ID: 1163297709

View in Genome Browser
Species Human (GRCh38)
Location 19:16422880-16422902
Sequence CCTGGGAGGCAGAAGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163297702_1163297709 16 Left 1163297702 19:16422841-16422863 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 1163297709 19:16422880-16422902 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1163297700_1163297709 17 Left 1163297700 19:16422840-16422862 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 1163297709 19:16422880-16422902 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1163297698_1163297709 25 Left 1163297698 19:16422832-16422854 CCTGTGATCCCAGCTACTCAGGA 0: 1115
1: 60805
2: 152020
3: 236754
4: 201718
Right 1163297709 19:16422880-16422902 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163297709 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG Intronic
Too many off-targets to display for this crispr