ID: 1163276969

View in Genome Browser
Species Human (GRCh38)
Location 19:16290971-16290993
Sequence AGGGGTAAGTCAGCCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163276961_1163276969 21 Left 1163276961 19:16290927-16290949 CCTCGTATTCAAACAGAGTCGGT No data
Right 1163276969 19:16290971-16290993 AGGGGTAAGTCAGCCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163276969 Original CRISPR AGGGGTAAGTCAGCCAGTGC AGG Intergenic
No off target data available for this crispr