ID: 1163283925

View in Genome Browser
Species Human (GRCh38)
Location 19:16334424-16334446
Sequence CAGTGGCTGGGGAGGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163283925_1163283940 25 Left 1163283925 19:16334424-16334446 CCATTCTCCCTCCCCAGCCACTG No data
Right 1163283940 19:16334472-16334494 CTACAAATTTGAGCACTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163283925 Original CRISPR CAGTGGCTGGGGAGGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr