ID: 1163287602

View in Genome Browser
Species Human (GRCh38)
Location 19:16358174-16358196
Sequence TTGGAAACACAGACCCGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163287602_1163287604 -5 Left 1163287602 19:16358174-16358196 CCTTGACGGGTCTGTGTTTCCAA 0: 1
1: 0
2: 0
3: 14
4: 99
Right 1163287604 19:16358192-16358214 TCCAAATGAAAGGTGTCAGCAGG 0: 1
1: 1
2: 8
3: 166
4: 948
1163287602_1163287608 25 Left 1163287602 19:16358174-16358196 CCTTGACGGGTCTGTGTTTCCAA 0: 1
1: 0
2: 0
3: 14
4: 99
Right 1163287608 19:16358222-16358244 CTGGTGCCTTCAGAGTCGACCGG 0: 1
1: 0
2: 1
3: 9
4: 113
1163287602_1163287606 6 Left 1163287602 19:16358174-16358196 CCTTGACGGGTCTGTGTTTCCAA 0: 1
1: 0
2: 0
3: 14
4: 99
Right 1163287606 19:16358203-16358225 GGTGTCAGCAGGAAAGTTCCTGG 0: 1
1: 0
2: 1
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163287602 Original CRISPR TTGGAAACACAGACCCGTCA AGG (reversed) Intronic
901886248 1:12225327-12225349 TTGGAAACACTGAACCTTTAGGG + Intergenic
903459280 1:23509378-23509400 TTGGAAACCCAGACCTGCCCTGG + Exonic
905645859 1:39624834-39624856 TTGAAAAGACAGACTCCTCAAGG - Exonic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907124270 1:52035417-52035439 ATGTAAACACAGGCCCGGCATGG + Intronic
909569665 1:77094831-77094853 TGTGAAACACATACCTGTCAAGG - Intronic
910718307 1:90256700-90256722 TTGGAAAAACAGTCCCCTCAGGG + Intergenic
911036255 1:93552148-93552170 TTGGAAACACTGTGCAGTCAAGG + Intronic
911371249 1:96997282-96997304 TTGGAAACAAATACCAGTGAGGG + Intergenic
911569439 1:99505289-99505311 GTGGAAATTCAGACCCGGCACGG - Intergenic
911990073 1:104684966-104684988 TTGGAAACAAAGATCTGTCAAGG + Intergenic
916008359 1:160681857-160681879 TTGGAAAGACAGACCAGCCAAGG - Intronic
916373985 1:164131279-164131301 TTGTACATACAGACCCTTCAAGG - Intergenic
923460704 1:234206984-234207006 TTGGAAACAGACACCAGCCAAGG + Intronic
1063232184 10:4076108-4076130 TAGGAAACACAGACCTGAAAGGG + Intergenic
1063658729 10:8017805-8017827 TTGGAACCACAAATCAGTCAGGG - Intergenic
1068761105 10:60710394-60710416 TTATAAACACAGACCATTCATGG - Intronic
1070370141 10:75774878-75774900 TTGGAAACAATGACCCTTTATGG - Intronic
1071936494 10:90537312-90537334 TTGGGAAGACAGACGGGTCAAGG + Intergenic
1072196426 10:93120477-93120499 CTGGAACCACAGACCCCTCAGGG - Intergenic
1077558568 11:3240822-3240844 TTGAAAAAACAGACCCCTTAAGG - Intergenic
1080701657 11:34649472-34649494 TGTGAAACACACACCCATCAAGG - Intronic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1082079281 11:47999715-47999737 TTGGAAACAGAGACCCAGAAAGG + Intronic
1088368574 11:109064565-109064587 TTGAAAACTCAGACCTGGCAGGG + Intergenic
1090082451 11:123623080-123623102 TTGGGAACACAGAAGCATCAAGG + Intronic
1102232743 12:111274843-111274865 TAGGAAACACAGAGCCGGAAAGG - Intronic
1102520423 12:113474698-113474720 CTGGAAACACACACCAGACAGGG - Intergenic
1107676849 13:42806564-42806586 TTGCAGACACAGCCCCTTCATGG + Intergenic
1108334776 13:49428453-49428475 TTGGTCACACAGACCAGTCTTGG + Intronic
1115330595 14:32192879-32192901 TTGGAAACAGAGACGCTTCCAGG - Intergenic
1117413390 14:55471003-55471025 TTGGACACACAGACCAATCTTGG + Intergenic
1117708882 14:58502500-58502522 TTGATAACACAGACCAATCATGG + Intronic
1118431692 14:65725580-65725602 TGGGGAACACAGGCCAGTCAAGG - Intronic
1120122864 14:80702746-80702768 TTGGAAACACACAAACCTCAGGG - Intronic
1120595527 14:86430568-86430590 TTGGAAACACATACCCAGCAGGG - Intergenic
1122888739 14:104723188-104723210 TTGGCAACTGAGAGCCGTCAGGG + Intergenic
1123930700 15:25170416-25170438 CTGGAAACGCTGACCCGTCACGG - Intergenic
1125181569 15:36885587-36885609 TTGGAAACCCAGGCCCTTCCTGG + Intergenic
1126144070 15:45461116-45461138 TTGGAAACACTGAGCCTCCACGG + Intergenic
1127854271 15:62941726-62941748 TTGGTAAGACAGACCTGGCAGGG + Intergenic
1128314480 15:66652047-66652069 TTGCAAACACAGACCCAGCATGG + Intronic
1129064363 15:72888854-72888876 TTGCAGACCCAGACCCATCACGG - Intergenic
1129952766 15:79606788-79606810 TTGGAAACACACACCTTCCATGG - Intergenic
1132768150 16:1545387-1545409 TGGGCAAAACAGACCCGTTAGGG - Intronic
1132790483 16:1683786-1683808 TTGCAAACACTGACCACTCAAGG - Intronic
1135661286 16:24299134-24299156 ATGTAAACACAGCCCCCTCAAGG - Intronic
1137368939 16:47886927-47886949 TTGGAGATACAGAGACGTCAGGG + Intergenic
1138559464 16:57792055-57792077 TGGGAAACACATACCCTTCAAGG - Intronic
1141887345 16:86901566-86901588 TGGTACACACAGACCCGTCCTGG - Intergenic
1145184230 17:20780491-20780513 TGGGAAAGCCAGAACCGTCAGGG + Intergenic
1150635325 17:66909070-66909092 CTGGAAACACAGACCCTAAAGGG + Intergenic
1153551530 18:6267341-6267363 TTGGAAATACTGAGACGTCATGG + Intronic
1155097509 18:22572409-22572431 TTAGAAACTCAGACCCCCCAGGG + Intergenic
1158890830 18:61870508-61870530 TTGGAACCACAGAGTCGGCAGGG - Intronic
1159529756 18:69640456-69640478 TTGGAAACACAGATTCCTAATGG - Intronic
1161557763 19:4954253-4954275 CTGGAAACCCAGACCTGGCAAGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1161865006 19:6827114-6827136 GTGGAAACACAGACAGGGCAGGG + Intronic
1163287602 19:16358174-16358196 TTGGAAACACAGACCCGTCAAGG - Intronic
925634797 2:5932858-5932880 TTGGAAGCACAGAACCTTCACGG + Intergenic
931385598 2:61795131-61795153 CTGGAAGCAGAGACCCCTCAGGG - Intergenic
931464633 2:62475492-62475514 TGGGAAACCCAGAACCGCCAGGG - Intergenic
935357877 2:102221384-102221406 CTGGAAACGCAGAGCTGTCATGG - Intronic
943407872 2:187511650-187511672 TTGAAACAACGGACCCGTCAAGG - Intronic
1173753127 20:45492254-45492276 TTCTAAAGACAGACCAGTCAGGG + Intergenic
1174127349 20:48316679-48316701 TTGGCAAGACAAACCCTTCAAGG + Intergenic
1176267430 20:64217555-64217577 TTGGACACACACGCCCGTAACGG - Intronic
1179587925 21:42385546-42385568 TTGGAAAGACAGACCCGACGTGG + Intronic
1180727990 22:17960713-17960735 TTGGAAACAGACACCCGCCCCGG + Intronic
949411630 3:3771860-3771882 TTGGAAACCCAGTCCTGTCATGG - Intronic
949930890 3:9077639-9077661 TTGGAGACACAGGCCAGGCAGGG - Intronic
952955556 3:38555300-38555322 TTGGAACCCCAGAACAGTCAGGG - Intronic
957305693 3:78456063-78456085 GTGGAAGCACAAACCAGTCAGGG - Intergenic
959681603 3:109102651-109102673 TTTGAAACACAGACAAGTGACGG - Intronic
960559476 3:119067498-119067520 TAGGAAACAAAGACCCACCAAGG - Intronic
963738971 3:149055803-149055825 TTGGTCACACAGACCAGTCCTGG - Intronic
965690740 3:171354294-171354316 TTGGAAACAGACACCAGCCACGG + Intronic
966749503 3:183308687-183308709 TTGGAGACACACACCCCTAAAGG - Intronic
969504220 4:7574206-7574228 TGGGGAACACAGTCCCGTCCTGG - Intronic
973320523 4:48805971-48805993 TTGGAAAAACAGGCCGGGCATGG + Intronic
973540620 4:51931719-51931741 ATGGAATCACAGAGCTGTCAGGG + Intergenic
974149531 4:57989019-57989041 TTTGAAAGACAGATCTGTCAGGG + Intergenic
986446627 5:7826819-7826841 TTGTAAACACAGAAATGTCAAGG + Exonic
998852697 5:146365674-146365696 TTGGAACCACAGGCCCCTCAAGG + Intergenic
1001200644 5:169713044-169713066 TGGCAAACACAGCCTCGTCAAGG + Intronic
1001308051 5:170590136-170590158 TTGGAAACTCAGAGCCTGCAGGG + Intronic
1007776612 6:44227558-44227580 GTGGAAACACAGACAGGCCAGGG - Intronic
1010931505 6:81809511-81809533 TTAGAAACACAGTCTCTTCAGGG - Intergenic
1014202581 6:118622297-118622319 TTTGAAACACTGATCCTTCAAGG - Intronic
1014471178 6:121816574-121816596 TTGGAGAAACAGAGACGTCAGGG - Intergenic
1015374665 6:132496070-132496092 TTGGAAAGACAGAACCTTCTAGG - Intronic
1018350789 6:162956711-162956733 TTGGAAACAGAGACACATCCAGG - Intronic
1018504411 6:164448979-164449001 TTGGAGACACAGATCCGTTTTGG - Intergenic
1018649115 6:165976647-165976669 TGTGAAACTCAGACCCTTCACGG + Intronic
1022752516 7:33244924-33244946 TTGGAAACAGGGAACAGTCAGGG + Intronic
1029382388 7:100222285-100222307 TGGGAGACACAGACCCGCCCCGG - Intronic
1029657583 7:101937112-101937134 ATGCAAACACAGTCCCGGCAGGG - Intronic
1032503636 7:132418966-132418988 TTGTAAACACAGAGCCTTCTGGG + Intronic
1033158739 7:138979039-138979061 CTGGAAACACAGAGCAGTGAAGG - Intronic
1033815204 7:145062891-145062913 TTGGAATATCAGACCCCTCATGG - Intergenic
1037523702 8:19704253-19704275 TTTGAATCACAGACCCTTCCAGG + Intronic
1039738683 8:40359708-40359730 TTGGAAACTCAGATCCCTCCAGG + Intergenic
1045248583 8:100464566-100464588 CTGGAAACACAGAACCCTGAGGG - Intergenic
1049985937 9:951351-951373 CTGGAAACACAGACCAGACATGG + Intronic
1058439295 9:104992243-104992265 TTTGAAGCACGGACCCTTCATGG - Intergenic
1061803617 9:133126501-133126523 TTGGGAACACAGACCCGGTGTGG - Intronic
1186231288 X:7457217-7457239 TTGGAAAGACACACCAGCCATGG - Intergenic
1191079833 X:56498050-56498072 ATGGAAACACACACACATCAGGG - Intergenic
1191928731 X:66344768-66344790 TTTGAAACCCAGACCCCTGATGG + Intergenic
1192741792 X:73900500-73900522 ATGGAAACACAGGCCAGGCATGG + Intergenic
1197166100 X:123379319-123379341 TTGGACACACAAAACCCTCATGG - Intronic
1197428062 X:126323169-126323191 CTGGGAACTCAGACCCGTCTCGG - Intergenic
1200272574 X:154699536-154699558 TGGGAACCACAGACCAGTCATGG + Intronic