ID: 1163280185

View in Genome Browser
Species Human (GRCh38)
Location 19:16311549-16311571
Sequence CCTTTTAAGCAGAAACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163280185_1163280187 30 Left 1163280185 19:16311549-16311571 CCTTCAAGTTTCTGCTTAAAAGG No data
Right 1163280187 19:16311602-16311624 CAGAATCTCACTCTGTCACCAGG 0: 53
1: 1102
2: 3599
3: 8325
4: 12779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163280185 Original CRISPR CCTTTTAAGCAGAAACTTGA AGG (reversed) Intergenic
No off target data available for this crispr