ID: 1163288864

View in Genome Browser
Species Human (GRCh38)
Location 19:16365627-16365649
Sequence CTGTGGGTTTGCAGGGGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 332}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163288852_1163288864 13 Left 1163288852 19:16365591-16365613 CCTGGGGGACAGTGTGACAGTGT 0: 1
1: 3
2: 12
3: 348
4: 5894
Right 1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG 0: 1
1: 1
2: 2
3: 22
4: 332
1163288850_1163288864 26 Left 1163288850 19:16365578-16365600 CCGGCAGGGGCACCCTGGGGGAC 0: 1
1: 0
2: 1
3: 18
4: 311
Right 1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG 0: 1
1: 1
2: 2
3: 22
4: 332
1163288851_1163288864 14 Left 1163288851 19:16365590-16365612 CCCTGGGGGACAGTGTGACAGTG 0: 1
1: 0
2: 2
3: 25
4: 342
Right 1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG 0: 1
1: 1
2: 2
3: 22
4: 332
1163288847_1163288864 29 Left 1163288847 19:16365575-16365597 CCACCGGCAGGGGCACCCTGGGG 0: 1
1: 0
2: 2
3: 28
4: 290
Right 1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG 0: 1
1: 1
2: 2
3: 22
4: 332
1163288855_1163288864 -10 Left 1163288855 19:16365614-16365636 CCTGCACCCCAGCCTGTGGGTTT 0: 1
1: 0
2: 0
3: 28
4: 305
Right 1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG 0: 1
1: 1
2: 2
3: 22
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163288864 Original CRISPR CTGTGGGTTTGCAGGGGATA GGG Intronic
900237886 1:1601102-1601124 CTCTGGGTCTGCAGGGGTTGTGG + Intergenic
901874335 1:12158372-12158394 GAGTGGGTTTGGAGGGGTTACGG + Intergenic
902742556 1:18448955-18448977 CTGGGGGTTTTCAAGGGATGTGG + Intergenic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
903137506 1:21318982-21319004 CTGTGGGTTTTCAGTGGAGCTGG + Intronic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
904663196 1:32100395-32100417 TTGTGGGTGAGCTGGGGATAAGG + Intronic
905474914 1:38219284-38219306 CTGTGGGGCTTCAGGGGAGAGGG + Intergenic
905613349 1:39374559-39374581 TTTTAGGTTTGCAGGGTATATGG + Intronic
907044363 1:51290775-51290797 CTGTGGGTCTGAGGGGGTTATGG + Intronic
907254015 1:53164578-53164600 CTGGGGATTTGATGGGGATATGG - Intergenic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
908125367 1:61024989-61025011 CAGGGGTTTTGCAGGGGTTACGG + Intronic
909516417 1:76512245-76512267 GTGTGGGTTTGAAGGAGAAATGG - Intronic
909809248 1:79910459-79910481 CTATGTGTTTGGAGAGGATATGG - Intergenic
909867218 1:80687878-80687900 CTGAGGGTTTCCAGGGTCTATGG + Intergenic
910354605 1:86340863-86340885 CTGAGTGTTTGAAGGGGAAAGGG - Intergenic
910936331 1:92486316-92486338 CTGTGGGTCGGCAGGGGATGGGG + Intronic
911436622 1:97867931-97867953 TTGTGTGTTTGCAGGTGACATGG + Intronic
911800878 1:102136012-102136034 CTGTTAGTTTGCCGAGGATAAGG - Intergenic
912029149 1:105217298-105217320 CTGTGAGTTTGCAGAGTATCTGG + Intergenic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
912692575 1:111815503-111815525 CTGGGGGATGGCAGGGGATGAGG - Intronic
914716367 1:150257949-150257971 CTGTGGGCTTCCAGGGGATTCGG - Exonic
918278922 1:182983717-182983739 ATGGTGGTTTTCAGGGGATAGGG - Intergenic
919112887 1:193242091-193242113 CTGCAGGTTTGCAGGGGTTGGGG + Intronic
920160855 1:203996719-203996741 CTGTAGGTTGGGAGGGGGTAGGG + Intergenic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
922790054 1:228306357-228306379 CTGTGGGGCTGCAGGGGGCAGGG - Exonic
923048028 1:230369622-230369644 CTGTGTGTGTGCTGGGGACAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063086382 10:2821979-2822001 CTATGATTTTGCATGGGATAAGG - Intergenic
1063379690 10:5576648-5576670 CTGTGTGTGTGCAGGGAGTAGGG - Intergenic
1067068321 10:43115874-43115896 CTGTGGGTTCCCAGGGAATGTGG + Intronic
1067839681 10:49665851-49665873 CGGTGGGTTTGCAGAGGACCTGG + Intergenic
1067913464 10:50371370-50371392 GTTTGGGTTTGGATGGGATAGGG - Intronic
1067935293 10:50606289-50606311 CAGTGGTTTTCCAGGGGCTAGGG + Intronic
1069569736 10:69487069-69487091 CTGCGGCTTTCCAGGGGCTACGG + Intronic
1071203747 10:83251090-83251112 ATTTGGGTTTGTAGGGGACAAGG + Intergenic
1071392646 10:85190908-85190930 ATGTGGCTTGGCAGGGAATATGG - Intergenic
1071701217 10:87939214-87939236 CTGGGGGTATGCATGGGACAGGG - Intronic
1073171429 10:101512212-101512234 CAAGGGTTTTGCAGGGGATAAGG - Intronic
1073618431 10:105022239-105022261 CTGTGGGGTGACAGGGCATATGG + Intronic
1073618864 10:105026266-105026288 CTGTGGCTGTCCAGGGGAGAGGG - Intronic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1076068003 10:127464178-127464200 GAGTGAGTTTGCAGGGCATACGG + Intergenic
1076708814 10:132319689-132319711 CTGTGGGAATGCAGGGGCTGAGG + Intronic
1078004020 11:7518913-7518935 CTGAGGGTTTGAAGGGGAAAGGG + Intronic
1081685037 11:45036380-45036402 CTGTGAATTTTGAGGGGATAAGG - Intergenic
1082960532 11:58914913-58914935 CTGTGGGAGTGCAGTGGATGTGG + Intronic
1083535706 11:63464896-63464918 CTGTGGCTTTGCAGGGGATAAGG - Intronic
1083536239 11:63469019-63469041 GTGTGGGTGTGCAGAGGATGGGG - Intronic
1083878100 11:65535322-65535344 CTGTGGTGTTGCAGCGGATGGGG - Exonic
1084042489 11:66550359-66550381 CTGTGTGTCTGTTGGGGATAGGG - Intronic
1085175319 11:74481657-74481679 ATCTGGGTTTACAGGGGAGAGGG + Intergenic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1086873375 11:92066294-92066316 CTGTGGTTTTGCAGAGGTTCTGG - Intergenic
1087641432 11:100759277-100759299 CTGTGTGTTTGCTGGGGCTCTGG + Intronic
1089087170 11:115830434-115830456 GTGAGGGTTTCTAGGGGATAGGG + Intergenic
1089589612 11:119531997-119532019 CTGTGGGTGTGCAATGGACAAGG - Intergenic
1090678698 11:129029859-129029881 CTGTGAGCTTGCTAGGGATAGGG - Intronic
1091384292 12:82924-82946 CTGTTGTTCAGCAGGGGATAGGG + Intronic
1091609654 12:1994991-1995013 TTTTTGTTTTGCAGGGGATAAGG + Intronic
1091788043 12:3254950-3254972 TTGTCGGTTTCCAGGGGACAGGG + Intronic
1094317693 12:29150090-29150112 CTGGGGGTGTGCAGGGGAGCAGG + Intronic
1095464387 12:42475480-42475502 GTGTGGGGTTGCAGGGGTTTAGG - Intronic
1096197195 12:49656354-49656376 GTGTGTGTTTGCGGGGGAGAAGG - Intronic
1096722202 12:53531744-53531766 CTGTGGCTGGGCAGGGGATGGGG + Exonic
1097037482 12:56133394-56133416 CTGAGGGTTGGCGGGGGAGAGGG - Intronic
1097124548 12:56763471-56763493 GTGTGTGTGTGTAGGGGATATGG + Intronic
1097861917 12:64526455-64526477 CTGGGGGTTGGGAGGGGTTAGGG - Intergenic
1098202139 12:68067843-68067865 CTGTGTGCTTTCAGGGGCTAAGG + Intergenic
1098355995 12:69613087-69613109 CTGAGGGTTTGTGGGTGATAGGG + Intergenic
1099367087 12:81780581-81780603 CTGTGAGGTTGCAGAGGAAAGGG + Intergenic
1099861353 12:88228811-88228833 TTGAGGGTTTGAAGGGGAAAGGG - Intergenic
1100255590 12:92879922-92879944 CTGTGGGCTGGCAGGGGACCAGG - Intronic
1101420018 12:104543203-104543225 CTGTGAGTTTACATGGGATCTGG - Intronic
1102080125 12:110091108-110091130 CTCTGGGTTCCCAGGGGATCTGG + Intergenic
1102199709 12:111048823-111048845 CTGGGGGACTGCAGGGGATGTGG + Intronic
1102784512 12:115593388-115593410 CTGTGGGGATTCAGGGGAAAGGG - Intergenic
1103130511 12:118464451-118464473 CTTTGGGGATGCAGGGGAAAGGG - Intergenic
1103462650 12:121117375-121117397 CTTTGGGTTTCCAGGGGATCTGG - Intergenic
1105278566 13:18950133-18950155 CTGTGGACTTGCAGGGGGCATGG - Intergenic
1105899861 13:24745106-24745128 CTGGCGCTTTGCAGGGGAGAGGG - Intergenic
1107172319 13:37357686-37357708 GTGTGGGGTTGCAGGGGTTGGGG - Intergenic
1109885848 13:68543359-68543381 CTGTGAGATTGCTGGGGAGATGG - Intergenic
1113456740 13:110454911-110454933 CTGTGGGGTGGCAGGGGGTGGGG - Intronic
1114237452 14:20835195-20835217 CTGAGGGTTTGAAGGGGGAAGGG + Intergenic
1114966341 14:27965846-27965868 CTGTGGGTTTTTAGAGAATATGG + Intergenic
1116279040 14:42877907-42877929 ATGGTGGTTTCCAGGGGATAAGG + Intergenic
1117740709 14:58816562-58816584 CTGTCTGTTTGCAGGGGCTAAGG + Intergenic
1119261719 14:73241642-73241664 CTGTGAGTCTGCAGGGGGTGTGG + Intronic
1119320854 14:73729549-73729571 CTGTGGGGCTGCTGGGGATTGGG - Intronic
1120631639 14:86898917-86898939 CTGTGCCTTTGCAGGGCATTTGG + Intergenic
1122268683 14:100558620-100558642 CTGTGGATTTGTAGGGGCGATGG - Intronic
1123029847 14:105446468-105446490 CTGTGGGTTTGCGGTGGGTCGGG + Intronic
1124667399 15:31605182-31605204 GTGTGGGTGTGCAGGGGGAATGG + Intronic
1124892127 15:33743132-33743154 CTGTGGCTTTGCTGTGGACATGG - Intronic
1126862023 15:52894413-52894435 CTTTGGGTTTGCAGGGTATAGGG - Intergenic
1128468600 15:67933268-67933290 CTGAGGGTTTTCAGGAGAGAAGG - Intergenic
1128666152 15:69539728-69539750 CTGTGGGGTTGCGGGGGGTGGGG + Intergenic
1129665435 15:77576989-77577011 CTGTGGGAAGGCAGGGGCTATGG - Intergenic
1129792674 15:78351994-78352016 CTGGGGGTTTTGAGGGGAAATGG + Intergenic
1131573147 15:93559586-93559608 CTCTGGGTTTGCAATAGATAAGG + Intergenic
1131719508 15:95152147-95152169 TTGGTGTTTTGCAGGGGATAAGG - Intergenic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133727961 16:8554936-8554958 CTGGGGGTCTGCAGAGCATAGGG - Intergenic
1133972680 16:10578926-10578948 CTGCTGGTTTGCAGGGAATGAGG - Intronic
1135816869 16:25642698-25642720 TTGTGGGATTGCAAGGGACATGG - Intergenic
1137832995 16:51562248-51562270 CAGAGGGTTTGCAGAGGCTATGG + Intergenic
1138051782 16:53786176-53786198 GTGTGTGTTTGCATGGGGTAGGG - Intronic
1139908654 16:70383087-70383109 CTGAGGTTCTGCAGGGGAAATGG + Intronic
1140685297 16:77427777-77427799 CTGTGAGTTGGCAGGGGAGGTGG + Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1142066217 16:88064549-88064571 CTGAGGGTTTGCCGAGGAGAGGG + Intronic
1142287220 16:89176368-89176390 CTGTGGTTTTGCAGGGGGAGGGG + Intronic
1143769183 17:9157168-9157190 GTGTTGGTTTGCTGAGGATAGGG - Intronic
1146264756 17:31445016-31445038 CTCTGGGTTAGCAGGGCCTATGG + Intronic
1147165993 17:38593746-38593768 CTGTGGGCTTTCAGGGGATGGGG - Intronic
1148766296 17:50040510-50040532 CTGGGGCTTGGCAGGGGAGAGGG - Intergenic
1150662315 17:67093720-67093742 CTGTGGGGTAGCAGTGGAAATGG - Intronic
1152096371 17:78274245-78274267 CAGTGGGATGTCAGGGGATATGG - Intergenic
1153002969 18:473183-473205 CTGTGGGCTTGCGGGGGAGGTGG - Intronic
1153230821 18:2933856-2933878 CTGTGGAGCTGCAGGGGATGTGG + Intronic
1153973002 18:10243404-10243426 CTGAGGTTTTTCAGGGCATATGG + Intergenic
1154127473 18:11704518-11704540 CTGTGGGTTAGCAGGAGTTGAGG - Intronic
1157108720 18:44799649-44799671 GTGTAGGTTTGCTGGGGATGCGG + Intronic
1157226628 18:45871771-45871793 CTGTGGGGTGTCAGGGGAAAAGG + Intronic
1157841028 18:50958634-50958656 GTGTGGTGTTGCAGGGGATAAGG + Intergenic
1158392142 18:57052504-57052526 CTGTGGGTTGGCATGGGTTGGGG + Intergenic
1158462762 18:57660994-57661016 CTGTGGGCTTTCTGGGGGTAGGG + Intronic
1160175800 18:76593010-76593032 AAGTGGCTTTGCAGGGGAGACGG - Intergenic
1161064474 19:2230935-2230957 CTGTGGGTGTGCTGGGGCCAGGG + Exonic
1161266046 19:3365357-3365379 CTGTGGGATTGCTGGGGATAAGG - Intronic
1161403429 19:4078812-4078834 CTGTGGGGGTGCTGGGGACAGGG - Intergenic
1161871955 19:6877066-6877088 CTGTGGGTTTGAAGGGTGTCTGG + Intergenic
1162003007 19:7760043-7760065 ATGAGGCTTTGCTGGGGATAGGG + Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162843836 19:13376000-13376022 CTGTGGGCTTGCTGTGGATTAGG - Intronic
1162932020 19:13962188-13962210 CAGTGGGGTTGCTGGGGGTAGGG + Exonic
1163288864 19:16365627-16365649 CTGTGGGTTTGCAGGGGATAGGG + Intronic
1163382873 19:16980259-16980281 CTCTGTGTGTGCAGGGGACAGGG - Intronic
1163856769 19:19708501-19708523 GTGTGGGTTTGGATGGGAAACGG + Intergenic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164959159 19:32412567-32412589 AAGTGGTTTTGCAGGGCATAGGG + Intronic
1165756054 19:38293602-38293624 CTGCAGGCTTGCAGGGGTTAGGG - Intronic
1165969788 19:39617794-39617816 CTTTTGGGTTGCAGGGGAGATGG + Intergenic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166948260 19:46410444-46410466 CTGCTGGTTTGGAGGGGACAGGG - Exonic
1167423051 19:49415026-49415048 CTGTGGGTGTGGAGTGGATGGGG - Intronic
1167427916 19:49439011-49439033 CTGATGCTTTGCAGGGGACAAGG + Intronic
926133345 2:10319298-10319320 CTGGAGGCTTGCAGGGGAAATGG + Intronic
927170822 2:20367899-20367921 CTGTGGCTTTGCAGGGTACACGG + Intergenic
927202211 2:20584798-20584820 CTTTGGGTTTGGAAGGGATGAGG + Intronic
927349702 2:22094659-22094681 CTGTGGGTGTGCAGCTGACATGG + Intergenic
927675632 2:25103830-25103852 CTGGGGGGTGGCAGGGGAGAGGG + Intronic
928169663 2:28995170-28995192 ATGTGGATGGGCAGGGGATATGG + Intronic
931486838 2:62702463-62702485 CTGTTGGTTGGTAGGGGAAATGG + Intronic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
932474138 2:71990716-71990738 CTATGGGTTTGCAGAGGAAGAGG + Intergenic
933161227 2:79026844-79026866 ATGTGGGGTTGGAGGTGATAGGG + Intronic
933689028 2:85165097-85165119 CTGTGGCATTGAAGAGGATAGGG + Intronic
935412530 2:102780709-102780731 TTGTGGGTGTGGAGGGGATGTGG + Intronic
935571148 2:104661163-104661185 CTGTGGGTTGGCGGGGGACGGGG - Intergenic
935854018 2:107255879-107255901 CTGGGGGTTTGCCGGGGGGAAGG - Intergenic
936054024 2:109247156-109247178 GTTTGGGTTTGCAGAGGACAAGG + Intronic
937992870 2:127674148-127674170 CTGTGGCTTTGCTGGGGAAAGGG - Intronic
939631488 2:144531291-144531313 GTGTGGGATTGGAGGGGAAAGGG - Intergenic
940143502 2:150521694-150521716 CGGTGGGTTTACAGGGGAAGTGG - Intronic
940785879 2:157980631-157980653 CTGTGGGTTTTCCAGGTATATGG - Intronic
941070114 2:160945979-160946001 CTGTGGGTTTGGAAGAGACATGG + Intergenic
941809987 2:169745910-169745932 ATGTGGGTTTGCAGCTGAGAAGG + Intronic
945051138 2:205825331-205825353 CTGTGGGTTGACTGGGGGTAAGG + Intergenic
946051919 2:216869931-216869953 CTGTGGGGCTCTAGGGGATAGGG + Intergenic
946171921 2:217900641-217900663 CTGTGTTTTTGCAGGGGTTAGGG - Intronic
946314151 2:218898295-218898317 CTGCGGGTCTGCAGGGGCTCGGG + Intronic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946550493 2:220796021-220796043 CTGTGTGTTTGTAGGTGATTGGG - Intergenic
946902036 2:224382165-224382187 CTGAGGGTTTGCCGGCCATATGG + Intronic
947609559 2:231515253-231515275 GTGTGTGTTTTTAGGGGATAGGG + Intergenic
947841189 2:233208852-233208874 CTGTGGGTTCCCAGGAGATACGG + Intergenic
948658103 2:239489390-239489412 CTGTGTGCTTGCTGGGGACAAGG - Intergenic
948687344 2:239677530-239677552 CTGTGTGTGTGCAGGGGCCAGGG - Intergenic
949043904 2:241861872-241861894 CTGTGTGTGTGCTGGGGATTGGG - Intergenic
1169014460 20:2280289-2280311 CTGTGGGTTAGCAAGAGATCAGG + Intergenic
1170096441 20:12650609-12650631 TAGTGGGTTTCCAGGGGAGATGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170935483 20:20805663-20805685 TTGTGGGTATGCAGGCAATAGGG + Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1172008065 20:31830925-31830947 CTCTGAGTTGGCAGGGGACAGGG + Intronic
1172896000 20:38300406-38300428 CTCTGGGTTTGGACTGGATAGGG - Intronic
1173002970 20:39118742-39118764 CTGTGGGTTGGCTGGGGTTCAGG + Intergenic
1173197540 20:40928255-40928277 CTGTGGGAGTGCAGAGGAGAGGG - Intergenic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175004700 20:55669877-55669899 CTCTGGGTTTCCATGGGATCTGG + Intergenic
1178750325 21:35296733-35296755 CTTTTGGTTTGGAGGTGATACGG + Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181939888 22:26467277-26467299 TTTTGGCTTTGCAGGGCATATGG + Intronic
1182049972 22:27305128-27305150 CTGTGAGTTTTCAGGGGCAATGG + Intergenic
1183731666 22:39621891-39621913 CTCTGGGATTGGAGGGGATGAGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184773726 22:46612920-46612942 CTGTGGGTGAGCAGGGGCTGTGG - Intronic
1184802451 22:46769840-46769862 CTGTGGGGTTGGAGAGGATCGGG + Intronic
949151591 3:774620-774642 CTGTGTGTTTGGAGGTGATAGGG - Intergenic
954609809 3:51938300-51938322 ATGTGGGCTAGCAGGGAATAGGG - Intronic
954627178 3:52028915-52028937 GTGGGGGTGTGCAGGGGATGGGG + Intergenic
955908113 3:63829208-63829230 CTGTAGGTTTGGGGGGTATAGGG + Intronic
956186898 3:66571260-66571282 CTGTGGGTTAGGTGGGGGTAGGG - Intergenic
956808593 3:72842204-72842226 CTGTGTATTTGTAGGGGAAATGG - Intronic
958421045 3:93931890-93931912 ATGTGGTTGTGCAGTGGATAAGG + Intronic
958895194 3:99821533-99821555 CTGAAGGTTTACAGGGAATAAGG - Intronic
959459181 3:106604026-106604048 GTGTGTGTTTGCTGGGGATGTGG + Intergenic
959767426 3:110048306-110048328 ATGTGTCTTTGCAGGTGATATGG + Intergenic
960233689 3:115256940-115256962 GTGTGTCTTTGCAGGTGATATGG - Intergenic
961995307 3:131235691-131235713 CTGTGAGTATGAATGGGATAAGG - Intronic
962038530 3:131680827-131680849 CTGTGGGGACGCAGGGGAAAGGG - Intronic
962504401 3:136031177-136031199 TTGTGGTTTTGCAGGGGTTAAGG + Intronic
963358072 3:144235694-144235716 CTGTAGGTGTGCAGGGGACAGGG - Intergenic
964286934 3:155128312-155128334 CTGAGGGATTGCAGGTGGTAGGG - Intronic
964304939 3:155329644-155329666 CTGTGCGTTTGCAGGGGCTGAGG + Intergenic
967232724 3:187355677-187355699 CTGTGGGTTGGCAGTGTACAAGG + Intergenic
967494982 3:190133079-190133101 CTGTGTGGTTGCAGGGAAAAAGG - Intergenic
968173673 3:196530064-196530086 CTTTGGGTATTCAGGGGAAAGGG - Intergenic
968447642 4:660371-660393 CTGAGGCTTGGCAGGGGATCTGG + Intronic
968649071 4:1753320-1753342 CTGTGGCTTTGCTGGAGGTAGGG - Intergenic
970495273 4:16618726-16618748 GTGAGGGTTTCCAGGTGATATGG + Intronic
970869366 4:20797752-20797774 CTGTGGGTCGGCAGGGAATTAGG + Intronic
973903159 4:55498703-55498725 CTGTGGAGTGGCAGGGGAGATGG + Intronic
974666496 4:64969236-64969258 CTGTGGCTTTGTAGGGTACAGGG + Intergenic
974725551 4:65794413-65794435 CTGTGGCTTTGCAGGGTGTAGGG + Intergenic
974738250 4:65969454-65969476 CTATGGGTTTGTAGGGGTTGGGG - Intergenic
974829534 4:67173232-67173254 ATTTGGGATTGTAGGGGATAAGG - Intergenic
976300207 4:83509354-83509376 CTGAGGGTTTGAAGGGGGAAGGG + Intronic
978479636 4:109174568-109174590 CTGTGGCACTGCAGGGCATATGG + Intronic
979984322 4:127295618-127295640 CTGTGGTTTTGCAGGGTACAGGG + Intergenic
981119326 4:141030783-141030805 ATGGGGGTTGCCAGGGGATAGGG + Intronic
981189682 4:141847580-141847602 CTGTGGGGTGGCAGAGGATGGGG - Intergenic
982478943 4:155885338-155885360 CTGAAGGTTTGCAGGGCATGTGG + Intronic
984054355 4:174908669-174908691 ATGAGGGTTTGCTGGGGATTGGG + Intronic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985842398 5:2317927-2317949 CTGTGGGTTTGGTGGGGCCATGG + Intergenic
986116413 5:4779682-4779704 CTGGGGGTTATCAGGGGTTAGGG + Intergenic
986502825 5:8418010-8418032 TTGTGGGGTTGCAGTGGAGAAGG - Intergenic
986551653 5:8962758-8962780 CTGTGGGGTTTGGGGGGATAGGG - Intergenic
987859791 5:23469557-23469579 CTATGAGTTTTCAGGGGACACGG + Intergenic
988276155 5:29083268-29083290 CTGTTGGTGTGCAGGGGACAAGG + Intergenic
988940944 5:36146712-36146734 CTGTCAGTTTGCAGGGGAACAGG - Intronic
989585970 5:43074150-43074172 CTGAGTGTTTGAAGGGGAAAGGG + Intronic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992596930 5:78356647-78356669 CGGTTGGTTTGCAGGAGAGAGGG + Intergenic
993488683 5:88518708-88518730 CTGAGGGTATGCATTGGATAGGG - Intergenic
995289719 5:110437972-110437994 CTGAAGGTTTTCAGTGGATAAGG + Intronic
999581968 5:153049023-153049045 TTGTGGGTTTTCAGTGGACAGGG - Intergenic
1000233503 5:159336520-159336542 CTGTGGGGCTGCAGGGGTCATGG + Intergenic
1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG + Intergenic
1002183364 5:177442676-177442698 CTGTGTGGGTGAAGGGGATAGGG + Intronic
1002291174 5:178202006-178202028 CTGTGGGTTGGCAAGGGCTGGGG + Intergenic
1002495646 5:179609563-179609585 CTGTGGGTCTCCAGGGGCTTGGG + Exonic
1003880481 6:10475789-10475811 TTTTGGGTTTGCAGGGGGTGGGG - Intergenic
1004764530 6:18710720-18710742 CTGTGGGTGTACAGGGCATCTGG - Intergenic
1005673006 6:28125853-28125875 CTGTGAGTGATCAGGGGATATGG + Intronic
1006275012 6:32997590-32997612 TTGTGTGTTTTCAGTGGATACGG + Intergenic
1006582184 6:35083541-35083563 CTGTGGGTCTGACGGGGATGTGG - Intronic
1006728758 6:36219250-36219272 CTGAGGGTTGGCGGGGGGTAGGG - Intronic
1007081632 6:39109245-39109267 CTGGGGGCTTGCCTGGGATATGG + Intronic
1010508816 6:76692035-76692057 CTGTGGGTTGGTGGAGGATAAGG + Intergenic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1014520768 6:122439396-122439418 CTGTGACTTTGCAGGGTAAAGGG - Intergenic
1014731662 6:125038991-125039013 CTGTGGCTTGTCAGGGGATGGGG - Intronic
1016874784 6:148853891-148853913 TTTTGGGTATGCAGGGGGTAGGG - Intronic
1017309276 6:152957303-152957325 CTATGGCTTTGCTGGGTATATGG - Intergenic
1018702302 6:166436724-166436746 GGGTGGGTTTGCATGGGAAATGG + Intronic
1018861902 6:167717082-167717104 CTGTTTGTTGGCAGGGGACAGGG - Intergenic
1019131954 6:169883370-169883392 CTCTGGGTTATGAGGGGATAAGG + Intergenic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019613768 7:1949614-1949636 CTGTGGGGTTTCAGGGGAGGTGG - Intronic
1020101497 7:5396771-5396793 ATGTGGCTTTGCAGGAGATGTGG + Intronic
1020439483 7:8201988-8202010 CTGGGGGTAGGCAGGGGACATGG - Intronic
1022369828 7:29759943-29759965 CTCAGGGTCTGAAGGGGATACGG + Intergenic
1023138356 7:37076549-37076571 GTTTGGGTTTTCAGGTGATAAGG - Intronic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025799666 7:64774044-64774066 CTCTGGGGTTGCAGAGAATATGG + Intergenic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026117285 7:67506574-67506596 CTATGGGGTTGCTGGGGAGAGGG + Intergenic
1026132029 7:67628838-67628860 CTGTGGGTTTGAAGATGAAAAGG + Intergenic
1026878007 7:73890705-73890727 CCTTGGGTTTGCAGGGCCTACGG + Intergenic
1027235576 7:76295694-76295716 CTGTGGGCTTCCAGGGCACAGGG - Intergenic
1029635981 7:101784040-101784062 ATGTGGGTGGGCAGGGGACAGGG + Intergenic
1029868924 7:103667128-103667150 CTATGGATTTGCAGAGGAAAAGG + Intronic
1031637603 7:124120258-124120280 CTGTGGTTTTGCCAGGCATATGG - Intergenic
1031746062 7:125499612-125499634 GTGGGAGTTTGCAGGGGAGATGG - Intergenic
1033367961 7:140685610-140685632 CTGTGGCTTTGGTAGGGATAAGG - Intronic
1034277166 7:149829047-149829069 GTGTGGGGTGGCAGGGGAGAAGG - Intergenic
1034337099 7:150330762-150330784 CTGGGGCTTTGCAGGGGACTTGG - Exonic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034937138 7:155207494-155207516 CTCTGGGTGTGCAGGTGATTTGG + Intergenic
1034958908 7:155352134-155352156 CTGCTGGTGTGCAGGGGACACGG + Intergenic
1035136121 7:156704303-156704325 CTGTGGGTTTGTTGGTGTTATGG - Intronic
1035922824 8:3696191-3696213 CTGTCTGTTTGAAGGGCATATGG - Intronic
1035958711 8:4112691-4112713 ATGAGGGTTTGCAAGTGATATGG + Intronic
1036647927 8:10623652-10623674 ATGTGGCTTTGCTGGGGACATGG - Intronic
1037353508 8:17991860-17991882 CTTTGGGGTTTCAGGGGAAAGGG - Intronic
1037611785 8:20481975-20481997 CTCAGTGTGTGCAGGGGATATGG - Intergenic
1037741046 8:21609521-21609543 CGGTAAGTGTGCAGGGGATATGG - Intergenic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1039564593 8:38542029-38542051 CTGAGGGGTTGCTGGGGCTAGGG - Intergenic
1039956439 8:42210550-42210572 ATCTGGCTTTGCAGGGGATGGGG + Intergenic
1040418716 8:47219471-47219493 CTCTTGGTTTGCTGGGGACAGGG + Intergenic
1044022767 8:87127842-87127864 CTGTGGGTTTCCAGGATTTAAGG - Intronic
1047210332 8:122835354-122835376 CTGAGGGTTTGAAGGGGGAAGGG + Intronic
1048001145 8:130380441-130380463 CTGAGGGTTTGCAGGGTGCAGGG + Intronic
1048717148 8:137282805-137282827 CTGAGGGTTTGAAGGGGGAAGGG - Intergenic
1048833174 8:138496224-138496246 CTGTGGCTTGGCTGGGGACAGGG - Intronic
1048979028 8:139693236-139693258 CTGTGAGTCTGCAGGGCATCTGG - Intronic
1050194906 9:3071926-3071948 GTGTTAGTTTGCTGGGGATAAGG + Intergenic
1051452578 9:17213942-17213964 GTGTGTCTTTGCAGGTGATATGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059415271 9:114158309-114158331 CTGTGTGTTTCCAGGTAATAAGG + Intronic
1060402581 9:123357092-123357114 CTGTGGGGTGGCTGGGGATTTGG + Intronic
1061919510 9:133775035-133775057 CTGTAGGTTTGCAGGTAACATGG - Exonic
1062134146 9:134915832-134915854 ATGTGGATTTGCAGGGAACATGG - Intronic
1185738556 X:2512042-2512064 CTGTGGGTTTCCAGGCGTGAGGG + Intergenic
1186208721 X:7227882-7227904 GTGGTGGTTTCCAGGGGATAGGG - Intronic
1187800565 X:23058036-23058058 CAGTGGGTTTCCAGGTGTTAGGG + Intergenic
1188045926 X:25426251-25426273 CTTTGGGTTTGCACGGGAGCTGG - Intergenic
1188473868 X:30569345-30569367 GTGTGGGTATGTAGGGGAAATGG + Intronic
1188479238 X:30620435-30620457 CTCTGAGTTTACAGGGGATCTGG + Intergenic
1189260884 X:39678130-39678152 CTGGGGCTGTGCAGGGGATGGGG + Intergenic
1190739701 X:53280878-53280900 CTGTGGGCTTGTGGGGGACAGGG - Intronic
1190884625 X:54520713-54520735 CTGTGGGGGTGCAGGGGAACTGG + Intergenic
1191717310 X:64202625-64202647 CTTTGGCATTGCAGGGGAAAGGG - Intronic
1192826677 X:74704495-74704517 CTGTGTGTTTGTGGGGGAAATGG - Intergenic
1192889894 X:75378906-75378928 GTGTGAGTTTGCAGGGAATAAGG + Intronic
1196929545 X:120667763-120667785 CTGTGGGTCTGCTGGGTCTATGG + Intergenic
1196970042 X:121098687-121098709 CTGAGAGTTTGCAGAGGATATGG + Intergenic
1197556347 X:127959690-127959712 CTTTGGGAATTCAGGGGATAAGG - Intergenic
1197765210 X:130055694-130055716 CTGTGGTTTAGCAGGGGACGGGG + Intronic
1198037857 X:132819710-132819732 CTCTGGGATGGCAGGGGACATGG - Intronic
1198627686 X:138596856-138596878 CTGGGGCTGTGCAGGGGAAAAGG + Intergenic
1198792673 X:140362601-140362623 CTGTTGGTGTGCAGAGAATAGGG - Intergenic
1199096115 X:143742212-143742234 ATGGTGGTTCGCAGGGGATATGG - Intergenic
1200840200 Y:7774037-7774059 CTGTGAGTCTCCTGGGGATATGG - Intergenic