ID: 1163279268 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:16305468-16305490 |
| Sequence | CATCAGAGGAAGCTGGTGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1163279264_1163279268 | 8 | Left | 1163279264 | 19:16305437-16305459 | CCAAATGTACTGAGGTAGGGAAA | No data | ||
| Right | 1163279268 | 19:16305468-16305490 | CATCAGAGGAAGCTGGTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1163279268 | Original CRISPR | CATCAGAGGAAGCTGGTGGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||