ID: 1163279268

View in Genome Browser
Species Human (GRCh38)
Location 19:16305468-16305490
Sequence CATCAGAGGAAGCTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163279264_1163279268 8 Left 1163279264 19:16305437-16305459 CCAAATGTACTGAGGTAGGGAAA No data
Right 1163279268 19:16305468-16305490 CATCAGAGGAAGCTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163279268 Original CRISPR CATCAGAGGAAGCTGGTGGA AGG Intergenic
No off target data available for this crispr