ID: 1163284046

View in Genome Browser
Species Human (GRCh38)
Location 19:16335289-16335311
Sequence TTACCCCCATTTCAAAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163284046_1163284053 20 Left 1163284046 19:16335289-16335311 CCTCTTCTTTGAAATGGGGGTAA No data
Right 1163284053 19:16335332-16335354 ACGGCCGGTGCCCTGGCCTTGGG No data
1163284046_1163284058 30 Left 1163284046 19:16335289-16335311 CCTCTTCTTTGAAATGGGGGTAA No data
Right 1163284058 19:16335342-16335364 CCCTGGCCTTGGGGGCCGCCCGG No data
1163284046_1163284054 21 Left 1163284046 19:16335289-16335311 CCTCTTCTTTGAAATGGGGGTAA No data
Right 1163284054 19:16335333-16335355 CGGCCGGTGCCCTGGCCTTGGGG No data
1163284046_1163284055 22 Left 1163284046 19:16335289-16335311 CCTCTTCTTTGAAATGGGGGTAA No data
Right 1163284055 19:16335334-16335356 GGCCGGTGCCCTGGCCTTGGGGG No data
1163284046_1163284050 5 Left 1163284046 19:16335289-16335311 CCTCTTCTTTGAAATGGGGGTAA No data
Right 1163284050 19:16335317-16335339 CAGAGCAGTGGGAGCACGGCCGG No data
1163284046_1163284051 13 Left 1163284046 19:16335289-16335311 CCTCTTCTTTGAAATGGGGGTAA No data
Right 1163284051 19:16335325-16335347 TGGGAGCACGGCCGGTGCCCTGG No data
1163284046_1163284048 -6 Left 1163284046 19:16335289-16335311 CCTCTTCTTTGAAATGGGGGTAA No data
Right 1163284048 19:16335306-16335328 GGGTAACAGCGCAGAGCAGTGGG No data
1163284046_1163284052 19 Left 1163284046 19:16335289-16335311 CCTCTTCTTTGAAATGGGGGTAA No data
Right 1163284052 19:16335331-16335353 CACGGCCGGTGCCCTGGCCTTGG No data
1163284046_1163284049 1 Left 1163284046 19:16335289-16335311 CCTCTTCTTTGAAATGGGGGTAA No data
Right 1163284049 19:16335313-16335335 AGCGCAGAGCAGTGGGAGCACGG No data
1163284046_1163284047 -7 Left 1163284046 19:16335289-16335311 CCTCTTCTTTGAAATGGGGGTAA No data
Right 1163284047 19:16335305-16335327 GGGGTAACAGCGCAGAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163284046 Original CRISPR TTACCCCCATTTCAAAGAAG AGG (reversed) Intergenic
No off target data available for this crispr