ID: 1163291228

View in Genome Browser
Species Human (GRCh38)
Location 19:16380717-16380739
Sequence TCACACAGATGCGACTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163291224_1163291228 18 Left 1163291224 19:16380676-16380698 CCAGTCACACCGATGCGGTCGTC No data
Right 1163291228 19:16380717-16380739 TCACACAGATGCGACTCTCTAGG No data
1163291226_1163291228 9 Left 1163291226 19:16380685-16380707 CCGATGCGGTCGTCTGAGGCTCT No data
Right 1163291228 19:16380717-16380739 TCACACAGATGCGACTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163291228 Original CRISPR TCACACAGATGCGACTCTCT AGG Intronic