ID: 1163287217

View in Genome Browser
Species Human (GRCh38)
Location 19:16356211-16356233
Sequence GCAGAATTGTCTGCGCCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163287217_1163287222 -8 Left 1163287217 19:16356211-16356233 CCCCACGGCGCAGACAATTCTGC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1163287222 19:16356226-16356248 AATTCTGCACTCTGGGAATGTGG 0: 1
1: 0
2: 0
3: 30
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163287217 Original CRISPR GCAGAATTGTCTGCGCCGTG GGG (reversed) Intronic
900849835 1:5133770-5133792 ACAGATTTGTCTGGGGCGTGAGG - Intergenic
902104619 1:14024032-14024054 GCAGAATTTCCTTCTCCGTGGGG - Intergenic
903361581 1:22780449-22780471 GCAGAGTTGCCTGAGCCCTGGGG + Intronic
1084687989 11:70708484-70708506 CCAGAAATGTCTGCGGCATGTGG - Intronic
1090738936 11:129639156-129639178 GCAGAATTCTCTTCTCTGTGAGG - Intergenic
1110172359 13:72516952-72516974 GCACAATTCTCTGAGCCCTGTGG - Intergenic
1113144080 13:107187444-107187466 GCAGAATTATCTGCAGGGTGAGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1124692983 15:31841143-31841165 GCAGAATTGCCTGGGGTGTGTGG + Intronic
1132669567 16:1097050-1097072 GCAGATTTGTGTGCGACCTGGGG + Intergenic
1141577629 16:84974752-84974774 GCAGAAGCGTGTGCGCCGTTGGG - Intronic
1141689209 16:85587034-85587056 GCAGAATTGTGTGTGTGGTGGGG + Intergenic
1143481870 17:7231973-7231995 GCAGAATTTTGTGCCCAGTGAGG - Intronic
1150212090 17:63446898-63446920 GCAGTATCGTCTCCCCCGTGGGG - Intergenic
1151133195 17:71919719-71919741 GCAGAATTCACTGGGCCGTAAGG - Intergenic
1151282832 17:73089387-73089409 GCAGGATTGTCTGGGGCTTGTGG - Intronic
1156830328 18:41484032-41484054 GCAGAATTCTCTGCACAGCGGGG - Intergenic
1160775487 19:853258-853280 GCAGAAACGTCCGCGCGGTGCGG + Exonic
1161369785 19:3904450-3904472 GCAGAATTGTCTCTGCCTGGGGG - Intronic
1163287217 19:16356211-16356233 GCAGAATTGTCTGCGCCGTGGGG - Intronic
1163472720 19:17506665-17506687 GGAGAATTGCTTGCGCCGGGAGG + Intergenic
1167443049 19:49520847-49520869 GCAGAATTTGCTGCACCGTCAGG - Intronic
1167956781 19:53072041-53072063 GCAAAATTATCTGCTCTGTGTGG - Intronic
926060505 2:9801827-9801849 GCAGAATTTTCTAGGCTGTGTGG - Intergenic
927609870 2:24527685-24527707 GCAGAATTGCCTGAGTCATGTGG + Intronic
930049088 2:47200087-47200109 GCAAATTTGTCTGCACAGTGAGG - Intergenic
930357884 2:50344953-50344975 GCAGAATTGTGTGAGTCCTGAGG - Intronic
932851055 2:75187294-75187316 GCAGAATTATCTCTGCCCTGAGG - Intronic
945680892 2:212912896-212912918 TCAGAATTGTGATCGCCGTGGGG + Intergenic
1168808813 20:689297-689319 GCTGAATTGTCTTGGCCGTTTGG - Intergenic
1184830072 22:46979777-46979799 GCACAAATGTCAGCACCGTGAGG + Intronic
959618737 3:108377371-108377393 GTAGAATTGTCTGCTCCGACAGG - Exonic
965612661 3:170561195-170561217 CCAGAATTGTCAGCTCCCTGAGG + Intronic
969450675 4:7271299-7271321 GCTGAATTGTTAGGGCCGTGTGG - Intronic
970432782 4:16004136-16004158 GCAGAATTCTCTGCTTCTTGAGG - Intronic
981111056 4:140933919-140933941 GCAGAATTGTCCCCACAGTGTGG - Intronic
984413928 4:179433006-179433028 GCAGAAAGGTCTGCTCCTTGAGG + Intergenic
1003650181 6:7952103-7952125 GCAGAATTGTGTTAGCCTTGGGG - Intronic
1011580769 6:88861444-88861466 GCAGAATTTACTGAGCAGTGAGG - Intronic
1024131431 7:46356510-46356532 ACAGAATGGTCTGCGCTGTTAGG - Intergenic
1026607017 7:71825063-71825085 GCTGCATTGTTTGCGCTGTGGGG - Intronic
1027125598 7:75554697-75554719 ACAGAATTGTCTGCTCCTGGTGG + Intronic
1035039225 7:155915471-155915493 GCAGAATCCTCTGCACCATGGGG - Intergenic
1050575376 9:6989655-6989677 GCAGTATTGTCTTCTCTGTGAGG + Intronic
1060073682 9:120572936-120572958 GTAAAATTGTCTGGGCCTTGGGG - Intronic
1060771716 9:126336806-126336828 GCAGTGTTGTCTGCCCCGAGAGG - Intronic
1187676155 X:21718576-21718598 GCAGTATTTTCTGGGCTGTGAGG + Intronic
1189214804 X:39313865-39313887 ACAGAATCGTCTGCTCCTTGGGG + Intergenic
1191876763 X:65805777-65805799 GCTGAATGGTCTGAGCCCTGTGG - Intergenic