ID: 1163291226 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:16380685-16380707 |
| Sequence | AGAGCCTCAGACGACCGCAT CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1163291226_1163291228 | 9 | Left | 1163291226 | 19:16380685-16380707 | CCGATGCGGTCGTCTGAGGCTCT | No data | ||
| Right | 1163291228 | 19:16380717-16380739 | TCACACAGATGCGACTCTCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1163291226 | Original CRISPR | AGAGCCTCAGACGACCGCAT CGG (reversed) | Intronic | ||