ID: 1163291228 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:16380717-16380739 |
Sequence | TCACACAGATGCGACTCTCT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1163291224_1163291228 | 18 | Left | 1163291224 | 19:16380676-16380698 | CCAGTCACACCGATGCGGTCGTC | No data | ||
Right | 1163291228 | 19:16380717-16380739 | TCACACAGATGCGACTCTCTAGG | No data | ||||
1163291226_1163291228 | 9 | Left | 1163291226 | 19:16380685-16380707 | CCGATGCGGTCGTCTGAGGCTCT | No data | ||
Right | 1163291228 | 19:16380717-16380739 | TCACACAGATGCGACTCTCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1163291228 | Original CRISPR | TCACACAGATGCGACTCTCT AGG | Intronic | ||