ID: 1163291448

View in Genome Browser
Species Human (GRCh38)
Location 19:16381828-16381850
Sequence GTGCGAGTCCCCCGCGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163291441_1163291448 -6 Left 1163291441 19:16381811-16381833 CCCTGGGCCTAGGGCCCGTGCGA No data
Right 1163291448 19:16381828-16381850 GTGCGAGTCCCCCGCGGCCTGGG No data
1163291435_1163291448 30 Left 1163291435 19:16381775-16381797 CCGTCTGTGGGTGCTTCTGCGAT No data
Right 1163291448 19:16381828-16381850 GTGCGAGTCCCCCGCGGCCTGGG No data
1163291442_1163291448 -7 Left 1163291442 19:16381812-16381834 CCTGGGCCTAGGGCCCGTGCGAG No data
Right 1163291448 19:16381828-16381850 GTGCGAGTCCCCCGCGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163291448 Original CRISPR GTGCGAGTCCCCCGCGGCCT GGG Intronic