ID: 1163287562

View in Genome Browser
Species Human (GRCh38)
Location 19:16358002-16358024
Sequence CTGTCCTCAAGGCTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163287562_1163287575 28 Left 1163287562 19:16358002-16358024 CCCTCCACCAGCCTTGAGGACAG 0: 1
1: 0
2: 2
3: 23
4: 371
Right 1163287575 19:16358053-16358075 CCTGGATCCAAATCAAAGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 170
1163287562_1163287573 10 Left 1163287562 19:16358002-16358024 CCCTCCACCAGCCTTGAGGACAG 0: 1
1: 0
2: 2
3: 23
4: 371
Right 1163287573 19:16358035-16358057 AGCTGACAGTAATGTTCGCCTGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163287562 Original CRISPR CTGTCCTCAAGGCTGGTGGA GGG (reversed) Intronic
900339815 1:2182689-2182711 CTCCCCTCAAGCCTGGTGAATGG + Intronic
900674942 1:3879581-3879603 CTCTCCTCCTGGCTGGTAGATGG - Intronic
900920168 1:5665012-5665034 CCCTGCTCATGGCTGGTGGAGGG - Intergenic
901786176 1:11626286-11626308 CTGTCCTGCAGGCTGGAGGTGGG - Intergenic
902027335 1:13393851-13393873 CTGTCCTCAAGGTGGCTGGTGGG + Intergenic
902983194 1:20139903-20139925 CTGTCCTGAAGGCTGATGCGTGG + Intronic
903070014 1:20722475-20722497 CTGACCTGAAGGCTCTTGGAGGG - Intronic
903072570 1:20733832-20733854 CTGGACTCAAGGCTGGCAGATGG - Intergenic
903658089 1:24960992-24961014 CTACCCTCAGGGCTGGTGCATGG - Intronic
905672103 1:39798609-39798631 CTGTGGTAAAGGGTGGTGGATGG + Intergenic
906231149 1:44165699-44165721 CTGCACTCCAGGCTGGGGGACGG - Intergenic
907466994 1:54644837-54644859 CTGTCATCCAGGCTGGTGCCTGG + Intronic
910394302 1:86776552-86776574 CTGTCATCTAGGCTGGAGGGTGG + Intergenic
912310735 1:108618452-108618474 GTGTCCTCAAGGCTGCTGACAGG - Intronic
912462053 1:109841275-109841297 CTGTCCCCCAGGCTGGAGGGCGG - Intergenic
912757294 1:112334893-112334915 CTGTCACCAAGGCTGGAGTACGG - Intergenic
912953057 1:114133887-114133909 CTGAGCTCAAGGCTAGTGGAGGG - Intronic
914865539 1:151425018-151425040 TTGACCTCCAGGATGGTGGACGG - Exonic
916399181 1:164427524-164427546 CTGGCCTCAAAGTTGATGGATGG - Intergenic
917718877 1:177766203-177766225 CTGTCTTCTATGCTGGTGGTGGG - Intergenic
919767205 1:201135151-201135173 CTGTCCTCAGGGCTGGAGCTGGG + Exonic
919890153 1:201966323-201966345 CTGCACTCTAGGCTGGTCGATGG + Intronic
920159308 1:203983893-203983915 CTTTCCTGGAGGCTGTTGGATGG - Intergenic
920210011 1:204321113-204321135 CTGCCCACAAGGATGGTAGAGGG + Intronic
920366323 1:205450080-205450102 CCGTCCTCAGGGCTGGGGGAGGG - Intronic
922481247 1:225941176-225941198 CTGTCCTCTAGGGAGGTTGAAGG + Exonic
922561250 1:226571192-226571214 CTGTCTCCCAGGCTGGAGGACGG - Intronic
923548164 1:234939990-234940012 CTGCCGCCAGGGCTGGTGGATGG - Intergenic
924061806 1:240182951-240182973 CTGTCACCCAGGCTGGTGTATGG + Intronic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1063320264 10:5045743-5045765 CTGAGCTCCAGGCTGGTGCACGG + Intronic
1063320271 10:5045776-5045798 CTGAACTCCAGGCTGGTGCATGG + Intronic
1064135056 10:12743308-12743330 CTGTCACCCAGGCTGGAGGACGG - Intronic
1064208108 10:13341936-13341958 CTGTACTCAAGCCTGGGTGATGG + Intronic
1064577599 10:16761817-16761839 CTGTCGTCGAGGCTGGAGTATGG - Intronic
1066097520 10:32086253-32086275 CTGTCACCCAGGCTGGAGGAGGG - Intergenic
1067430509 10:46240484-46240506 CTGCCCTCAAGGCATGTGCATGG - Intergenic
1067685213 10:48462761-48462783 CTGTGCTCAAGGCTGATGAATGG - Intronic
1068235490 10:54227500-54227522 CAGGCCTCCAGGCTGGTGGTGGG + Intronic
1069075496 10:64034592-64034614 GAGTCCTCAAGGCTGGGAGAAGG + Intergenic
1069498848 10:68931347-68931369 CTGTCACCCAGGCTGGTGGGTGG + Intronic
1069603497 10:69724856-69724878 CTGTCCACAAGAATGGTGGTGGG + Intergenic
1069822363 10:71235668-71235690 CAGTCCTCAGGGCTGGAGGCTGG - Intronic
1071259365 10:83906083-83906105 CTGTCACCCAGGCTGGTGTACGG - Intergenic
1071434610 10:85635602-85635624 TTGTCCTCAGGGCTGGCTGAGGG - Intronic
1073320998 10:102616224-102616246 CTGTGCTCAGGGCTGCTGCACGG + Intronic
1075495197 10:122914001-122914023 CTGTCCCCCAGGCTGGTGTGCGG + Intergenic
1075541308 10:123316791-123316813 CTGTCTTCTGGGCTGTTGGAGGG - Intergenic
1076234939 10:128856227-128856249 CTGTCCTCCAAGTCGGTGGAGGG - Intergenic
1077072015 11:679276-679298 CTGCCCTCCAGCCTGGGGGATGG + Intronic
1077184662 11:1230751-1230773 CTGACCTCAGGGCTGGAGGGGGG - Intronic
1078559901 11:12362375-12362397 CTGTTTTCAAGGCTGGGGAAGGG + Intergenic
1079171941 11:18105204-18105226 CTGCACTCCAGGCTGGGGGACGG - Intronic
1081454400 11:43206940-43206962 CTGGCAGCAAGGCTGGGGGAGGG - Intergenic
1082277134 11:50233870-50233892 CTGTCACCAAGGCTGGAGTACGG - Intergenic
1083878627 11:65537578-65537600 TGGCCCTCAAGGCTGTTGGAAGG + Intronic
1084469052 11:69344569-69344591 CTGTCTTCATGGCCTGTGGATGG - Intronic
1085278096 11:75312778-75312800 CTGGCTTCAAAGCTGGAGGATGG + Intronic
1085348916 11:75785768-75785790 CTGTCCTTCAGGCAGGTGCATGG + Intronic
1088489590 11:110373999-110374021 CTGTCATCCAGGCTGGAGTACGG + Intergenic
1088744965 11:112797541-112797563 CTCTGCTCAAGGCTGGAGCATGG - Intergenic
1089150863 11:116363234-116363256 CTGTACTCCAGGCTAGTGGGGGG - Intergenic
1089581788 11:119485938-119485960 CTGTCCTCGCTGCTGGTAGAGGG + Intergenic
1089775617 11:120833492-120833514 CCTTCCACAAGGGTGGTGGAGGG - Intronic
1089896190 11:121932476-121932498 CTGTCCTCAGGGCTAATGCAGGG - Intergenic
1090253557 11:125267346-125267368 TTGTCCTGAAGGCTTGTAGAGGG + Intronic
1090404290 11:126467770-126467792 CTGGCCTCAAGGCTGGATGCAGG - Intronic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1091773521 12:3169246-3169268 TTGACCTCAGGGCTGGGGGAAGG + Intronic
1091993772 12:4977051-4977073 CTGCCCTGAAGGCTGGGGAAGGG + Intergenic
1093931687 12:24960727-24960749 CTCTCCTCAAGCCTGAAGGAAGG - Intergenic
1094446171 12:30532966-30532988 CTGTCTACAAGGCTGATGCACGG + Intergenic
1095685261 12:45025945-45025967 CAGTCATCAAGGCTGGGGAAAGG + Intronic
1096033496 12:48442514-48442536 CTGTGTTCAGGGCTGGTGGGGGG - Intergenic
1096237702 12:49940857-49940879 CTGTCTTCAAGGCAGGTGGCAGG + Intergenic
1096412024 12:51383910-51383932 CTTTCTCCAAGGCTGGTGGAGGG - Intronic
1098088561 12:66875612-66875634 TTGTCTTCAAGGCTGTTGAAAGG + Intergenic
1098440002 12:70507607-70507629 CAGTCTTCCAGACTGGTGGAAGG + Intergenic
1099300601 12:80890045-80890067 CTGTTCTAAAGGCTGGTAGATGG - Intronic
1100387755 12:94119308-94119330 CTGTACTCCAGCCTGGTTGACGG - Intergenic
1101911622 12:108864230-108864252 CTGTGCTCCAGCCTGGTTGATGG + Intronic
1102163420 12:110787409-110787431 CTCTCCCAAAGGCTGTTGGAGGG - Intergenic
1102182701 12:110924136-110924158 CTGCCCTCAAGGCTGGGTGGCGG + Intergenic
1102448079 12:113018891-113018913 CTGTCATCCAGGCTGGAGGCTGG - Intergenic
1103488390 12:121297387-121297409 CGGCCCTAAAGGCTGGGGGAAGG + Intronic
1103530316 12:121596633-121596655 CTGTCACCCAGGCTGCTGGAGGG + Intergenic
1103956562 12:124580432-124580454 CCGTCCTAAAGGCTGGTTGGGGG + Intergenic
1103992296 12:124807356-124807378 CTGGCCTCAAAGGTGGAGGAAGG + Intronic
1103994558 12:124820655-124820677 GTGTCCCCCAGGCTGGTGAAGGG - Intronic
1104978443 12:132562324-132562346 GTGGCCGCAAGGCTGGGGGAGGG + Intronic
1105273633 13:18901152-18901174 CTGTACTCCAGGCTGGGTGATGG + Intergenic
1106123278 13:26879833-26879855 CTGTTCTTAGTGCTGGTGGAAGG - Intergenic
1106175313 13:27325314-27325336 CTGTAGTTATGGCTGGTGGAAGG + Intergenic
1108598520 13:51970896-51970918 CTGTCCTCCAGGATGGCTGAGGG - Intronic
1108923160 13:55701875-55701897 CTGTCATCCAGGCTGGAGTACGG + Intergenic
1109868626 13:68301691-68301713 CTGACCTCTATGATGGTGGAGGG - Intergenic
1112896538 13:104306253-104306275 CTGTCACCCAGGCTGGAGGAGGG - Intergenic
1113666137 13:112143196-112143218 CTGGCCTCAGGGCTGGTACATGG + Intergenic
1114130413 14:19785523-19785545 CTGTTTTCAAGACTGGTGGTGGG + Intronic
1114445262 14:22783435-22783457 CTGTACTCCAGCCTGGGGGACGG - Intronic
1115865065 14:37736789-37736811 CTGTACTCCAGCCTGGTAGATGG - Intronic
1117137222 14:52747953-52747975 CTGTACTCCAGCCTGGTTGACGG + Intronic
1119068203 14:71552111-71552133 CTGTCCTAAAGCCTGGGGAAAGG - Intronic
1119739680 14:77006251-77006273 CTGACAGCAAAGCTGGTGGAAGG - Intergenic
1121791728 14:96704276-96704298 ATGACCTCAAGGCAGATGGAGGG + Intergenic
1122153498 14:99737217-99737239 CTGTCTCCAAGGCTGCAGGAAGG - Intergenic
1122157574 14:99759432-99759454 CTGCCCTCCAGGCTGGCTGAGGG - Intronic
1122214616 14:100194614-100194636 CTGTCTTCAAGGTTGGAGGCTGG + Intergenic
1122342893 14:101039900-101039922 GTCTCCTCAAGGCGGGTGGGTGG - Intergenic
1122389202 14:101368775-101368797 CTGTCCTAAGGGCTGGTGTGGGG + Intergenic
1122614085 14:103004830-103004852 CTGTCGTCCAGGCTGGAGTACGG - Intronic
1123028460 14:105439548-105439570 CTGTCCTCAGGGGTGGTGGGTGG + Intronic
1123163981 14:106308342-106308364 CTGTCACCAAGGCTGGTGTGTGG + Intergenic
1123449469 15:20350940-20350962 GGGTCCCCAGGGCTGGTGGAGGG - Intergenic
1125530771 15:40412047-40412069 CTGTTGTCAAGGCTGTTGCAGGG - Intronic
1125539259 15:40460276-40460298 CTTTCCTCAAGGAGGGTAGAAGG - Intronic
1125891510 15:43270403-43270425 CTCTCCTCAAGGTTGGGGCATGG - Intergenic
1126615744 15:50577515-50577537 CTGTCGTCCAGGCTGGAGTAGGG - Intronic
1127206110 15:56720997-56721019 CTGCACTCAAGGCTGGTCAATGG - Intronic
1127758324 15:62113950-62113972 CTGCCCTGAGGGCAGGTGGAGGG - Intergenic
1128471927 15:67961730-67961752 CTGTCTTCCATGCTGGGGGATGG + Intergenic
1128771639 15:70287055-70287077 CTGTCACCCAGGCTGGTGGAGGG + Intergenic
1129242306 15:74258969-74258991 CTACCCTCCAGGCTGCTGGAAGG - Intronic
1130162862 15:81419019-81419041 CTTTCCTCCTGGCTGGTAGATGG - Intergenic
1130894798 15:88161617-88161639 CTCTCCTCCATGCTAGTGGATGG - Intronic
1131118803 15:89810340-89810362 CTGTACTCCAGCCTGGGGGACGG + Intronic
1132084052 15:98892050-98892072 CTGGTCTCAAGGATGGTGGTGGG - Intronic
1132455671 16:20864-20886 GTGGCAGCAAGGCTGGTGGAGGG - Intergenic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132494349 16:253999-254021 CTGTGCTTGAGGCTGGTGGAAGG + Intronic
1132547173 16:538666-538688 CTGTCCCCAAGGCTGTGGGGAGG + Intronic
1134229072 16:12415261-12415283 CTGTCCTGAAGGCTGGGGAGTGG + Intronic
1135987024 16:27191365-27191387 CTGCCATCAAGGCTGGTGTTCGG + Intergenic
1136186477 16:28591508-28591530 CTGTGGTCTAGGCTGGGGGAAGG + Intronic
1136188964 16:28604232-28604254 CTGTGGTCTAGGCTGGGGGAAGG + Intergenic
1136571190 16:31097952-31097974 CTGTCATCCAGGCTGGAGTACGG + Intergenic
1137804266 16:51288629-51288651 CTGGCTGGAAGGCTGGTGGAAGG - Intergenic
1139119483 16:63998172-63998194 CTGTACTCCAGCCTGGTTGATGG + Intergenic
1139310989 16:66027926-66027948 CTGTCATCCAGGCTGGAGTATGG - Intergenic
1140336352 16:74108518-74108540 CTGTCCCCCAGGCTGGAGAACGG - Intergenic
1141953690 16:87355796-87355818 TTGTCCCCGAGGCAGGTGGAGGG - Intronic
1142149056 16:88504785-88504807 CTGTCCTCAAGGCCTCTGAAAGG + Intronic
1142168323 16:88605562-88605584 CTGACCTCAACCCAGGTGGAGGG - Intronic
1142834932 17:2578038-2578060 CTGTCGTCCAGGCTGGAGTACGG - Intergenic
1143086285 17:4418489-4418511 CTGTGCTCCAGGCTGGAGTACGG + Intergenic
1143947453 17:10605580-10605602 CAGTCCTGCAGGCTGGCGGAAGG + Intergenic
1144518826 17:15940773-15940795 CTGTGCTCATGGTTGGTGTAGGG + Intergenic
1144708740 17:17386725-17386747 CTGTGCTCATGGCTGCTGGGGGG - Intergenic
1145239399 17:21231264-21231286 CTGTCTCCCAGGCTGGAGGATGG - Intergenic
1145817007 17:27802553-27802575 GTGTCCTCAAGCCTGGTGCTTGG - Intronic
1145947522 17:28788273-28788295 CTGTCATCCAGGCTGGAGTATGG + Intronic
1147773270 17:42882560-42882582 CTGTCCTTCAGGCTGGGGTACGG - Intergenic
1148749125 17:49934704-49934726 CTGTGCCCAAGGCTGGGGGTGGG + Intergenic
1148954520 17:51342837-51342859 CTGCCCTTCAGGGTGGTGGAAGG + Intergenic
1148971818 17:51490452-51490474 CTGTCATCAGGGTTGATGGAGGG - Intergenic
1149745522 17:59093929-59093951 CTGCACTCAAGCCTGGGGGAGGG - Intronic
1149983837 17:61332365-61332387 CTGACCTCTCGGATGGTGGAGGG - Intronic
1150336095 17:64331868-64331890 CTGTTCTCGAAGGTGGTGGAGGG + Intronic
1151610936 17:75174352-75174374 CTGTACTCAAGCCTGGGCGATGG + Intergenic
1151737724 17:75955197-75955219 CTGTCATCTAGGCTGGAGTACGG + Intronic
1152451520 17:80384261-80384283 CTGTCCACAATGCTGGAGCATGG + Intronic
1152859268 17:82686139-82686161 CTGTCATCCAGGCTGGAGGCTGG + Intronic
1152896475 17:82914237-82914259 CTGCTCTGAAGGATGGTGGAGGG + Intronic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1153539329 18:6136862-6136884 CTGTCCTCGTTACTGGTGGAGGG - Intronic
1153837009 18:8972342-8972364 CTGTCCTCAGGGCTGGAGGCTGG + Intergenic
1154170524 18:12047493-12047515 CGTTCCCCAAGGCTGGGGGATGG - Intergenic
1154170554 18:12047590-12047612 CATTCCCCAAGGCTGGGGGATGG - Intergenic
1154316750 18:13310316-13310338 CTGTCACCCAGGCTGGAGGAGGG - Intronic
1154465392 18:14638712-14638734 CTGTACTCCAGGCTGGGTGATGG + Intergenic
1158953924 18:62522831-62522853 CGGTCCTAAAGGCTGGTGCTCGG - Intergenic
1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG + Intergenic
1160486259 18:79295818-79295840 GTGTCCTCAGGGCTGGGAGAGGG - Intronic
1160871225 19:1278798-1278820 CTTCCCTCATGGCTGCTGGAAGG - Exonic
1161199762 19:3008043-3008065 CTGTCCCCCAGGCTGGAGTACGG - Intronic
1162042331 19:7978366-7978388 CTGACCTCCAGGGTGGGGGAGGG + Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162930610 19:13955761-13955783 CTGTCCTCAGGCAAGGTGGAGGG + Intronic
1163287562 19:16358002-16358024 CTGTCCTCAAGGCTGGTGGAGGG - Intronic
1163704174 19:18802803-18802825 CTGTCCTCCAGGCTGGAGTGCGG + Intergenic
1163809056 19:19419050-19419072 CTGAATTCAAGGATGGTGGAGGG - Intronic
1163987206 19:20964829-20964851 CTGTCCTCCAAGCTGGCAGAAGG - Intergenic
1164840073 19:31386673-31386695 CTGGCCACTTGGCTGGTGGATGG - Intergenic
1165053757 19:33160550-33160572 CTGTGCTCAATGCTGGTTGCTGG + Intronic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165356282 19:35306080-35306102 CTGTCATCCAGGCTGGAGTAGGG - Intronic
1165492127 19:36130016-36130038 CTGTCATCCAGGCTGGAGTATGG + Intergenic
1166661474 19:44650006-44650028 GTGCCCTCAAGCCAGGTGGACGG + Exonic
1166759702 19:45217057-45217079 CTGTCCTCCAGGCTGGAGTGTGG + Intronic
1166791932 19:45403893-45403915 CTGTCCTTGAGGCGGGGGGAGGG - Intronic
1167300396 19:48674335-48674357 CTGTGCTCTAGGTTGTTGGAAGG + Intergenic
1167399405 19:49255071-49255093 TTGTCCTCAGGGCAGGTGGAAGG + Intergenic
1167726056 19:51213571-51213593 CTGTCGTCCAGGCTGGAGCACGG + Intergenic
1168013984 19:53556672-53556694 CTGTCATCAAGGCTGGAGTGCGG + Intronic
1168032976 19:53695996-53696018 CTGACCTCCAGCCTGATGGACGG - Intergenic
1168322468 19:55518296-55518318 CTGTCCCCAAGGAGGTTGGAAGG - Exonic
925041898 2:738706-738728 CTGGCCTCAGGGCTGGGGCAGGG + Intergenic
925662197 2:6213979-6214001 CTGCCCTCCAGCCTGGGGGACGG + Intergenic
925870663 2:8267134-8267156 CTGTCTTCAAGTCTGAGGGAGGG + Intergenic
925936896 2:8772437-8772459 CTGTCCTCCAGGCTGGAGTGCGG - Intronic
926565980 2:14474588-14474610 CTGTACTCCAGCCTGGTTGACGG + Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
927478922 2:23435049-23435071 ATGTCCTCAGGGCTGGTGTGAGG + Intronic
928106889 2:28476399-28476421 CTGACCTCATGGCTGGGGCAGGG - Intronic
928504256 2:31933276-31933298 CTGTCATCCAGGCTGGTGTGTGG - Intronic
929791047 2:45023446-45023468 GTGAGCTCAGGGCTGGTGGAGGG - Intergenic
930322382 2:49872999-49873021 CTGTCATCCAGGCTGGAGTACGG + Intergenic
931198080 2:60072172-60072194 CTGTCCTTAAGGCTGCATGAGGG - Intergenic
931271353 2:60706195-60706217 ATGACTTCAAGGTTGGTGGATGG - Intergenic
932042804 2:68318781-68318803 CTGCCCGCAAGGCTGAAGGAGGG - Intronic
932338336 2:70943647-70943669 CAGTCCTGTAGGCTGGGGGAGGG - Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934573877 2:95388549-95388571 CTGTCCTCAGGGCAGGGTGAGGG - Intergenic
934811629 2:97283904-97283926 CTGCATTCGAGGCTGGTGGAGGG + Intergenic
934826062 2:97424036-97424058 CTGCATTCGAGGCTGGTGGAGGG - Intergenic
935010365 2:99129550-99129572 TTGCCCCCAAAGCTGGTGGAGGG - Intronic
935169822 2:100602318-100602340 CTGTCCTCCAGGCTGGAGGGCGG - Intergenic
935173921 2:100631434-100631456 CTGTCACCCAGGCTGGAGGAGGG + Intergenic
935582904 2:104774264-104774286 CTGCCCTCAGTGCTGGTGTAGGG + Intergenic
935985342 2:108667066-108667088 CTTTCCTGAAGGCTGGAGGGTGG + Intronic
936137773 2:109910721-109910743 CTTTCCTGAAGGCTGGAGGGTGG + Intergenic
936206924 2:110460764-110460786 CTTTCCTGAAGGCTGGAGGGTGG - Intronic
936954318 2:118009332-118009354 CTGTCGTCCAGGCTGGAGTACGG - Intronic
937196764 2:120164249-120164271 CTGTCATCCAGGCTGGAGTACGG + Intronic
937977513 2:127590651-127590673 CTGTCTGCAGGGCTGGTGAAAGG - Intronic
940331074 2:152475529-152475551 CTGTCATCCAGGCTGGAGTACGG + Intronic
943806010 2:192127093-192127115 CTGTCAGAAAGCCTGGTGGAGGG - Intronic
944752441 2:202724092-202724114 CTGTCATCCAGGCTGGAGTACGG + Intronic
945816681 2:214613487-214613509 CTGTACTCCAGCCTGGGGGATGG - Intergenic
946411734 2:219518587-219518609 CTGTCTACAAGGCTGGGGGTGGG - Intronic
947546115 2:231011584-231011606 CTGTCCTCAAGGGTGGGGGTGGG - Intronic
948592378 2:239059780-239059802 CTGTGCTCCAGGCTGGTGGGTGG - Intronic
948592392 2:239059823-239059845 CTGTCCTGCAGGCTGGTGGATGG - Intronic
948592406 2:239059866-239059888 CTGTCCTGCAGGCTGGTAGGTGG - Intronic
948592419 2:239059909-239059931 CTCTCCTGCAGGCTGGTGGGTGG - Intronic
1168792957 20:592190-592212 CCCTCCTCAAGGCTGGTGTATGG + Intergenic
1170786551 20:19472542-19472564 GCGTCCTCATGGCTGGAGGAGGG - Intronic
1171487072 20:25493048-25493070 CTGTCCTGGAACCTGGTGGAGGG - Intronic
1172013451 20:31859820-31859842 CAGTCCTCCAGGCTGGTTAATGG - Intronic
1173669196 20:44786046-44786068 CTGTCCTCAAGGGGGCAGGAAGG + Intronic
1174112632 20:48206696-48206718 ATGTCCTCTCGGATGGTGGAAGG + Intergenic
1174650887 20:52124644-52124666 CTGTACTCCAGGCTGGGTGATGG - Intronic
1174959620 20:55140488-55140510 CTTTCCTCAAGGCTGTTTGGAGG + Intergenic
1176082838 20:63282514-63282536 CTGTCCTGAAGTCTGGAGGATGG + Intronic
1176809149 21:13519674-13519696 CTGTACTCCAGGCTGGGTGATGG - Intergenic
1176861215 21:14012512-14012534 CTGTCACCAAGGTTGGTGGGTGG + Intergenic
1179023007 21:37656729-37656751 CTGTCCTCAAAACTTGAGGATGG + Intronic
1179242097 21:39601706-39601728 CTGTCAGCACGGCTGGTGGGAGG + Intronic
1179464568 21:41563026-41563048 CTGGTCCCAAGGCTGTTGGATGG - Intergenic
1179721717 21:43320059-43320081 GTGTTCTCAAGGCTGGGGAAAGG + Intergenic
1179941334 21:44640370-44640392 GTGTGACCAAGGCTGGTGGAGGG + Intronic
1180623055 22:17174797-17174819 CTGTACTCCAGCCTGGGGGATGG + Intergenic
1181518672 22:23432983-23433005 CTCTCCTCCCGGCTTGTGGACGG + Intergenic
1182386983 22:29952128-29952150 CTTTACTCAAGGCGGGTAGATGG - Intronic
1182560059 22:31152682-31152704 CTGTCACCCAGGCTGGAGGAGGG - Intergenic
1182680292 22:32074200-32074222 TTGTCCTCAGAGCTGGTGCAGGG + Intronic
1183155610 22:36072609-36072631 CTGTCATCCAGGCTGGAGCACGG - Intergenic
1183265570 22:36823202-36823224 CTGGCCTCCCAGCTGGTGGAGGG + Intergenic
1183832816 22:40427841-40427863 CTTTCCTGGAGGTTGGTGGATGG - Intronic
1184117395 22:42430224-42430246 CTGCACTCCAGCCTGGTGGACGG + Intronic
1184120139 22:42444671-42444693 CTGTCAGGAAGGCTGGGGGAGGG - Intergenic
1184522317 22:45002447-45002469 CTCTGCTGAAGGCTGGGGGAGGG + Intronic
949430515 3:3970758-3970780 CTGTCCTCAAAGCTGGGTGTGGG + Intronic
949536100 3:4997445-4997467 CTGTCCCCCAGGCTGGAGGGCGG + Intergenic
950407216 3:12812258-12812280 CTGTCCCCCAGGCTGGAGTACGG + Intronic
950614918 3:14150713-14150735 CTGTCCTCAGGGCTGGGCAATGG - Intronic
950686304 3:14620894-14620916 CTGTGCTCAAGACAGGTGCATGG + Intergenic
952642623 3:35615225-35615247 CTGTCCCCCAGGCTGGAGGCTGG - Intergenic
953018973 3:39101831-39101853 CAGTCCTGTAGCCTGGTGGAAGG - Intronic
953543026 3:43839587-43839609 CTGTCCTGACTGCTGCTGGAAGG + Intergenic
955056805 3:55462151-55462173 CTCTGCTCCAAGCTGGTGGAGGG + Intergenic
955285580 3:57638095-57638117 CTGTCTTCCAGGCTGGAGTACGG - Intronic
955517519 3:59742458-59742480 CTCTCCTCTTGGCTTGTGGATGG + Intergenic
955901446 3:63760040-63760062 CTGTCCCCAAGGCTGGAGTGCGG + Intergenic
956137611 3:66114576-66114598 CTGCCCTCCAGGCTGGGCGATGG - Intergenic
957391475 3:79577873-79577895 CTGTCTTCCAGGCTGGAGGGCGG - Intronic
957667626 3:83254054-83254076 CTGTCTCCCAGGCTGGAGGAGGG - Intergenic
958180974 3:90060625-90060647 TTGTCCTCTAGGCAGGGGGAAGG + Intergenic
960797916 3:121507888-121507910 CTGTCACCAAGGCTGGAGCATGG + Intronic
961058646 3:123810232-123810254 CTGTCCTGAGGTCTGGGGGAGGG - Intronic
963495056 3:146047773-146047795 CTTGCCTGAAGGCTGGTGCAGGG - Intergenic
965677028 3:171208282-171208304 CTGTCCTCCAGGCTGGAGTGCGG - Intronic
967065674 3:185913017-185913039 CTGTCCCCCAGGCTGGAGTACGG - Intergenic
968130960 3:196192569-196192591 CTGTCCACCAGGCTGGAGGCGGG - Intergenic
969521422 4:7679983-7680005 CTGTCCTCAGGGCAGGTAGAAGG - Intronic
970295626 4:14626544-14626566 CTGTCGGCCAGGCTGGTGGCTGG + Intergenic
971063051 4:22994024-22994046 CTGTCCCCTAGGCTTGAGGAGGG - Intergenic
973858672 4:55039166-55039188 GTGTCCTCTATGCTGATGGAGGG - Intergenic
974146081 4:57949067-57949089 CTGTCCTCAAGGGAGAGGGAAGG - Intergenic
974357003 4:60825419-60825441 CTGCACTCCAGGCTGGTTGATGG + Intergenic
974446130 4:61984528-61984550 CTGTCATCCAGGCTGGAGTAAGG - Intronic
974899093 4:67974478-67974500 CTGTACTCCAGCCTGGGGGATGG - Intergenic
975400321 4:73929953-73929975 GGGTCCTCAAGGAGGGTGGAGGG + Intergenic
975924474 4:79432337-79432359 CAGTCCTCCAAGCTGTTGGAGGG + Intergenic
976180680 4:82396016-82396038 CTGCACTCAAGCCTGGGGGAGGG - Intergenic
978861440 4:113454462-113454484 CTGTTCTCAAGGCACCTGGATGG - Exonic
979121446 4:116907228-116907250 CTCTCCTCAAGGTTGGTGAATGG + Intergenic
981692240 4:147522505-147522527 CTGCACTCCAGGCTGGGGGATGG + Intronic
985045729 4:185938742-185938764 CTGGCCTCCAGGCTGCTGGGGGG - Intronic
985276465 4:188242551-188242573 CTGTCCTCAAAGCTGCCTGAAGG + Intergenic
985690323 5:1306200-1306222 CTGTCACCAAGGCTGGTGTGTGG + Intergenic
986811014 5:11359912-11359934 CTCTACTCCAGGCTTGTGGATGG - Intronic
989002330 5:36774284-36774306 CTGTCCTCCAGGCTGGAGTGCGG + Intergenic
989162478 5:38404743-38404765 CTGCCCTAAAGGCTGGTGCCTGG + Intronic
990571157 5:57080101-57080123 CTGTCCCCCAGGCTGGTGTGTGG - Intergenic
993504294 5:88692274-88692296 CTGTCCTCAAGGGTTGGGGGAGG + Intergenic
993891354 5:93478438-93478460 CTGTCATCCAGGCTGGAGTACGG + Intergenic
994381180 5:99073604-99073626 CTGTCATCCAGGCTGGAGTATGG + Intergenic
999128488 5:149264659-149264681 CTGTCTCCATGGCTTGTGGATGG - Intergenic
1001774134 5:174316010-174316032 CAGTCCTCAATACTGGTGTAGGG + Intergenic
1002502917 5:179658725-179658747 CTGCCAGCAAGGCTGGGGGAGGG - Intergenic
1002540030 5:179900464-179900486 CTGTCTTCATGCCTGGTGGGTGG - Intronic
1003390561 6:5709339-5709361 CTGCCCTCACAGCTGGTTGAAGG + Intronic
1003862534 6:10335579-10335601 CTGTCCTCTTGGCTTGTAGATGG - Intergenic
1003930275 6:10918159-10918181 CTGTCGTCCAGGCTGGAGTAAGG - Intronic
1004061728 6:12204449-12204471 CTGTGCCCAAGCCTGGTGCATGG + Intergenic
1005209417 6:23443367-23443389 GTCTCCTCAGGGCTGGGGGAAGG - Intergenic
1005246459 6:23891349-23891371 CTGTCCAGAAGCCTGGTGGGGGG - Intergenic
1005344259 6:24873908-24873930 CTGTCATCCAGGCTGGAGTATGG + Intronic
1006491923 6:34394798-34394820 CTGCACTCCAGCCTGGTGGACGG + Intronic
1006531945 6:34663055-34663077 CTGTCATCCAGGCTCGTGTAGGG - Intronic
1006664573 6:35683198-35683220 CTGTCCCCCAGGCTGGAGTATGG + Intronic
1007144532 6:39615134-39615156 CTGTCCTCCAGTCTGGGAGACGG + Intronic
1007216612 6:40244928-40244950 CTGCTCTCAAAGCTGGTGGGTGG + Intergenic
1010116237 6:72316252-72316274 CTGTGCTCCAAGCTGGGGGAGGG - Intronic
1012457085 6:99419114-99419136 CTGGCACCCAGGCTGGTGGAGGG - Intronic
1013812706 6:114062848-114062870 CAGTCCTGAAGGTTGATGGAGGG - Exonic
1015592119 6:134832185-134832207 CTGTCGCCCAGGCTGGAGGACGG - Intergenic
1016258805 6:142143046-142143068 CTGCCCTCTAGCCTGGGGGACGG + Intergenic
1016474306 6:144409728-144409750 CTCCCCTCATGGCTGGTGGATGG - Intronic
1018910478 6:168098557-168098579 CGGTCACCAAGGCTGGTGGGGGG - Intergenic
1019155844 6:170038384-170038406 CTGCCCTCAGGGCTGCTGGGGGG + Intergenic
1019339061 7:499741-499763 CTGTGCTCCAGGCTGGAAGAAGG - Intronic
1019599889 7:1875960-1875982 CTCTCCTCCCGGCTTGTGGACGG - Intronic
1019997763 7:4735627-4735649 CTTTCCGCCGGGCTGGTGGACGG + Intronic
1020174303 7:5869970-5869992 CTCTTGTCAAGGCTGGAGGATGG - Intergenic
1022941735 7:35248704-35248726 CGGTCCTCCTGGCTGGTGGCTGG - Exonic
1023289891 7:38657830-38657852 CTGTCATCCAGGCTGGAGGGTGG + Intergenic
1024346527 7:48320010-48320032 CTGTCTTTAAGGCTGATAGATGG - Intronic
1024537241 7:50447770-50447792 CTGTCACCCAGGCTGCTGGAGGG + Intronic
1025021207 7:55481495-55481517 CTGGCCTCAAGGCTCCTGGCTGG + Intronic
1026459840 7:70604262-70604284 CTCTCCTCCAGGCTGGTGATGGG + Intronic
1026573561 7:71553288-71553310 CTGTCCCCCAGGCTGGAGGGAGG - Intronic
1026811736 7:73472977-73472999 CTGTCCCCCAGGCTGGAGTACGG + Intronic
1026918261 7:74136200-74136222 CTGTACTCCAGCCTGGGGGACGG - Intergenic
1026942802 7:74297438-74297460 CTGTCCCCCAGGCTGGAGGGTGG - Intronic
1026948075 7:74328678-74328700 CTGTACTCAAGGCAGAAGGATGG + Intronic
1029084455 7:98000403-98000425 CTCTTGTCAAGGCTGGAGGATGG + Intergenic
1029684962 7:102140826-102140848 CTGTACTCCAGCCTGGGGGATGG + Intronic
1030343718 7:108409558-108409580 CTGTCCTCAGGCCTGGTGCCTGG - Intronic
1033190805 7:139277024-139277046 CTGTCCCCCAGGCTGGAGGGCGG - Intronic
1033729845 7:144166942-144166964 CTGTTGTCCAGGCTGGTGTATGG - Intergenic
1035640897 8:1184509-1184531 CTGTTCTCAGGGCAGTTGGAGGG + Intergenic
1036450881 8:8866353-8866375 CTGTCCTCTAGGCTGGAGTACGG + Intronic
1036646934 8:10616814-10616836 CGGGCCTCACGCCTGGTGGAGGG - Intronic
1037431011 8:18813193-18813215 CTGACTTAAAAGCTGGTGGAAGG + Intronic
1038618093 8:29114494-29114516 CTGTCCTTAGGGGTGGTGAAGGG + Intronic
1040874967 8:52141685-52141707 CTGTCCCCAAGGCTTCTGCAGGG - Intronic
1041179221 8:55230397-55230419 CTGCACTCAAGGCTGGGTGATGG - Intronic
1041748783 8:61236912-61236934 CTGCCTACAATGCTGGTGGATGG + Intronic
1041940093 8:63377395-63377417 CTGTCCACCAGGCTGGAGTAGGG - Intergenic
1042561978 8:70079103-70079125 CTGTCCTCCAGCCTGGATGATGG - Intergenic
1042664517 8:71191174-71191196 TTGTCAGCAAGGCTTGTGGAGGG + Intergenic
1043841919 8:85116408-85116430 CTGTCATCCAGGCTGGAGTATGG + Intronic
1044191149 8:89319292-89319314 CTCTCTTCTAGGCTGGTAGATGG + Intergenic
1046207598 8:111021914-111021936 CTGTCCCCCAGGCTGGAGGGGGG - Intergenic
1047950787 8:129932980-129933002 CTATCCTCTGGGCTGGTGGAAGG + Intronic
1048989889 8:139755059-139755081 GTGACCTCAAGGCTGGCCGAGGG - Intronic
1049210990 8:141386321-141386343 GTGGCCTCAAGGGTGGTGGAGGG - Intergenic
1049791297 8:144473891-144473913 CCGTGCTCCAGGCTGGGGGAGGG - Exonic
1053379143 9:37635215-37635237 CTTTCTTCAAGGTTGGTGCAAGG - Intronic
1057024933 9:91727616-91727638 CTGACCCTAAGCCTGGTGGAAGG + Intronic
1058886278 9:109323538-109323560 CTGTCCCCCAGGCTGGAGCACGG + Intergenic
1060111103 9:120906903-120906925 CTGTACTCCAGCCTGGGGGACGG - Intronic
1060818034 9:126645661-126645683 GTGTGCTCAAGGCTCCTGGAGGG - Intronic
1061163918 9:128911589-128911611 CTGTCCTCCTGGTTGGGGGAGGG + Intronic
1061286740 9:129627794-129627816 CTGTCCACTAGGCTGCTAGAGGG + Intronic
1061964992 9:134008397-134008419 CTGTCCCCCAGGCTGGAGTACGG + Intergenic
1062150130 9:135013902-135013924 CTGGCCTCAGGGCTCCTGGAGGG - Intergenic
1186852850 X:13597410-13597432 CTGGCCTCTATGCTGGTGGCAGG - Intronic
1187168883 X:16831355-16831377 CTGTACTCATGGCTGGGTGATGG + Intronic
1187254449 X:17629596-17629618 CTGGCATCAGGCCTGGTGGATGG + Intronic
1187542735 X:20214058-20214080 CTTTCCCCAAGAATGGTGGAAGG - Intronic
1189773341 X:44447716-44447738 CTGTCACCCAGGCTGGTGTATGG + Intergenic
1189987956 X:46570735-46570757 CTGTCACCCAGGCTGGTGGAAGG - Intergenic
1195933411 X:110102313-110102335 CTGTCACCCAGGCTGGAGGACGG - Intronic
1196174966 X:112630386-112630408 CTGTGCTCAAGGTCGATGGATGG - Intergenic
1196847667 X:119909489-119909511 CTGTACTCAAGCCTGGGTGACGG + Intronic
1197443521 X:126519784-126519806 CTGTCTTCTCGGCTGGTTGATGG - Intergenic
1198079597 X:133226826-133226848 CTGTCCGGAAGGTTGGGGGAGGG - Intergenic
1198242142 X:134796994-134797016 CTGTCCTCGAGGCGGGAGGGGGG - Intronic
1198734417 X:139770814-139770836 GTGTCCTCAGGGCTGTTGAATGG + Intronic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1200400701 X:156018864-156018886 GTGGCAGCAAGGCTGGTGGAGGG + Intergenic
1201395772 Y:13546118-13546140 CTGTACTCCAGCCTGGGGGATGG + Intergenic