ID: 1163288621

View in Genome Browser
Species Human (GRCh38)
Location 19:16364583-16364605
Sequence GGACCAGGAGTGGCCCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163288621_1163288632 25 Left 1163288621 19:16364583-16364605 CCATGCAGGGCCACTCCTGGTCC 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1163288632 19:16364631-16364653 GGCCTCGCTGCCAGGTCTCCCGG 0: 1
1: 1
2: 2
3: 21
4: 223
1163288621_1163288628 4 Left 1163288621 19:16364583-16364605 CCATGCAGGGCCACTCCTGGTCC 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1163288628 19:16364610-16364632 CATGAGCCAATGGTAAGCCAAGG 0: 1
1: 0
2: 1
3: 21
4: 109
1163288621_1163288630 17 Left 1163288621 19:16364583-16364605 CCATGCAGGGCCACTCCTGGTCC 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1163288630 19:16364623-16364645 TAAGCCAAGGCCTCGCTGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 131
1163288621_1163288625 -6 Left 1163288621 19:16364583-16364605 CCATGCAGGGCCACTCCTGGTCC 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1163288625 19:16364600-16364622 TGGTCCCAGGCATGAGCCAATGG 0: 1
1: 0
2: 0
3: 23
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163288621 Original CRISPR GGACCAGGAGTGGCCCTGCA TGG (reversed) Intronic
900125174 1:1065683-1065705 AGACCGGTAGTGGCCCTGAACGG + Intergenic
900548710 1:3242899-3242921 GGACCCAAAGTGGCCATGCACGG - Intronic
900720622 1:4173587-4173609 GGAGCAGGAGACACCCTGCAAGG - Intergenic
901222028 1:7588646-7588668 GGCCCTGGGGTTGCCCTGCAAGG - Intronic
901463204 1:9404108-9404130 GGACCGAGGGTGGCCCGGCAAGG + Intergenic
901474946 1:9483080-9483102 GGACCATGTGAGTCCCTGCAGGG + Intergenic
901595815 1:10384563-10384585 GGACAAGCAGTGGCCGTGGAGGG + Intergenic
902178989 1:14673282-14673304 TGACCAGGGCTGGCCCTGGATGG + Intronic
903371147 1:22837021-22837043 AGACCAGGAGAGGCCCTACACGG + Intronic
903373269 1:22850424-22850446 GTACCAGGACTGGGCCTGCCAGG + Intronic
903758992 1:25684705-25684727 GCACCAGGAGTGGCCGAGCATGG + Intronic
903810221 1:26031188-26031210 GGGCCAGGAGTGCCCCTGGGGGG - Exonic
903840244 1:26233906-26233928 AGACCTGGAGGGGCCCTGCTGGG - Intergenic
903886929 1:26546132-26546154 GGCCCAGGCCTGGCCCTGCAGGG + Intronic
905174131 1:36125511-36125533 CGGCCAGGCGTGGTCCTGCAGGG + Intergenic
905205904 1:36342753-36342775 GGACCAGGAGGGGCCGTGCCTGG - Intronic
907192284 1:52659496-52659518 GGCCCAGTGGTGGCCCTTCATGG + Intronic
907222070 1:52914445-52914467 GGCCCAGGTGTGGGACTGCAGGG + Intronic
907305057 1:53508651-53508673 GTACCTGGTGTTGCCCTGCAGGG - Intronic
907491323 1:54810638-54810660 GGAGCAGCAGTGACCCCGCATGG + Intronic
912762958 1:112385429-112385451 GAAACAGGAGTGGCCGGGCACGG + Intergenic
913237749 1:116799403-116799425 TTACCAGGGGTGGCCCTGCTGGG + Intergenic
915512242 1:156392694-156392716 GGGCCAGGAGTGCCCCAGCTGGG + Intergenic
915954322 1:160209923-160209945 GGCCCAGCAGTGGCCCTGCCAGG - Intronic
916197807 1:162241088-162241110 GGACCAGCAGTGACCCTGATTGG + Intronic
916379082 1:164188689-164188711 GGAGCAGGAGGGGGCCTGCAGGG - Intergenic
920503128 1:206497887-206497909 AGCCCATGAGTGGCCCTTCAGGG + Intergenic
920604810 1:207371430-207371452 GGACCAGGCGTGGCAGAGCAGGG + Intergenic
922726157 1:227923972-227923994 GGACCATGACTGGCGCTGCACGG + Intronic
922763995 1:228148313-228148335 GGACCTGGGGTGGGGCTGCATGG + Intronic
924038299 1:239957859-239957881 GGAGCAGGAGGGGCTCAGCAGGG - Intergenic
924880146 1:248152267-248152289 GCATCAGCAGTGGCCCTGTAGGG + Intergenic
924883252 1:248186689-248186711 GCATCAGCAGTGGCCCTGTAGGG + Intergenic
1063320425 10:5046827-5046849 AGACCAGTAGTGGCCCCGAATGG + Intronic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1067463028 10:46472124-46472146 GGACAAAGAGTGGCCATGCAGGG + Intergenic
1067494724 10:46751440-46751462 TAACCAGGAGTGGCAGTGCATGG + Intergenic
1067599931 10:47588957-47588979 TAACCAGGAGTGGCAGTGCATGG - Intergenic
1067624166 10:47912514-47912536 GGACAAAGAGTGGCCATGCAGGG - Intergenic
1067796648 10:49326267-49326289 GGACACGGAGTGGCGGTGCACGG - Exonic
1069557538 10:69407796-69407818 GGAGCAGGAGTGTGCCTGCAGGG - Intronic
1069846850 10:71378046-71378068 AAACCTGGATTGGCCCTGCATGG - Intergenic
1070191946 10:74119016-74119038 GTGCCGGGAGTGGCCCTGCTGGG - Exonic
1070693265 10:78543233-78543255 GGAGCAGCACTAGCCCTGCATGG + Intergenic
1073065910 10:100759139-100759161 GGGCCTTCAGTGGCCCTGCAAGG + Intronic
1074082793 10:110181154-110181176 GGACCAGAAGTGGCCTTCAAAGG - Intergenic
1074281216 10:112053370-112053392 GGGACAGGAGTGGCCGGGCACGG - Intergenic
1074416267 10:113269571-113269593 GGCCAAGGAGTGGCCTGGCAGGG - Intergenic
1074447230 10:113530537-113530559 TGCCCAGGAAGGGCCCTGCAGGG + Intergenic
1074762960 10:116681136-116681158 GCAACAGGTGAGGCCCTGCAGGG - Exonic
1075690809 10:124392968-124392990 GGACCAGGTGTGTCACTCCAAGG + Intergenic
1076047048 10:127302371-127302393 GCCCCAGGAGTGGCCCCCCAGGG - Intronic
1076671360 10:132122523-132122545 AGAGCAGGTGTGGCCCTGCCCGG - Intronic
1076890297 10:133280123-133280145 AGACCATAAGAGGCCCTGCAGGG + Intronic
1076922855 10:133464702-133464724 GGACAAGGAGAGGTCCTTCAGGG - Intergenic
1077374037 11:2197358-2197380 GGCCGAGGAGCCGCCCTGCAGGG + Intergenic
1077560683 11:3258381-3258403 GTGCCTGGGGTGGCCCTGCAGGG + Intergenic
1077566579 11:3304209-3304231 GTGCCTGGGGTGGCCCTGCAGGG + Intergenic
1078101697 11:8333980-8334002 GCACCTGGGGTGGGCCTGCATGG + Intergenic
1078359482 11:10657339-10657361 AGAACAGGCTTGGCCCTGCAAGG - Intronic
1079007149 11:16800083-16800105 GCACCAAAAGTGGCCCAGCAAGG + Intronic
1080665236 11:34330126-34330148 GGCCAAGGAGTGACCCAGCAGGG - Intronic
1080753528 11:35173298-35173320 GGACAAGGAGAGGCCCCGGAAGG + Intronic
1081671055 11:44942938-44942960 ACACCTGGAGTGGCCCTGAAGGG - Intronic
1081728168 11:45347620-45347642 GGAACCAGAGGGGCCCTGCAAGG + Intergenic
1084181821 11:67450753-67450775 GGACCAGGCTTGGCCATGCCAGG + Intergenic
1085706683 11:78792621-78792643 GCACCAGGTGTGGCCCAGCATGG + Intronic
1089287710 11:117418283-117418305 GCCCCAGCAGTGGCCCTACAGGG - Intergenic
1091661150 12:2384741-2384763 GTACCAGTAGAGGCACTGCAGGG + Intronic
1094418097 12:30238855-30238877 TGAACATGAGAGGCCCTGCAGGG - Intergenic
1094485696 12:30925067-30925089 GGAGCTGGGGTGGCCCTTCAGGG + Intergenic
1096100166 12:48965998-48966020 GGACCAAGAGTGACCTTGGAAGG + Exonic
1098919817 12:76293113-76293135 GGACCTGGATTGGCCTGGCAAGG - Intergenic
1099733311 12:86534108-86534130 GGATCAGGAATGGACCTGAAAGG - Intronic
1100705978 12:97200579-97200601 GGACTAGCAGTGGCCCCTCATGG - Intergenic
1101867152 12:108528660-108528682 GGGCCAGGCACGGCCCTGCATGG - Intronic
1101986454 12:109451097-109451119 GAACCAGGAGTGGACCTGCTGGG + Exonic
1102207369 12:111099602-111099624 AGAACAGGATTGGACCTGCAGGG + Intronic
1102483405 12:113239643-113239665 AGACCAGAAGTAGCCCAGCAGGG + Intronic
1103944479 12:124518406-124518428 GGGCCTGGCCTGGCCCTGCAGGG - Intronic
1104167714 12:126250135-126250157 GGACCAGGAGTAGCAGTGGAGGG - Intergenic
1104567962 12:129902633-129902655 GGAGCAGCAGCGGCCCCGCAGGG - Intronic
1104592030 12:130092452-130092474 GAGCCAGGGGTGGCCCAGCAGGG + Intergenic
1104913704 12:132252902-132252924 AGACCAGTAGTGGCCCCGAACGG + Intronic
1104941112 12:132395804-132395826 GAAACAGGAGTGGCACGGCAGGG + Intergenic
1105704805 13:22962274-22962296 GGCCCCAGAGTGGCCCTCCACGG + Intergenic
1105772794 13:23629269-23629291 GAACCAGGAGTAGCCCTCCCTGG + Intronic
1105971215 13:25430415-25430437 GGAGCAGGAGTGGTTGTGCACGG + Intronic
1107878095 13:44808178-44808200 GGAGCAGGATTGGCCCTTCAGGG + Intergenic
1108848221 13:54700103-54700125 GGTCCAGCTGTGGCCATGCATGG - Intergenic
1112430907 13:99349475-99349497 AGACCAGTAGTGGCCCTGAACGG + Intronic
1112498269 13:99922665-99922687 CGACCAGGAGTGGCAGTGGATGG - Intergenic
1113740871 13:112711600-112711622 GGACTGGGAGGGGCACTGCAGGG + Intronic
1114559089 14:23578101-23578123 GGCCCAGGGGAGGCTCTGCAGGG + Intronic
1114673836 14:24428708-24428730 GGACCTGGAAAGACCCTGCAAGG - Intronic
1115661042 14:35494540-35494562 GGCCCAGGACTGTCCCTTCAGGG - Intergenic
1116654059 14:47628863-47628885 GGAGTATGAGTGTCCCTGCAAGG - Intronic
1116957235 14:50936918-50936940 GGACATGGAGAGGACCTGCAGGG + Intronic
1117772608 14:59150078-59150100 GGGCTAGGAGTGGCCAGGCACGG - Intergenic
1120954495 14:90069394-90069416 GGCCCATGATTGGCTCTGCATGG + Intronic
1121836668 14:97098454-97098476 GGACCAGGACTGGCTCTGCACGG + Intergenic
1122113115 14:99515209-99515231 GGACGTGGACTGGCCCTGCTGGG - Exonic
1122768713 14:104087534-104087556 AGGCCAGGAGCAGCCCTGCAAGG + Intronic
1122847962 14:104511029-104511051 GGAGCAGGGCTGGCCCTGCCAGG - Intronic
1122945751 14:105008122-105008144 GGCCCAGATGTGGCCCAGCAGGG + Intronic
1123777476 15:23594539-23594561 AGACCAGTAGTGGCCCCGAACGG - Intronic
1125595911 15:40886024-40886046 AGACCAGGAGTGGCCGGGCGCGG - Intergenic
1126341171 15:47642624-47642646 AGACCTGGAGTGGCCCAGCCGGG + Intronic
1127771107 15:62231542-62231564 GTACCAGGAGAGGCCATGCCTGG - Intergenic
1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG + Intergenic
1129402859 15:75294386-75294408 GCACCAGGAGTGGCCAGGGAGGG + Exonic
1131236140 15:90698724-90698746 GGATGAGGATTGGCCCAGCATGG - Intergenic
1132248369 15:100315236-100315258 GAAGCAGCAGTGCCCCTGCACGG - Intronic
1132692769 16:1188974-1188996 GGACCTGGGGGGGCCCTCCAAGG - Intronic
1132713418 16:1279104-1279126 GGAGCAGGAGGGGCTCAGCAGGG + Intergenic
1132751913 16:1461535-1461557 GGACCGGGAGTGGGCTGGCAGGG + Intronic
1134172157 16:11977006-11977028 AGACCAGGAGTGCCCCGCCACGG - Intronic
1134249064 16:12561779-12561801 GGACCACGCGTGGCCTGGCAGGG + Intronic
1136411686 16:30081326-30081348 AGACCAGGCCTGGCTCTGCAGGG - Intronic
1136711831 16:32243751-32243773 AGACCAGTAGTGGCCCCGAATGG - Intergenic
1136756085 16:32685656-32685678 AGACCAGTAGTGGCCCCGAATGG + Intergenic
1136812028 16:33184717-33184739 AGACCAGTAGTGGCCCCGAATGG - Intergenic
1136818504 16:33294797-33294819 AGACCAGTAGTGGCCCCGAATGG - Intronic
1136825068 16:33351330-33351352 AGACCAGTAGTGGCCCCGAATGG - Intergenic
1136830134 16:33450101-33450123 AGACCAGTAGTGGCCCCGAATGG - Intergenic
1136996703 16:35195637-35195659 GGAGGAGGAGTGGAGCTGCAGGG - Intergenic
1137559255 16:49492499-49492521 GGAGCAGGAGTGGCCCGTCTCGG - Intronic
1138110825 16:54322513-54322535 GGCCCAGCACTGGCCCTCCAGGG - Intergenic
1138351608 16:56348903-56348925 GTCCCAGGAGTGGCAGTGCAGGG - Intronic
1139422793 16:66859302-66859324 GGAACAGGAAAGGCCCTTCAGGG - Intronic
1139561226 16:67743670-67743692 GGCCCAGATGTGGCCCTGCAGGG - Intronic
1139956564 16:70696061-70696083 GGGCTAGGTGTGGCCCTGCCTGG - Intronic
1140260518 16:73374385-73374407 GAACCAGGACTGGCCTTGAATGG - Intergenic
1141139336 16:81487126-81487148 GAACCAGAACAGGCCCTGCAGGG + Intronic
1141741865 16:85898917-85898939 GGTCCAGGGGCGGCGCTGCAGGG - Exonic
1141906335 16:87029187-87029209 GTCCCAGGTGTGGCCCTGGAGGG - Intergenic
1142434383 16:90047509-90047531 GGGCCAGGCCTGGACCTGCAGGG - Intergenic
1202990606 16_KI270728v1_random:7687-7709 AGACCAGTAGTGGCCCCGAATGG - Intergenic
1203058223 16_KI270728v1_random:946008-946030 AGACCAGTAGTGGCCCCGAATGG + Intergenic
1144320725 17:14116901-14116923 GGACCAGGGAAGTCCCTGCAAGG - Intronic
1148073404 17:44921642-44921664 GGACCAGATGTGGCCCTGGTGGG + Intergenic
1148506148 17:48128696-48128718 CCACCAGGAGTGGCTCTGGAAGG - Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149328924 17:55561432-55561454 GGCTCAGTAGTGGTCCTGCAGGG - Intergenic
1151394438 17:73812903-73812925 GGACCAGACTTGGCCATGCAGGG - Intergenic
1152133891 17:78492833-78492855 GGACCATGGGTGGGCCTGGATGG + Intronic
1152745948 17:82039310-82039332 AGACCAGTAGTGGCCCCGAATGG - Intergenic
1154047093 18:10916315-10916337 GGACCAGGAGCCGCCTAGCAGGG + Intronic
1154199173 18:12287569-12287591 GGCCAAGGAATGCCCCTGCAGGG - Intergenic
1155239751 18:23854033-23854055 GGACCCTGAGTGGCCCCGCTGGG - Intronic
1158401354 18:57124064-57124086 TGTCCAGGTGTGGCCCTGGAAGG + Intergenic
1161579903 19:5075098-5075120 GGACCAGGAGGGGCACTCCCGGG - Intronic
1162130729 19:8524720-8524742 TGGCCAGGAGTGGCTTTGCAGGG + Intronic
1162908861 19:13839127-13839149 GGAGCAGGCGAGGCCCCGCAGGG + Intergenic
1163232529 19:16014184-16014206 AGACCAGTAGTGGCCCTGAATGG + Intergenic
1163234521 19:16022916-16022938 GGCACAGGCGTGTCCCTGCAGGG + Intergenic
1163288621 19:16364583-16364605 GGACCAGGAGTGGCCCTGCATGG - Intronic
1164967398 19:32497217-32497239 AGACCGGTAGTGGCCCTGAATGG + Intergenic
1165079125 19:33297791-33297813 GGCTCAGGAGTGGCGCAGCAAGG + Intergenic
1166046390 19:40233227-40233249 GAACCAGGAGTGGCCGGGCTGGG - Exonic
1166252971 19:41584277-41584299 GAACCATGAGGGGCCTTGCAGGG - Intronic
1166411150 19:42555974-42555996 GAACCATGAGGGGCCTTGCAGGG + Intronic
1166753686 19:45178006-45178028 GGGCCAGACGTTGCCCTGCAAGG + Intronic
1168350160 19:55670997-55671019 GGACCAAGGCTGGCTCTGCAGGG + Intronic
1168461990 19:56567319-56567341 GGACCAGGAGAGGCCCAAAAGGG + Intergenic
1168688430 19:58362508-58362530 GGCCCGGAAGTGGCCCTGCACGG - Intronic
925305835 2:2847474-2847496 TGGCCAGGGGTGGCCCTGCAGGG - Intergenic
925340591 2:3132729-3132751 GGACCAGGTGTGCCCATTCACGG - Intergenic
927575760 2:24200719-24200741 GTACCAAGGGTGGCCCTGCCTGG - Intronic
929431026 2:41886717-41886739 GGACTAGGAATGTCCCTGCAGGG + Intergenic
930080742 2:47446334-47446356 GAAACAGAAGTGGCCCGGCATGG - Intronic
931377008 2:61717017-61717039 GGACTATGAGTGGCCCAGCCTGG + Intergenic
933709791 2:85316424-85316446 GGACTGGTAGGGGCCCTGCAAGG + Intergenic
933767279 2:85718848-85718870 GGACCAGGACAGGCCAGGCAAGG - Intergenic
934176998 2:89585131-89585153 AGACAGGGAGAGGCCCTGCAGGG - Intergenic
934287306 2:91659490-91659512 AGACAGGGAGAGGCCCTGCAGGG - Intergenic
934990398 2:98916314-98916336 GGACCAGGGGTTGCCCTACAGGG + Intronic
935605745 2:104970642-104970664 GGGGCAGGAGTGGGCCTGCCTGG - Intergenic
936048245 2:109203088-109203110 GGAACACTGGTGGCCCTGCACGG + Intronic
936979404 2:118250371-118250393 GGACCAGGAGCTGCCCAGGATGG + Intergenic
937908407 2:127063917-127063939 GGAACAGGTGAGGCCCAGCACGG - Exonic
938000675 2:127733271-127733293 GCACAAAGTGTGGCCCTGCAGGG + Intronic
938265173 2:129923208-129923230 GGAACAGGAGTGGCTCCTCAGGG + Intergenic
939145750 2:138412641-138412663 TGACCAGGAGTGGCCATCAAAGG + Intergenic
941256017 2:163231855-163231877 AGACCAGGAATGGTTCTGCAAGG - Intergenic
942104506 2:172619380-172619402 GGACCAGGGGTGGAGCTGAAGGG + Intergenic
944842559 2:203638411-203638433 AGAAAAGGTGTGGCCCTGCAAGG + Intergenic
948196926 2:236103415-236103437 GGGCGGGGAGTGGCCCAGCAGGG - Intronic
948237090 2:236399578-236399600 GGACCAGGACTGGGCCTGCGCGG - Intronic
948295609 2:236857994-236858016 GGGTCAGGACTGGTCCTGCATGG + Intergenic
948567402 2:238895775-238895797 GGACAGGGAGAGGCTCTGCAGGG + Intronic
948888892 2:240897348-240897370 GGAACAGGAGTGGGCCAGCTTGG - Intergenic
1169033276 20:2429944-2429966 TGACCAGGACTGGGCCTTCATGG + Intronic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1171359549 20:24577427-24577449 GCCCCAGCACTGGCCCTGCAAGG + Intronic
1173691596 20:44965389-44965411 GGCCCATGGGTGGCCCTGAAGGG + Intergenic
1174049879 20:47760188-47760210 GGAGCAGGAGTGACCCTTCCTGG - Intronic
1174195841 20:48772308-48772330 GGCACAGGTATGGCCCTGCAGGG + Intronic
1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG + Intergenic
1178421463 21:32446820-32446842 TGTCCAGGAGTGGCCATGGAAGG - Intronic
1179921721 21:44510978-44511000 GGACGTGGGGTGGCCCTGGACGG - Intronic
1180075864 21:45461520-45461542 GGACAAGGAAGAGCCCTGCAGGG - Intronic
1180211157 21:46296088-46296110 GGCCCTGGGGTGGCCCTGAAGGG + Intronic
1180751151 22:18125223-18125245 GGAACAGAAGTGGCCAGGCATGG + Intronic
1181039944 22:20187331-20187353 CGTGCAGGCGTGGCCCTGCAAGG - Intergenic
1181339376 22:22165954-22165976 AGACCAGGTGTGGCCTGGCATGG + Intergenic
1181770389 22:25120885-25120907 CTACCAGGAGTGACCCTGCAGGG + Intronic
1181777556 22:25170533-25170555 GGGCCAGGCGATGCCCTGCAGGG + Intronic
1183248337 22:36710940-36710962 GGACACAGAATGGCCCTGCATGG + Intergenic
1183588543 22:38767120-38767142 GGACCAGCAGTGGCCATCCCTGG - Intronic
1184546210 22:45170213-45170235 AGACCGGCAGTGGCCCTGAATGG - Intronic
1184771403 22:46598875-46598897 GAACCAGGAGGGGACATGCATGG + Intronic
1185158457 22:49208225-49208247 GGCTCAGGAGTGGCCCTAGATGG + Intergenic
1185190189 22:49431071-49431093 GGACCAAGGGAGGCCCTGCGAGG - Intronic
950407332 3:12812982-12813004 GGTCCAGGTGAGCCCCTGCAGGG - Exonic
951300811 3:20994425-20994447 AGACATGCAGTGGCCCTGCAGGG - Intergenic
952912536 3:38203341-38203363 AGACCAGTAGTGGCCCGGAACGG - Intronic
953133952 3:40166940-40166962 GGAGCAGGAGGGGCCCTACCAGG - Exonic
953689751 3:45107733-45107755 TGACCTGGAGTTGGCCTGCATGG - Intronic
953981330 3:47414596-47414618 GGCCCCTGAGTGGCCCTGAAGGG + Exonic
953981370 3:47414782-47414804 GGTGCTGGAGTGGCCCGGCACGG - Intronic
954073520 3:48160046-48160068 GGAACAGTAGTGGGGCTGCAGGG - Intronic
959742307 3:109734957-109734979 GGACCGGTAGTTGCCCTCCAGGG - Intergenic
961333114 3:126154538-126154560 TGAACAGGTGTGTCCCTGCATGG - Exonic
962680191 3:137791232-137791254 GGACAAGGAATAGCCCTGCTAGG - Intergenic
963107724 3:141660666-141660688 GGACATGGAGAGGGCCTGCAAGG - Intergenic
963250308 3:143096453-143096475 GGTCCAGCTGTAGCCCTGCAGGG + Intergenic
966974080 3:185069854-185069876 GGCCCAGGAGAAGCCCTCCACGG - Intergenic
967091016 3:186134841-186134863 GGGCTAGGAGTGGCCCTCCTGGG + Intronic
968555244 4:1243587-1243609 GGGGCAGGTGTGGCCCGGCAGGG - Intronic
968576515 4:1368802-1368824 GGACCAGGACGGACCCAGCAGGG - Intronic
968585407 4:1414018-1414040 GAACCCAGAGCGGCCCTGCAGGG - Intergenic
968660217 4:1795722-1795744 GGACCTGGAGTGACCCCCCAGGG + Intronic
968753556 4:2402851-2402873 GGGGCAGGCTTGGCCCTGCAGGG - Intronic
969562851 4:7960428-7960450 GGACCAGGGGTGGTCCTGCAAGG - Intergenic
969620976 4:8278681-8278703 GGACCTGGTGGGGCCCTGCAGGG + Intronic
970609979 4:17716202-17716224 GTCCCAGGAGTGCCCTTGCATGG - Intronic
971421961 4:26481747-26481769 GGACCAGGATTGGGGCAGCAGGG + Exonic
972251693 4:37309084-37309106 GGCCCAGGACTGGCCCACCAAGG - Intronic
973266855 4:48219784-48219806 AGACCAGTAGTGGCCCCGAATGG - Intronic
974957290 4:68657255-68657277 TGACATGGAGTGGCCCTGCAGGG + Intronic
976557068 4:86461996-86462018 GGCCCAGGATGGGCCCTGCATGG - Intronic
977642045 4:99368143-99368165 GGCCCAGGACTGGCCCCTCATGG - Intergenic
978491355 4:109314998-109315020 GGACCAGGAGTAGGACTGGAGGG - Intergenic
978821512 4:112972055-112972077 GGAGGAGGAGTGGTCTTGCAAGG + Intronic
979502934 4:121460896-121460918 AGACCAGGAGTGAATCTGCAAGG + Intergenic
982395066 4:154907430-154907452 AGACCAGTAGTGGCCCCGAAAGG + Intergenic
982999748 4:162398993-162399015 GGACTAGGAGTGGACCTTGATGG - Intergenic
983581831 4:169316997-169317019 GTACCAGGAGTGGCTCTAGAGGG + Intergenic
985576495 5:675674-675696 GGACCAGCAGGGGCCCAACAAGG - Intronic
985638058 5:1049625-1049647 ACACCAGGAGTGGACCTGCCGGG + Intergenic
985758341 5:1732443-1732465 GGCCCAAGAGAGGCTCTGCAAGG + Intergenic
985872557 5:2568879-2568901 GCCCCAGGAGGGGACCTGCATGG - Intergenic
986125643 5:4880528-4880550 GCACCAGGGGTGCCCCCGCAAGG + Intergenic
986638548 5:9849231-9849253 GGACCAGGGGTGGCCCCACTGGG - Intergenic
986725723 5:10594980-10595002 AGCCCAGGACTGGCCCTGCTGGG - Intronic
996184326 5:120457899-120457921 AGACCAGTAGTGGCCCCGAATGG + Intergenic
997341847 5:133151365-133151387 GGGCAAGGAGTGGGCCTGCAGGG + Intergenic
998433654 5:142088450-142088472 GCACCAGGGGAGGCCCTTCAGGG + Intergenic
998945597 5:147336385-147336407 GGCCCAGGAGAGGTCCTTCAGGG + Intronic
999261195 5:150239917-150239939 GGACGAGGACTGGCCCCGCCAGG - Intronic
999754406 5:154653659-154653681 TGACCAGGGGTGGCCCAGCTTGG + Intergenic
1000614139 5:163409283-163409305 CAAACAGAAGTGGCCCTGCAAGG + Intergenic
1001702585 5:173718080-173718102 AGGCCAGGCCTGGCCCTGCAAGG + Intergenic
1002082989 5:176748508-176748530 GGGCCAGGAGTGCCCGGGCAAGG - Intergenic
1002434165 5:179221084-179221106 GGACCTGGGGCAGCCCTGCACGG + Intronic
1005350991 6:24935432-24935454 GGACCAGGAGTGGTTTTTCATGG - Intronic
1006368674 6:33631292-33631314 AGACCAGTAGTGGCCCTGAACGG + Intronic
1006484426 6:34327030-34327052 AGACCGGTAGTGGCCCTGAATGG + Intronic
1007448783 6:41927408-41927430 GGACGAGGAGTGGCCCACCCTGG + Exonic
1008232211 6:48996680-48996702 GCAGCAGGAGAGTCCCTGCAAGG + Intergenic
1009854447 6:69243748-69243770 GGACCTGTAGTTGCCCTGTATGG + Intronic
1009881256 6:69569081-69569103 TGAACAGGAGTGGCCTAGCATGG + Intergenic
1010018414 6:71131319-71131341 GGCCCAGGAGTGCCACTGCTGGG + Intergenic
1012560661 6:100577114-100577136 GGATCAGGATTGGACCTGCCTGG - Intronic
1013271651 6:108550985-108551007 GGGGCAGGAGAGGCCTTGCAAGG + Intergenic
1014191474 6:118501272-118501294 GGACCAGAAGTGGCACCCCAAGG - Intronic
1017008673 6:150046896-150046918 GGACCAGGAGTAGGCCAGGAGGG + Intergenic
1018583382 6:165328515-165328537 GGGCCAGGTGTGGCCCTGTGAGG - Intronic
1019527877 7:1488909-1488931 GGGCCAGGTGTGACCCTGCGTGG - Intronic
1021626236 7:22595711-22595733 GGCCTAGAAATGGCCCTGCAGGG + Intronic
1023788686 7:43734729-43734751 AGACCGGTAGTGGCCCTGAACGG + Intergenic
1024029655 7:45448270-45448292 CAAACAGAAGTGGCCCTGCAAGG + Intergenic
1024273009 7:47656482-47656504 TGTCCAGGAGTGGGCCTTCAGGG + Intronic
1024589667 7:50870354-50870376 GGTCCAGGAATGGCCCCCCATGG - Intergenic
1025039569 7:55629426-55629448 TGACATGCAGTGGCCCTGCAGGG - Intergenic
1029172759 7:98642516-98642538 AGTCCAGGAGTGGCCTTGCTGGG + Intergenic
1031294395 7:119983582-119983604 GGGGCAGCAGTGGCCATGCAAGG - Intergenic
1032055303 7:128679835-128679857 GGAGCAGGTGTGACCCTGCCAGG + Intronic
1032710244 7:134454920-134454942 GGACCAGGACTGACCCTGTAGGG + Intronic
1034760407 7:153667184-153667206 GTACCAGGAGTGGCCTAGGAAGG + Intergenic
1035362448 7:158322506-158322528 GGGCCAGGTGTTGCCATGCACGG - Intronic
1035432857 7:158835350-158835372 AGACCGGTAGTGGCCCTGAATGG - Intergenic
1036656749 8:10681880-10681902 GAACCAGGAGTGGCCATGGGTGG - Intronic
1041076773 8:54176184-54176206 GGAACAGGAATGGCCCTGGGAGG + Intergenic
1041596962 8:59666208-59666230 AGACCGGTAGTGGCCCCGCACGG - Intergenic
1046276245 8:111964506-111964528 GGCCCAGGAGTGGACCTGAGGGG - Intergenic
1048027814 8:130602717-130602739 TGACCAGCAATGGCCCAGCACGG + Intergenic
1048042791 8:130747289-130747311 GGACCGGTAGTGGCCCAGAATGG - Intergenic
1048432267 8:134381553-134381575 GGGCCAGGTGGGGCCATGCATGG + Intergenic
1049428841 8:142549932-142549954 GGGCCAGGAGTGGGCCTGGGTGG - Intergenic
1049432612 8:142572227-142572249 GGACCGGGAGTGCCCGTGCAGGG + Intergenic
1049680048 8:143914081-143914103 GGAACAGGAGTGGCCCCGGCCGG - Intergenic
1050182436 9:2935048-2935070 GGTCCAGCTGTGGCCTTGCAGGG + Intergenic
1051811176 9:21052029-21052051 GGACCAGCAGTGGGCTCGCATGG - Intergenic
1054873114 9:70067353-70067375 GGACAGGGAGTGTCCCTCCATGG - Intronic
1056059104 9:82864259-82864281 AGACCAGGTGTGGCACTGAAAGG - Intergenic
1057081397 9:92176938-92176960 GGAGCAGGAGGGGCCTTGGAGGG + Intergenic
1057900295 9:98943406-98943428 TGCCCAGGAGTGGACCTGCCTGG - Intronic
1061008736 9:127942999-127943021 GGGCCAGGAGGGTCCCAGCATGG + Exonic
1061144153 9:128787398-128787420 TGGCCAGGAGTGGCCCAGCCGGG - Intronic
1061239706 9:129362510-129362532 GGACCAGGAGTGGGGCTCCGAGG + Intergenic
1061545028 9:131299499-131299521 GGAGGAAGAGAGGCCCTGCAGGG + Intronic
1061942218 9:133889935-133889957 ATCCCAGGAGTGGCCCTGCGGGG - Intronic
1062046001 9:134424833-134424855 GGACCAGGGGTGATCCTGCTGGG + Intronic
1062354853 9:136157062-136157084 GGGCCAGCAGTGTCCCGGCAGGG - Intergenic
1062567519 9:137169923-137169945 CGACCAGGAAGGGCCCCGCATGG + Exonic
1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG + Intronic
1185757254 X:2661683-2661705 GCCCAAGGTGTGGCCCTGCAGGG + Intergenic
1186503923 X:10074805-10074827 GGACCAGGTGTAGGCCTCCAGGG - Intronic
1190109776 X:47582482-47582504 GGGCCCGGGGTGGCCCAGCAGGG + Intronic
1190329457 X:49226688-49226710 CGGCCAGCTGTGGCCCTGCAGGG + Exonic
1192503751 X:71668797-71668819 GCACCAGAACTGGCCCTGCGGGG + Intergenic
1192522513 X:71814849-71814871 GCACCAGAACTGGCCCTGCGGGG + Intergenic
1194377649 X:93154615-93154637 GGCCCAGGAGTTGGCCTGCTTGG + Intergenic
1195618830 X:106933480-106933502 GGAACAGAGTTGGCCCTGCAAGG - Intronic
1195668149 X:107449123-107449145 TGACCAGGAGGGGAGCTGCAGGG + Intergenic
1198326004 X:135573656-135573678 GTACGAGCAGTGGTCCTGCAAGG + Intronic
1201346941 Y:12994878-12994900 AAACCAGGACTGGGCCTGCATGG - Intergenic