ID: 1163297954

View in Genome Browser
Species Human (GRCh38)
Location 19:16424518-16424540
Sequence CTGCAGACACAGGCTGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 947
Summary {0: 1, 1: 0, 2: 20, 3: 104, 4: 822}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163297946_1163297954 13 Left 1163297946 19:16424482-16424504 CCCCTAACCTGACTTTCAAAACT 0: 1
1: 0
2: 1
3: 21
4: 251
Right 1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG 0: 1
1: 0
2: 20
3: 104
4: 822
1163297948_1163297954 11 Left 1163297948 19:16424484-16424506 CCTAACCTGACTTTCAAAACTCT 0: 1
1: 0
2: 1
3: 22
4: 267
Right 1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG 0: 1
1: 0
2: 20
3: 104
4: 822
1163297950_1163297954 6 Left 1163297950 19:16424489-16424511 CCTGACTTTCAAAACTCTTGGCA 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG 0: 1
1: 0
2: 20
3: 104
4: 822
1163297944_1163297954 27 Left 1163297944 19:16424468-16424490 CCAGTAAAGTACCTCCCCTAACC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG 0: 1
1: 0
2: 20
3: 104
4: 822
1163297945_1163297954 16 Left 1163297945 19:16424479-16424501 CCTCCCCTAACCTGACTTTCAAA No data
Right 1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG 0: 1
1: 0
2: 20
3: 104
4: 822
1163297947_1163297954 12 Left 1163297947 19:16424483-16424505 CCCTAACCTGACTTTCAAAACTC 0: 1
1: 0
2: 3
3: 25
4: 233
Right 1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG 0: 1
1: 0
2: 20
3: 104
4: 822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163297954 Original CRISPR CTGCAGACACAGGCTGGGCA CGG Intronic
900147190 1:1163413-1163435 CTGCAGACACAGGCTGGAGCGGG + Intergenic
900164249 1:1238372-1238394 CGGCAGGCACAGGCAGGGCCAGG + Intergenic
900275234 1:1821709-1821731 CAGCAGCCACAGGCAGGTCATGG - Intronic
900470761 1:2853854-2853876 CTGCAGACATAGCCTGTGTAGGG + Intergenic
900471254 1:2856149-2856171 CTGCAGGCACAGCCGGGGCAGGG - Intergenic
900651485 1:3732194-3732216 CTGCAGCCCCAGGCTGGGGATGG - Intronic
901212399 1:7534050-7534072 CAGGAGAGCCAGGCTGGGCAAGG - Intronic
901260233 1:7865645-7865667 CTCCAAATACAGGCTGAGCATGG + Intergenic
901311750 1:8274933-8274955 CTGCTGATCAAGGCTGGGCACGG + Intergenic
901627036 1:10630306-10630328 CAGCAAACACACCCTGGGCAAGG - Exonic
901642536 1:10700161-10700183 CTGGGGCCACAGGCTGGGCCAGG - Intronic
901656605 1:10773162-10773184 CATCAAACATAGGCTGGGCAGGG + Intronic
901697775 1:11021905-11021927 CAAAAGACATAGGCTGGGCATGG - Intronic
901809111 1:11756312-11756334 GTTAAGACACAGGTTGGGCATGG + Intergenic
901837389 1:11933392-11933414 CCTCAGACAGAGGCCGGGCACGG - Intergenic
902215738 1:14933381-14933403 CTGCAGAACCTGGCCGGGCATGG - Intronic
902819698 1:18936402-18936424 CAGCAGACACGGGATGGGGATGG - Intronic
902903955 1:19540586-19540608 CTGCAAAAACTAGCTGGGCATGG - Intergenic
903503208 1:23813556-23813578 TTGCAGCCAGAGGCCGGGCATGG - Intronic
903632363 1:24785561-24785583 CTGAAGAAATAGGCTGGGCGCGG + Intronic
903741482 1:25560925-25560947 CTGCAAGCCCAGGCTGGGCAGGG - Intronic
903952840 1:27006080-27006102 CTGCAGGCACTGGCTGAGCAGGG - Exonic
904073333 1:27818983-27819005 TTGCAAAAATAGGCTGGGCATGG + Intronic
904194146 1:28772084-28772106 CACCAGCCTCAGGCTGGGCACGG - Intergenic
904209756 1:28879229-28879251 GTCCAGTCCCAGGCTGGGCACGG + Intergenic
904798025 1:33072099-33072121 CTGCTGGCACGGGCTGGGCACGG - Intronic
905057509 1:35108641-35108663 GTACACAGACAGGCTGGGCACGG - Intronic
905076242 1:35273002-35273024 ATGCAGTCACCGGCTGGGCGTGG - Intronic
905279377 1:36839180-36839202 TTGCAGAGGCAAGCTGGGCAGGG - Intronic
905481406 1:38264508-38264530 CTGAAGCAACAGCCTGGGCATGG + Intergenic
905733121 1:40310041-40310063 CTACAGCCACAGAGTGGGCATGG - Intronic
905753213 1:40484487-40484509 AGGCAGAAAAAGGCTGGGCACGG - Intronic
905920410 1:41715370-41715392 CTGAAGACTCAGGCTGGACCTGG - Intronic
905947941 1:41919412-41919434 CTGCAGAGCAAGGCAGGGCAGGG - Intronic
906148154 1:43572116-43572138 CAGCAGCCAGAGGCTGAGCAGGG - Intronic
906444343 1:45881884-45881906 TTTAAGAGACAGGCTGGGCATGG + Intronic
906448086 1:45921282-45921304 CCACAGACATAGGCTGGGCACGG - Intronic
907013306 1:50985900-50985922 CAAAAGACACAAGCTGGGCATGG - Intergenic
907107810 1:51900141-51900163 TTGCAGCAATAGGCTGGGCACGG + Intergenic
907215236 1:52858104-52858126 ATTAAGATACAGGCTGGGCATGG + Intronic
907445912 1:54507590-54507612 GTGCAGGCACAGGGTGGGCGTGG + Intergenic
907598370 1:55742031-55742053 CTGCAGTCAAAGGCAGGGCAAGG - Intergenic
907841172 1:58158825-58158847 ATGCAGGCACAGGCAAGGCAAGG + Intronic
908163873 1:61438310-61438332 CACCACACACTGGCTGGGCAGGG - Intronic
909632155 1:77778964-77778986 CTGCAGATTTAGGCGGGGCACGG - Intergenic
909972585 1:82008378-82008400 GTGCAGAAATAAGCTGGGCATGG - Intergenic
910342478 1:86203435-86203457 CTGCAGTCACAGGACGAGCAGGG - Intergenic
910394900 1:86782448-86782470 GTGCTGAAACAGGCTGGGCATGG + Intergenic
912987761 1:114452181-114452203 CATCATAAACAGGCTGGGCATGG + Intronic
913106049 1:115615019-115615041 ATGCAAACACTGTCTGGGCATGG - Intergenic
913666757 1:121056083-121056105 CTGAATGGACAGGCTGGGCATGG - Intergenic
914018501 1:143843519-143843541 CTGAATGGACAGGCTGGGCATGG - Intergenic
914250328 1:145917138-145917160 GAGCAGAAACAGGCTGGGCATGG + Intronic
914657056 1:149751722-149751744 CTGAATGGACAGGCTGGGCATGG - Intergenic
914696462 1:150085988-150086010 ATGACAACACAGGCTGGGCATGG - Intronic
914755090 1:150557922-150557944 CTGCAGGCACCAGCAGGGCAGGG - Intronic
915246991 1:154563162-154563184 AAACAGACACAGGCCGGGCATGG + Intergenic
916061005 1:161098564-161098586 CCGCAGGCTCAGGCTGGGCCTGG + Exonic
916962459 1:169903169-169903191 CTCCAGACAAAGGTTGGGCCAGG + Intergenic
917435577 1:175017698-175017720 CAGCACACAGAGGGTGGGCAAGG + Intronic
917457841 1:175200840-175200862 CTGTTGACAAGGGCTGGGCAGGG + Intergenic
917819549 1:178748560-178748582 AGGCAGGCACTGGCTGGGCACGG + Intronic
917898475 1:179517039-179517061 CTGAAGACAAAGGGTGGGTAGGG - Intronic
917968313 1:180192263-180192285 CTGCAGAGACAGGCCGGGGGCGG + Intronic
918135335 1:181668737-181668759 ATGTAGACCCAGGCTGGGCATGG + Intronic
918489055 1:185060826-185060848 TTGAGGAAACAGGCTGGGCAAGG + Intronic
919685857 1:200482967-200482989 CTACAAACAGAGGCTGGGCGCGG - Intergenic
919712647 1:200743648-200743670 CTGCTAATATAGGCTGGGCATGG + Intronic
919759986 1:201091793-201091815 CTGCAGAGGCAGGCAGGGAAGGG + Intronic
919841178 1:201610581-201610603 CTGCGGACAGAGGCAGGACATGG - Intergenic
919912871 1:202122798-202122820 CTCCGGCCACAGGCCGGGCAGGG - Intergenic
919945416 1:202315740-202315762 CTGAAAACTCGGGCTGGGCAAGG - Intronic
920200572 1:204257527-204257549 CTGCAGGGACAGGCGGCGCAGGG + Exonic
920562449 1:206948361-206948383 CTGCACCCACAAGGTGGGCAAGG - Intergenic
920786417 1:209046451-209046473 TTGCAGAAACAGGCTGGGCACGG - Intergenic
921048452 1:211493668-211493690 CAGCACACACAGGCTTGGCTGGG - Intergenic
921745805 1:218739599-218739621 ACGCAGACACCAGCTGGGCAAGG - Intergenic
922262114 1:223951961-223951983 CGGGAGGCACAGGCTGGGCCTGG + Intergenic
922707446 1:227796786-227796808 CTACAGAGACAGCCTGGGCTAGG - Intergenic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
922740376 1:228011001-228011023 GTGCAGACACTGGCTGAGCAGGG - Intronic
923614561 1:235526049-235526071 CTGCTGACAGGGGCCGGGCATGG + Intergenic
923688457 1:236170683-236170705 TTGCATATACAGGCCGGGCACGG + Intronic
924038825 1:239963532-239963554 CTGCAGGCACCTGCTGAGCAGGG + Intergenic
924284556 1:242472463-242472485 CTGCAGCCAAATTCTGGGCAAGG + Intronic
924495510 1:244584959-244584981 CTGCAGACCTAGGCTAGGCCAGG - Intronic
924942077 1:248818904-248818926 CAGCAGGCACATGCTGGGCTGGG - Intronic
1063071478 10:2671062-2671084 GTGCAGGCAGAGGCGGGGCAGGG - Intergenic
1063747393 10:8899890-8899912 CAGCAGAATCAGGCTGGGCGCGG - Intergenic
1064144027 10:12813266-12813288 CCGCATACTCAGTCTGGGCATGG + Intronic
1064146528 10:12830413-12830435 CTGCAAGCACTGGCTGGGCCTGG - Exonic
1064860565 10:19820785-19820807 CTTCAGCTGCAGGCTGGGCACGG + Intronic
1065181298 10:23128934-23128956 CTGCAGACCTAAGCTGGGAATGG + Intergenic
1065444661 10:25786010-25786032 TTACACACAGAGGCTGGGCACGG - Intergenic
1065456608 10:25912664-25912686 TTGCAAACGGAGGCTGGGCATGG - Intergenic
1066489831 10:35883760-35883782 CTGTAGTAAAAGGCTGGGCATGG - Intergenic
1066556539 10:36620566-36620588 CTGTAGACACAGGCTTGGCATGG - Intergenic
1066669606 10:37823043-37823065 ATGCAAACAGTGGCTGGGCACGG + Intronic
1066982118 10:42426551-42426573 ATACAGACTCAGGCTGGGCGTGG + Intergenic
1067238622 10:44472153-44472175 ATGCAGAGAGAGGCCGGGCATGG - Intergenic
1067779584 10:49190038-49190060 CTGTAGACAGTGGCTGGGGACGG + Intergenic
1069047980 10:63763145-63763167 CTGAAGACGCAGGCTTGGAATGG + Intergenic
1069607643 10:69749775-69749797 CTGCATTCACTGGCTGGGGAAGG + Intergenic
1069682706 10:70296636-70296658 CTGGAGACACAGTCAGAGCACGG + Intergenic
1069693261 10:70368563-70368585 ATGCAGATTCAGGCTGGGCGCGG - Intronic
1069693312 10:70368911-70368933 ATGCAGATTCAGGCCGGGCACGG - Intronic
1069748362 10:70730297-70730319 CGGCAGACAGAGGCTGGGCCTGG + Intronic
1069849357 10:71395361-71395383 CTGCAGGCAACGGCTGGGCCAGG - Intergenic
1069995985 10:72342448-72342470 CTGCAGGCAGAGGCTGGGGCTGG + Intronic
1070167480 10:73909693-73909715 CTGCAGGCCTAGGCTGGGAAAGG + Intronic
1070561797 10:77573396-77573418 CAGCAGGGGCAGGCTGGGCAGGG + Intronic
1070782677 10:79146696-79146718 CACCAGACACAGGCAGGGCTGGG + Intronic
1071214396 10:83382968-83382990 ATTCAGAAGCAGGCTGGGCACGG + Intergenic
1071673280 10:87631588-87631610 TTACAAACATAGGCTGGGCATGG + Intergenic
1072019130 10:91381336-91381358 TTGCAGACAAAGGCCAGGCAGGG - Intergenic
1072121799 10:92411242-92411264 CAGTAGAAACGGGCTGGGCATGG + Intergenic
1072140491 10:92585101-92585123 ATGCACACATTGGCTGGGCATGG + Intergenic
1072232953 10:93428494-93428516 ATTCACATACAGGCTGGGCAAGG - Intronic
1072267946 10:93748430-93748452 ATGCAGAATCAGGCCGGGCATGG - Intergenic
1072420200 10:95284642-95284664 ATGCATACAGAGGCTGGGCTTGG - Intronic
1072644105 10:97238506-97238528 ATTAAGACACAGGCTGGGCGTGG - Intronic
1072696634 10:97608904-97608926 CTGCAGTCCCAGGCTGAGCTAGG + Intronic
1073144373 10:101270843-101270865 CAGCAGTCTCAGGCTGGACAAGG - Intergenic
1073393795 10:103201343-103201365 CTAAAGCCTCAGGCTGGGCATGG + Intergenic
1073791751 10:106947551-106947573 CTGGAGCTACAGGCTGGGCGCGG + Intronic
1074232189 10:111548745-111548767 AAGCAAACACAGGCTGGGCATGG + Intergenic
1074598653 10:114890902-114890924 ATGCATATACAGGCTGGACATGG + Intronic
1074608985 10:115003209-115003231 CTGAGAAAACAGGCTGGGCACGG - Intergenic
1074772808 10:116744324-116744346 CTGCATACCCATGCTGGCCAGGG + Intergenic
1075026585 10:118989218-118989240 AAGAAGACATAGGCTGGGCACGG + Intergenic
1075259365 10:120949445-120949467 CTGCAGACACAGGGTGTGCAAGG - Intergenic
1075692657 10:124409397-124409419 CTACAGAAAAATGCTGGGCATGG + Intronic
1075715669 10:124553834-124553856 CTGCAGACAGAGGAGGGGCCTGG - Intronic
1075815193 10:125259736-125259758 CTGCACCCACAGGAGGGGCAGGG + Intergenic
1075825716 10:125355826-125355848 CTGCAGACTGAGGCAGGGCCCGG + Intergenic
1076100527 10:127774155-127774177 GTCCAGAGACAGGCTGTGCAGGG - Intergenic
1076166088 10:128284049-128284071 GTACAGAAAGAGGCTGGGCATGG + Intergenic
1076271982 10:129161684-129161706 CTAAAAACACAGGCTGGGCACGG + Intergenic
1076504750 10:130964258-130964280 CTGCAGAGTGAGACTGGGCAAGG + Intergenic
1076987953 11:253015-253037 CTCCAGGCACAGGCTTGGCCTGG - Intergenic
1076995471 11:295514-295536 CCCAAGACAAAGGCTGGGCAGGG - Exonic
1077052664 11:574802-574824 GTGCACACACAGGCGGGGGAGGG - Intergenic
1077171582 11:1168684-1168706 CTGCAGGCCCAGGCTGGTCTGGG - Exonic
1077478951 11:2803955-2803977 CTGCGGCCACATGCTGGCCAAGG - Intronic
1078853983 11:15191267-15191289 ATGCAGACACCGGCCGGGCACGG - Intronic
1078955403 11:16188771-16188793 TTGAAGAGATAGGCTGGGCACGG + Intronic
1079123585 11:17702498-17702520 CAGCAGCTACTGGCTGGGCATGG - Intergenic
1079356747 11:19736166-19736188 CTCCAGACACAAACTGGGCATGG + Intronic
1079414248 11:20218298-20218320 CTGCAGTTAAAGGCTGGCCAAGG - Intergenic
1079984217 11:27183474-27183496 GTTCAAAAACAGGCTGGGCATGG + Intergenic
1080294024 11:30704709-30704731 ATGCAGATTCTGGCTGGGCATGG + Intergenic
1080763363 11:35273739-35273761 CTTATGGCACAGGCTGGGCAGGG + Intronic
1080830360 11:35888289-35888311 TTCCAGCCACTGGCTGGGCATGG + Intergenic
1080855409 11:36107484-36107506 CTACAAACAGAGGCTGGGCATGG - Intronic
1081669708 11:44936179-44936201 CAGCAGACACTGGGTGGGCGGGG - Intronic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1081982581 11:47277585-47277607 ATGTAGAAAGAGGCTGGGCACGG - Intronic
1082078472 11:47993581-47993603 CTACAGACGCAGGCTGGGTACGG - Intronic
1082207564 11:49456113-49456135 CTGGAGGAACAGGCTGGGCGTGG - Intergenic
1083271716 11:61576198-61576220 CTGCAGACACTAGTTGGACAGGG + Intronic
1083325768 11:61872244-61872266 CCCTAGTCACAGGCTGGGCAGGG + Intergenic
1083451270 11:62747038-62747060 CTGAGGCCACAGGCTGGGTATGG + Intergenic
1083550970 11:63590029-63590051 CTGCTGACGGAGGCTGGGCATGG - Intronic
1083741996 11:64716123-64716145 CAGCAGACAGAGGCTAGGCCAGG - Intronic
1083749131 11:64751709-64751731 CTCCTGACAGAGGCTGGGCTGGG + Intronic
1083892993 11:65606053-65606075 CTGCAGAGCCAGGCCAGGCATGG - Exonic
1084001661 11:66298579-66298601 TTGTAGCCACAGGCTGGGCGCGG + Intergenic
1084150938 11:67287722-67287744 CAGCAGAAACAGGCTGGACTTGG + Intergenic
1084155498 11:67310646-67310668 CTGTAGGCACAGGCTGGAGAGGG + Intronic
1084647076 11:70464831-70464853 CTGCAGACATTGCCTGGGCCAGG + Intergenic
1085290372 11:75394849-75394871 CTGAATCCAAAGGCTGGGCATGG - Intergenic
1085558316 11:77446219-77446241 GCTCAGACCCAGGCTGGGCACGG + Intronic
1086647712 11:89245630-89245652 CTGGAGGAACAGGCTGGGCGTGG + Intronic
1086957761 11:92951222-92951244 ATGGAGAGACAGGCTGGGCATGG + Intergenic
1087424382 11:97969545-97969567 CCACTGACACAGGCTGGACAGGG + Intergenic
1088724758 11:112624179-112624201 GTGCAGAGAGAGGCAGGGCAGGG - Intergenic
1088987657 11:114924295-114924317 CTCCAGACACATGCTGTGCTAGG - Intergenic
1089143334 11:116305838-116305860 CTGGAGACATAGGTTGGGCCAGG + Intergenic
1089583386 11:119495398-119495420 CTGCAGCCAGTGGCCGGGCATGG - Intergenic
1089584527 11:119502111-119502133 CTGCAGAGAGAGGCAGGGCCGGG + Intergenic
1089767862 11:120781645-120781667 GTGAAGACACAGACAGGGCAGGG - Intronic
1090399419 11:126439524-126439546 ATGCAGATACTGGCTGGGCATGG + Intronic
1090698815 11:129276594-129276616 ATGCATATAAAGGCTGGGCAGGG - Intronic
1091563522 12:1631353-1631375 CAGCAGCAGCAGGCTGGGCATGG - Exonic
1091656743 12:2351644-2351666 CTGCAGACACACCCTGGGGAAGG - Intronic
1091671139 12:2453041-2453063 CTGCAGATACGGCCTGGACAGGG + Intronic
1091675543 12:2486376-2486398 ATTCAGACACACACTGGGCATGG + Intronic
1091734038 12:2904491-2904513 CTGAAGATACCTGCTGGGCATGG - Intronic
1091747817 12:3003818-3003840 CTGAGAACACAGGCTGGGGAAGG - Intronic
1092018827 12:5183069-5183091 CTGCAGACAGAGGCTGGGCTTGG - Intergenic
1093059666 12:14589426-14589448 CTGCAGAGACAGGGTGGGGGGGG + Intergenic
1093755020 12:22842496-22842518 TAGCAGAAAGAGGCTGGGCATGG - Intergenic
1095628037 12:44341290-44341312 CTGCACACTTGGGCTGGGCATGG - Intronic
1095954775 12:47799729-47799751 CTGCACCCACAGCCTTGGCAGGG - Intronic
1096262462 12:50101452-50101474 TAGCAGGCACAGGCTGGGCACGG - Intergenic
1096404983 12:51337242-51337264 AAGCAGCCATAGGCTGGGCATGG + Intronic
1096694638 12:53340693-53340715 CTGGAGACAAGGGCTGGGCTGGG - Intronic
1096707346 12:53430521-53430543 GAGGAGAGACAGGCTGGGCAAGG - Intronic
1097244501 12:57599764-57599786 AAGAAGACACAGGCCGGGCATGG + Intronic
1097885027 12:64720428-64720450 CTGAAGGCACAGGGTGTGCAGGG - Intronic
1098097790 12:66978478-66978500 CTTAAGACAAAGGCTGAGCAGGG - Intergenic
1098996657 12:77128548-77128570 AAACAGAAACAGGCTGGGCATGG + Intergenic
1099443732 12:82728428-82728450 CAGCAGACCCAGGCTGGGCGCGG + Intronic
1101943335 12:109117072-109117094 AAGCAGACTAAGGCTGGGCACGG + Intronic
1102128931 12:110509562-110509584 CTGCCATCCCAGGCTGGGCATGG - Intronic
1102170457 12:110838568-110838590 ATACAAACAAAGGCTGGGCATGG - Intergenic
1102880749 12:116482708-116482730 CTGCAGAGAGAGGCTAGGGATGG + Intergenic
1102943082 12:116961287-116961309 GTGCAGATACAGGCCGGGCACGG - Intronic
1103121666 12:118385397-118385419 CAGCAGTATCAGGCTGGGCATGG - Intronic
1103282757 12:119773716-119773738 CAGCAAACACAGGCCGGGCATGG - Intronic
1103303637 12:119947086-119947108 CAGCAGAAATAGGCCGGGCATGG - Intergenic
1103658448 12:122493901-122493923 ATACAGGCACAGGCTGGGCGCGG - Intronic
1103750310 12:123154098-123154120 CTGCAAACAGAGGCTTAGCAAGG + Intronic
1103767715 12:123293513-123293535 CTGCATGCCCAGGCTGGTCATGG - Exonic
1104662263 12:130619916-130619938 CTGCAGACACATGCTGTCCTTGG + Intronic
1104815810 12:131644777-131644799 CCTCTGACACAGGCTGGGGAGGG + Intergenic
1106209870 13:27631963-27631985 CTGAAGCCACAGGATAGGCATGG - Intronic
1106398340 13:29403333-29403355 GTGCAGATACAGGGTGGACAGGG - Intronic
1106459059 13:29952468-29952490 CTGAGGAGACAAGCTGGGCAAGG + Intergenic
1106558733 13:30831460-30831482 ATGCAGATACAGGCTGGGCGGGG + Intergenic
1107465115 13:40642626-40642648 CAGCATAAATAGGCTGGGCAGGG + Intronic
1107665754 13:42688625-42688647 CTGAATACATTGGCTGGGCATGG - Intergenic
1108321244 13:49292945-49292967 CTGCAGTCACAGCCCTGGCATGG - Exonic
1108681097 13:52781064-52781086 ATGCAGATGCAGGCTGGGGAAGG + Intergenic
1109524165 13:63554038-63554060 ACACATACACAGGCTGGGCACGG - Intergenic
1109762688 13:66850361-66850383 ATGCAGAAACTAGCTGGGCATGG + Intronic
1110054144 13:70943106-70943128 CCTCAGTCACAGGCTGGACATGG - Intergenic
1110364954 13:74672510-74672532 TTGCACACAGAGGCCGGGCATGG + Intergenic
1110568275 13:76977920-76977942 ATGCAGATACAGGCTGGGCATGG + Intergenic
1112035869 13:95496109-95496131 ATGCAGACACAGCCTGAGAAAGG - Intronic
1112159858 13:96855814-96855836 ATGCAAAGACAGGCCGGGCATGG + Intergenic
1112387968 13:98957942-98957964 GCACAGGCACAGGCTGGGCAGGG + Intronic
1112461710 13:99608361-99608383 GTTCAGACCCAGGCCGGGCACGG - Intronic
1112547299 13:100383280-100383302 TTGAAATCACAGGCTGGGCACGG - Intronic
1112938267 13:104827701-104827723 CTGAAGAAACCGGCTGGGCGCGG + Intergenic
1113370950 13:109725023-109725045 CTGCATTCACAGGCTGGGCTGGG + Intergenic
1113630813 13:111882389-111882411 ATGAAGCCACAGGCCGGGCACGG - Intergenic
1113855100 13:113439411-113439433 CTGTAGGCCCAGGCTGGGCACGG - Intronic
1114047357 14:18887260-18887282 ATGAAAAGACAGGCTGGGCACGG - Intergenic
1114441569 14:22752397-22752419 TAGTAGAGACAGGCTGGGCACGG - Intergenic
1117376389 14:55121838-55121860 TAGAGGACACAGGCTGGGCACGG - Intergenic
1118584225 14:67337219-67337241 CTGCCTAGACTGGCTGGGCATGG + Intronic
1118767596 14:68920628-68920650 GTGCAGACACAGGCTGGTGGAGG - Intronic
1118818044 14:69326509-69326531 CTGCAGCCACAGGCTGGCTGTGG + Intronic
1119037445 14:71242289-71242311 CTGCAGGGAGAGGCTGGACAAGG - Intergenic
1119348390 14:73944590-73944612 GTGCAGGCACAGGCTGTGCCCGG + Exonic
1119621323 14:76134136-76134158 CCACAGGCAGAGGCTGGGCAGGG - Intergenic
1119662112 14:76459547-76459569 CTGCAGAGAGAGGGTGGGCCTGG + Intronic
1119717394 14:76868612-76868634 CTGCAGACCCAGGCTTGGCAGGG - Intronic
1119823666 14:77639944-77639966 CAGTAGCCATAGGCTGGGCACGG + Intergenic
1119859913 14:77928748-77928770 ATGCAAAAACAGGCTGGGCACGG - Intronic
1119970905 14:78969198-78969220 CTACAGGAACAGGCTGAGCATGG - Intronic
1120160813 14:81142763-81142785 ATGCAAACATTGGCTGGGCATGG - Intronic
1120988955 14:90358147-90358169 CTGCCTGTACAGGCTGGGCATGG - Intergenic
1121028114 14:90631694-90631716 GTGCAGACTCAGGCTGGGCAGGG - Intronic
1121158245 14:91707895-91707917 GTGGAAATACAGGCTGGGCATGG - Intronic
1121519938 14:94579139-94579161 CAGCACACACAGGCTGGAGACGG + Intronic
1121853656 14:97246655-97246677 CTGGAGAGCCAGGGTGGGCATGG + Intergenic
1121886359 14:97546601-97546623 TTGCAGATACAGGCAGGGCAGGG - Intergenic
1122067260 14:99182414-99182436 CAGCAGACACACTCCGGGCAGGG + Intronic
1122213469 14:100188253-100188275 CTGCAGAATGAGGCTGGGCACGG - Intergenic
1122293725 14:100693542-100693564 CTGCAGACTCAGGCAGGGGCAGG - Intergenic
1122358059 14:101136134-101136156 CTGCAGGCTGAGGCTGGGAAGGG - Intergenic
1122638602 14:103143159-103143181 CTGCAGAAACACTCTGGGTAAGG + Intergenic
1122717071 14:103702237-103702259 CTGCAGACACTGGCTGGGCTTGG - Intronic
1122720676 14:103720530-103720552 CTCAGGACACAGGCTGGACATGG - Intronic
1122966526 14:105130460-105130482 CAGTAGATTCAGGCTGGGCATGG - Intergenic
1123038968 14:105482714-105482736 CTGCGGTCACTGGCTGGGCAGGG - Intergenic
1123577690 15:21689741-21689763 CTACAGACACAGAGTTGGCAGGG + Intergenic
1123614314 15:22132222-22132244 CTACAGACACAGAGTTGGCAGGG + Intergenic
1123699872 15:22906396-22906418 ATCCAGAAATAGGCTGGGCACGG - Intronic
1124066127 15:26345809-26345831 CAGGAGACACTGGCTGGGGAAGG + Intergenic
1124354937 15:28988045-28988067 ATACATCCACAGGCTGGGCATGG - Intronic
1124612824 15:31220240-31220262 CCACAGACACAGGCTGAGCGGGG - Intergenic
1124621698 15:31277643-31277665 CTGCAGGCCCAGGCTGGACCAGG - Intergenic
1124878502 15:33619695-33619717 CTGCAGGCCCAAGCTGGGGAAGG - Intronic
1125476330 15:40050418-40050440 AGGCAGACATAGGCTAGGCATGG + Intergenic
1125617297 15:41026260-41026282 CTGTGAAAACAGGCTGGGCACGG + Intronic
1125828099 15:42692800-42692822 CTGGAGGCACAGGGTGGGTAAGG - Exonic
1126992091 15:54389882-54389904 ATGCAGAAACTAGCTGGGCATGG - Intronic
1127352911 15:58170691-58170713 CTGAAGAAATAGGCAGGGCATGG - Intronic
1127923298 15:63512224-63512246 CTGCAGTTACTGGCTAGGCACGG - Intronic
1128045198 15:64612023-64612045 ATGCAAGTACAGGCTGGGCACGG - Intronic
1128055470 15:64696252-64696274 TTTAAGAAACAGGCTGGGCATGG + Intronic
1128419483 15:67478092-67478114 AGGCAGACAGAGGCTGGGCACGG + Intronic
1128465133 15:67904241-67904263 ATGCAGAAATTGGCTGGGCATGG - Intergenic
1128731974 15:70027295-70027317 CTGGGGACACCGGCTGGGCAGGG - Intergenic
1128776406 15:70323625-70323647 CTGCAGACAGAGGCAGGGCTTGG - Intergenic
1128830866 15:70767296-70767318 ATCCACACACAGGCCGGGCATGG + Intergenic
1129002863 15:72348314-72348336 CTGTTGACACAGGCTGAGAAAGG + Intronic
1129117183 15:73370931-73370953 CTGCTGCCACAGGCCGGCCAGGG + Intergenic
1129290824 15:74565974-74565996 ATGCAAACAGAGGCTGGACAGGG - Intronic
1129421407 15:75430249-75430271 CTTCATACACAGGAGGGGCAGGG + Exonic
1129478217 15:75802209-75802231 CTGGAGACCCAGGCAGGGCGGGG - Intergenic
1131123136 15:89835604-89835626 CAGCAGACACAGCCCGCGCAGGG + Exonic
1131134196 15:89920822-89920844 AAACAAACACAGGCTGGGCACGG + Intergenic
1131191244 15:90318672-90318694 CTGGAGAGACAGGCTGGGCTGGG - Intergenic
1131258085 15:90874391-90874413 CTCCAGGCCCAGGCAGGGCAGGG + Intronic
1131495679 15:92908826-92908848 ATGTATACACAGGCTGGGCGTGG + Intronic
1131707724 15:95016070-95016092 ATGAAAACTCAGGCTGGGCACGG - Intergenic
1202986559 15_KI270727v1_random:423986-424008 CTACAGACACAGAGTTGGCAGGG + Intergenic
1132486512 16:195071-195093 CTTCAGACACAGGATGAGCATGG - Intronic
1132558545 16:583339-583361 CTGGGTACACAGGGTGGGCATGG - Exonic
1132568522 16:634168-634190 CAGCGGAAACTGGCTGGGCATGG - Intergenic
1132682399 16:1148452-1148474 CTGCAGGCGGAGGCTGGGCTTGG - Intergenic
1132722942 16:1325919-1325941 TTCCAGACACAGGCTGCCCAGGG - Exonic
1132873520 16:2125835-2125857 CTGCCCACACAGGCTGTGAAGGG - Intronic
1133239976 16:4408440-4408462 CTGCTGACCCAGGGTGGCCAAGG + Intronic
1133345307 16:5065888-5065910 CAGCAGCCCCAGGCTGGCCATGG + Exonic
1133678111 16:8095080-8095102 CTGCAGACCCAGGCGAGACAAGG + Intergenic
1133778190 16:8914627-8914649 AATCAGACACAGGCTGGACATGG + Intronic
1134132900 16:11661740-11661762 CTACGGGTACAGGCTGGGCATGG - Intergenic
1134886300 16:17795739-17795761 AAGCAGACACAGGCTGGGCACGG + Intergenic
1135146509 16:19967305-19967327 ACCCAAACACAGGCTGGGCACGG - Intergenic
1135180208 16:20266875-20266897 GTGCAGACACAAGCATGGCAAGG + Intergenic
1135275496 16:21108829-21108851 CTGAAGATACAGGCTGGGTGCGG + Intronic
1135398632 16:22150109-22150131 ATGAAGACACAGGCTGGGTGCGG + Intronic
1135486242 16:22868115-22868137 CTGGAAAGATAGGCTGGGCATGG + Intronic
1135647336 16:24174630-24174652 CTGAAGAAAGAGGCAGGGCAGGG - Intronic
1135709169 16:24700525-24700547 ATTCAGACATAGGCTGGGCACGG - Intergenic
1135767645 16:25191691-25191713 CTACAGCAACAGGATGGGCATGG + Intergenic
1135984463 16:27173881-27173903 CTGCAGCAGCGGGCTGGGCAGGG - Intergenic
1136002233 16:27303575-27303597 CTCCAGTCCTAGGCTGGGCACGG + Intergenic
1136013346 16:27379143-27379165 CTGCACACACAGGCGGAGGATGG - Intergenic
1136132199 16:28230153-28230175 TTAAAGATACAGGCTGGGCACGG - Intergenic
1136363315 16:29795978-29796000 ATGGAGGTACAGGCTGGGCAGGG + Intronic
1136424822 16:30162760-30162782 TTTCAGGCCCAGGCTGGGCACGG + Intergenic
1136562441 16:31048151-31048173 TTGGAGACCCAGGCCGGGCATGG - Intergenic
1137621582 16:49879938-49879960 CTACAGCCACAGGCTGGGGAGGG + Intergenic
1138036897 16:53616779-53616801 ATGCACAACCAGGCTGGGCATGG + Intronic
1138345308 16:56316732-56316754 CTGCAGGCACGGGCAGGGCAGGG + Intronic
1138608659 16:58105737-58105759 CTGCAGACAGAGGAGGGGCCAGG - Intergenic
1139212947 16:65098654-65098676 ATGAAGACAGAGGCAGGGCATGG - Intronic
1139247127 16:65455960-65455982 CTGCAGGACCAGGCTTGGCATGG - Intergenic
1139710560 16:68772642-68772664 CACCAGACTTAGGCTGGGCACGG + Intronic
1139824490 16:69746297-69746319 CTGCAGGCTCAGGCTGGGTCTGG - Intronic
1139909978 16:70391711-70391733 CTGGTGACACAGGCTGGCCGGGG + Intronic
1140721033 16:77772407-77772429 GTGTAGGCATAGGCTGGGCAAGG + Intergenic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1141695491 16:85617201-85617223 TTCCAGACACGGGGTGGGCATGG - Intronic
1141897766 16:86969627-86969649 CTGAAGTCACAGGCTGAGCCAGG - Intergenic
1141941646 16:87279941-87279963 CTAATAACACAGGCTGGGCATGG - Intronic
1141949519 16:87331642-87331664 CTGCAGAGACAGGCTGGCTCTGG - Intronic
1142124849 16:88405172-88405194 TTGCAGCCACAGGATGGGCCAGG + Intergenic
1142153679 16:88523669-88523691 CTGCGACCACAGGCTGGGAAGGG - Intronic
1142640262 17:1281334-1281356 CTGCTGGCCCAGGCTGGTCAGGG + Intronic
1142875720 17:2851201-2851223 CTGCACACACTGGCTGGAAATGG + Intronic
1143029439 17:3959729-3959751 CCGGAGACACAGGCAGGGCCAGG - Intronic
1143314719 17:6023650-6023672 CTGCAGAGACTGGCTGTGAAGGG + Intronic
1143320433 17:6065046-6065068 CTGCAGACACAGGGGTGTCAGGG - Intronic
1143504719 17:7357226-7357248 TTGCAGACAGAGGCTAGGCAGGG - Intergenic
1143660360 17:8320870-8320892 CTTCACACACCAGCTGGGCAGGG - Exonic
1143663056 17:8339150-8339172 CTGGAGCCACAGGCCAGGCAAGG + Intergenic
1143727735 17:8860908-8860930 AAGCAGACACGGGCCGGGCACGG + Intronic
1143749525 17:9018339-9018361 CTGTGGACATAGGCTGGGCGCGG + Intergenic
1144170726 17:12657509-12657531 ATGCAATAACAGGCTGGGCACGG + Intergenic
1144457227 17:15429289-15429311 GTGCAGCCTTAGGCTGGGCACGG - Intergenic
1144831652 17:18135154-18135176 AAACAGAAACAGGCTGGGCACGG - Intronic
1144864296 17:18324950-18324972 CTGGAGGCAGAGGCTGTGCAGGG + Intergenic
1145029770 17:19495600-19495622 ATGCAGTCAGAGGCTGGGCCTGG - Intronic
1145256463 17:21326317-21326339 GTGTATACACAGGCCGGGCACGG + Intergenic
1145276604 17:21435192-21435214 GTCAAGACACAGGCTGGGCCAGG - Intergenic
1145314445 17:21721080-21721102 GTCAAGACACAGGCTGGGCCAGG - Intergenic
1145320149 17:21761635-21761657 GTGTATACACAGGCCGGGCACGG - Intergenic
1145712900 17:26993057-26993079 GTCAAGACACAGGCTGGGCCAGG - Intergenic
1145773318 17:27509019-27509041 CTTCAGGCCCAGGCTGGGAACGG - Intronic
1145914586 17:28564275-28564297 CAAAATACACAGGCTGGGCACGG + Intronic
1146774944 17:35605538-35605560 CTAAAGAAACTGGCTGGGCACGG - Intronic
1147158782 17:38559033-38559055 TAGCAGAGACAGGCTGGGGAGGG - Intronic
1147646534 17:42037818-42037840 CTGCAGAGGCCGGGTGGGCAGGG + Exonic
1147683003 17:42265639-42265661 GTGCATACTCAAGCTGGGCATGG - Intronic
1147699418 17:42383345-42383367 AGGCAAAAACAGGCTGGGCATGG - Intronic
1147743654 17:42682546-42682568 CAGGAGACAGAGGCTGGGGAAGG + Intronic
1147846186 17:43405437-43405459 ATGAAGAAACTGGCTGGGCACGG + Intergenic
1147945372 17:44077560-44077582 CTGCTGGCACAGCCTGGGCAAGG - Exonic
1147957313 17:44143226-44143248 TGTCAGCCACAGGCTGGGCATGG - Intronic
1148686680 17:49505060-49505082 CTGGGGACAAAGGCTGGGCGTGG - Intronic
1148776121 17:50096561-50096583 CTCAAGACTCAGGCAGGGCAGGG - Intronic
1148880801 17:50725046-50725068 ATGAAGAGAAAGGCTGGGCATGG - Intronic
1149570627 17:57669832-57669854 CCACACGCACAGGCTGGGCAGGG + Intronic
1149750678 17:59142578-59142600 ATACATACATAGGCTGGGCACGG - Intronic
1150455235 17:65301966-65301988 CTGAAGTCAAAGGCTGGGCTGGG - Intergenic
1150855286 17:68746516-68746538 ATGCAAACAAAGGCAGGGCATGG + Intergenic
1151026554 17:70684216-70684238 ATGCAGACACAGGACAGGCAGGG - Intergenic
1151291417 17:73153093-73153115 CAGCAGACTATGGCTGGGCACGG - Intergenic
1151295419 17:73182380-73182402 GTGCAGGTACTGGCTGGGCATGG - Intergenic
1151300698 17:73223025-73223047 CTACTAAAACAGGCTGGGCACGG + Intronic
1151678547 17:75612379-75612401 CTGCACATACAGGTTGGACATGG + Intergenic
1151915395 17:77114232-77114254 AGGCAGGCACTGGCTGGGCAAGG + Intronic
1152097748 17:78281743-78281765 CTGCTGCCACAGCCTTGGCAGGG - Intergenic
1152113349 17:78369658-78369680 CTGCAGACCCTGGCAGGGAAGGG - Intergenic
1152144862 17:78562025-78562047 CCACAGCCACAGGCTGGGGAAGG - Intronic
1152287800 17:79422591-79422613 CAGCAGCCTCAGGCTGGGCGGGG + Intronic
1152441545 17:80312904-80312926 CTGCTGGCACAGGCTGCTCAAGG - Intronic
1152572689 17:81127509-81127531 CACCAGACACTGGCAGGGCAAGG + Intronic
1152586210 17:81190594-81190616 CTGGAGACGGAGGCGGGGCAGGG - Intronic
1152699735 17:81812993-81813015 CTGGAGAGACAGGGTGGTCAGGG - Intronic
1152742004 17:82022568-82022590 CTGCAGAAACAGGCAGGGGTGGG - Intronic
1152895380 17:82907889-82907911 CTGCAGACCCTGCCTGGGGAGGG - Intronic
1153017450 18:596854-596876 CTGCAGACGCCGGGTGGGCGGGG - Intergenic
1153017469 18:596905-596927 CTGCAGACGCCGGGTGGGCGGGG - Intergenic
1153017488 18:596956-596978 CTGCAGACGCCGGGTGGGCGGGG - Intergenic
1153227196 18:2907932-2907954 ATGCAGACACTGGCAGGGCTGGG + Intronic
1153701072 18:7693822-7693844 ATGCAGACACAGGGTGGGGTTGG + Intronic
1154502441 18:15003535-15003557 CTGTTTACAGAGGCTGGGCAGGG - Intergenic
1155221335 18:23689054-23689076 CTGCAGCCACAGGCTGAGCCAGG - Intergenic
1155279918 18:24228908-24228930 AAGCAAACACAGGCTGGGCGCGG + Intronic
1155466849 18:26145406-26145428 CTGCACACAGAGGCCGGGCGCGG - Intronic
1155760563 18:29560032-29560054 GTGCAGACAGAGGCAGGGTATGG + Intergenic
1155795573 18:30032461-30032483 ATGCTGACACAGGCTGTGTAGGG + Intergenic
1156482483 18:37444993-37445015 GTGCAGACAGAGGCTGGGTGGGG + Intronic
1157128903 18:44984274-44984296 CTTCACAGACAGGCAGGGCAGGG + Intronic
1158930235 18:62317611-62317633 CTACAGATAAAGGCTAGGCATGG + Intergenic
1159182707 18:64929313-64929335 CTACAGAGAAATGCTGGGCAGGG + Intergenic
1159479489 18:68969313-68969335 CTTCAGACACAGGCAGGTAAGGG - Intronic
1159557425 18:69959954-69959976 ATGCAGGCAATGGCTGGGCACGG + Intronic
1160040885 18:75344712-75344734 CTGCAAACTCAGGCTGGGTGTGG - Intergenic
1160177499 18:76607801-76607823 ATCCTCACACAGGCTGGGCATGG + Intergenic
1160230974 18:77048752-77048774 CTACAGAGATTGGCTGGGCATGG - Intronic
1160282361 18:77503391-77503413 ATACACACATAGGCTGGGCACGG + Intergenic
1160327765 18:77966664-77966686 ATGCAGACACTGGATGGGCATGG - Intergenic
1160427586 18:78788511-78788533 CTGGAGACACTGGCTGGGGGAGG + Intergenic
1160586113 18:79914573-79914595 CTCCAGACGCAGCTTGGGCAAGG - Intronic
1160670890 19:362475-362497 CTCCACATTCAGGCTGGGCATGG + Intronic
1160721456 19:598896-598918 GGGCTGACTCAGGCTGGGCACGG - Intronic
1160835514 19:1122853-1122875 TCGCGGACACAGGCTGGGCTGGG + Intronic
1160850494 19:1189291-1189313 AAGCAGCCACTGGCTGGGCACGG - Intronic
1160890973 19:1378581-1378603 CAGCAGCCAGAGGCTGGGCGCGG + Intergenic
1160999644 19:1903975-1903997 TTCCAGGAACAGGCTGGGCACGG + Intergenic
1161055188 19:2187420-2187442 CATCAGGGACAGGCTGGGCAGGG + Intronic
1161123926 19:2545355-2545377 GTGCACACATAGGCCGGGCACGG + Intronic
1161215862 19:3094821-3094843 GGGCAGGCACAGGCAGGGCAGGG - Intronic
1161411573 19:4121064-4121086 CTGCAGGCCGAGGCAGGGCAGGG - Intronic
1161561567 19:4975881-4975903 ATTCACACTCAGGCTGGGCACGG - Intronic
1161782318 19:6301417-6301439 CTCCAAGCACAGGCTGGGCTTGG - Intergenic
1161977675 19:7615442-7615464 CTGCGGACACAAGCGGGGCTGGG - Exonic
1161999605 19:7734946-7734968 CTGGAGACACTGGCTGAGCCGGG + Intergenic
1162006502 19:7783801-7783823 CTGGAGACACTGGCTGAGCCTGG - Intergenic
1162103987 19:8358810-8358832 ATACACAAACAGGCTGGGCAGGG - Intronic
1162353938 19:10169118-10169140 ATGCAGCCTCAGGCTGGGCATGG - Intronic
1162402222 19:10453214-10453236 CTGCACACAGAGGCTGGGCTTGG - Intronic
1163167745 19:15509249-15509271 TTGCATACCCAGGCTGGGCCAGG - Intronic
1163297954 19:16424518-16424540 CTGCAGACACAGGCTGGGCACGG + Intronic
1163360284 19:16841685-16841707 GTGCAGACAGTGGCTGGGCCTGG + Intronic
1163377624 19:16943304-16943326 AGACAGACACAGGCCGGGCACGG - Intronic
1163582219 19:18145666-18145688 CAGCAGACCCAGCCTGGGCTGGG + Intronic
1163846469 19:19641055-19641077 CATCAAACACAGGCCGGGCACGG - Intronic
1164403386 19:27919175-27919197 CTGTAGTCACAGCCTGGTCATGG - Intergenic
1164578731 19:29421264-29421286 GTGCAGACACGGCCTGGGCAGGG + Intergenic
1164602287 19:29570441-29570463 AAGCAAAAACAGGCTGGGCATGG + Intergenic
1165070655 19:33253279-33253301 GTGCAGACACCTGCTGGGAACGG + Intergenic
1165176409 19:33933593-33933615 CAGCAAAAACTGGCTGGGCACGG - Intergenic
1165633061 19:37317898-37317920 CTGCAGACCCAGCCTGTGCCGGG - Intronic
1165892224 19:39120223-39120245 CTGGGCACTCAGGCTGGGCATGG - Intergenic
1165958658 19:39517147-39517169 GGAAAGACACAGGCTGGGCACGG - Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166214467 19:41326158-41326180 CCGCAGACACAGCCTGCGCTGGG + Intronic
1166856795 19:45786254-45786276 CTGCGGGCACAGGCTCGGCCGGG - Exonic
1166898033 19:46036288-46036310 CTGCAGCCACAACTTGGGCAGGG - Intergenic
1167039731 19:47016184-47016206 CCTCAGAAAGAGGCTGGGCACGG - Intergenic
1167048373 19:47064967-47064989 CTGCAGCCACATGGTGGGCCAGG + Exonic
1167604063 19:50470941-50470963 CAGTAGCCACAGGCTGGGCGCGG - Intronic
1167609911 19:50502033-50502055 CTGCAGAGGCTGGCGGGGCACGG - Intergenic
1167731138 19:51257114-51257136 TTGAAAACACTGGCTGGGCACGG + Intronic
1167738845 19:51312076-51312098 CTGCATTCCCTGGCTGGGCAGGG + Intronic
1167927348 19:52832303-52832325 CTGCAGAGACAGGCCGGGCACGG + Intronic
1168396021 19:56049469-56049491 CTAAAAATACAGGCTGGGCACGG - Intronic
1168413922 19:56157056-56157078 CCACAGGCAGAGGCTGGGCAGGG - Intronic
1168461300 19:56560812-56560834 TTTCAGTCACAGGCTGGGTATGG - Intergenic
1168685886 19:58349360-58349382 CTGCAAGAATAGGCTGGGCATGG + Intronic
925014569 2:512470-512492 CAGAAGAAACTGGCTGGGCATGG - Intergenic
925078103 2:1036814-1036836 CTCAAGACAAACGCTGGGCAAGG - Intronic
925296964 2:2783656-2783678 CAGCTGAGACAGGCAGGGCAGGG - Intergenic
925628156 2:5862680-5862702 CTCCATCCACAGGCTGAGCACGG + Intergenic
926052668 2:9754714-9754736 CTGGAGAGAGAGGGTGGGCAGGG + Intergenic
926110537 2:10180338-10180360 CTACACAGACAGGCTGGGCATGG + Intronic
926155919 2:10454032-10454054 CTGAAGACCCAGGTTGTGCAAGG - Intergenic
927076720 2:19586086-19586108 AGTCAGAAACAGGCTGGGCATGG + Intergenic
927151139 2:20196865-20196887 CTGGAAACACCGGCTGGGTAGGG + Intergenic
927151367 2:20198349-20198371 CTGCAGACTCTGCCTGGCCATGG - Intergenic
927179875 2:20437495-20437517 CTGCAAACACAGTCTGGGTCAGG - Intergenic
927537117 2:23872164-23872186 AAACAGAAACAGGCTGGGCATGG - Intronic
927638684 2:24833526-24833548 CTGCAGACACAGGGAAGGCAAGG - Intronic
927895919 2:26781818-26781840 CTGCAGCCAGAGGCCAGGCATGG + Intronic
927910985 2:26899596-26899618 GTGCAGGCAGAGGCTGGGCCTGG + Intronic
927954547 2:27199438-27199460 CTGCAGACACAGGGACAGCAGGG + Intergenic
928174547 2:29024775-29024797 CTGCAGAGGCAGCCTGAGCATGG + Intronic
929918236 2:46154073-46154095 CTGCATACCCAGGCCGGGCGTGG - Intronic
930388142 2:50723732-50723754 CTGCAGACACAACGTGGTCAGGG + Intronic
931309053 2:61061201-61061223 ATGCAGACTCTGGCTGGGCGTGG - Intergenic
931432277 2:62217605-62217627 ATGCTGACACAGGCTGGGGGTGG + Intronic
932571940 2:72942806-72942828 CTGAGGCCACAGGCTGGGCCAGG + Exonic
933551788 2:83786944-83786966 CTGCAGACAGAGGCCTGGGAAGG - Intergenic
933710758 2:85324130-85324152 ATGTAGACACAGGCCAGGCACGG + Intronic
933795024 2:85912724-85912746 CTCTAGATACTGGCTGGGCACGG + Intergenic
934123149 2:88859638-88859660 GGGCAGACACAGGGTGGCCACGG + Intergenic
935030035 2:99312870-99312892 CTGCCAACCAAGGCTGGGCACGG + Intronic
935239414 2:101165550-101165572 AAGAAGATACAGGCTGGGCACGG + Intronic
935720681 2:105976362-105976384 GTGCACACAGTGGCTGGGCACGG + Intergenic
936085907 2:109469065-109469087 CTGAGAACACAGGCTGTGCAGGG + Intronic
937085185 2:119166953-119166975 CTGAAGACACAGGTACGGCAGGG + Intergenic
937214682 2:120304267-120304289 CTGCACACACAAACTGTGCAAGG + Intergenic
937376323 2:121338335-121338357 CTGCAGCCAGGGTCTGGGCAGGG - Exonic
937420833 2:121753935-121753957 TTGCAGGCCCTGGCTGGGCATGG - Intronic
937451158 2:122003067-122003089 CTGCAGAGACTGGGTGGGAAGGG + Intergenic
937451196 2:122003208-122003230 CTGCAGAGACTGGGTGGGAAGGG + Intergenic
938131247 2:128717423-128717445 AGACAAACACAGGCTGGGCACGG + Intergenic
938367061 2:130743214-130743236 AAGCAGAACCAGGCTGGGCACGG - Intergenic
938501616 2:131833707-131833729 CTGTTTACAGAGGCTGGGCAGGG - Intergenic
939160631 2:138584424-138584446 CTGCATTCACAGGCTGGGCGCGG - Intergenic
942602862 2:177658966-177658988 GTGAAGGCAGAGGCTGGGCATGG + Intronic
944472288 2:200066797-200066819 CTGCAAACCCAGGCTGGGAAGGG - Intergenic
945058651 2:205889528-205889550 CTGGAGGCACAGGAAGGGCAGGG + Intergenic
945896293 2:215486102-215486124 ATACAGCCACAGGCTGGGCGCGG - Intergenic
946461193 2:219870315-219870337 CTGAAGACACAGGGTAGGAAGGG + Intergenic
947735967 2:232455762-232455784 CTGAGGACGCAGGCTGGGAAGGG - Intergenic
947817120 2:233045076-233045098 CTCCAGAGACAGGCTGAGCAGGG - Intergenic
948187133 2:236030303-236030325 TTACTGATACAGGCTGGGCATGG - Intronic
948426704 2:237892548-237892570 GAGAAAACACAGGCTGGGCACGG - Intronic
948428087 2:237901294-237901316 CTGCAGACACCACCGGGGCAGGG - Intronic
948433529 2:237936287-237936309 CAGCACACACAGCCTGGGCACGG + Intergenic
948707202 2:239802323-239802345 CTGCAGAAACCTGCTGGGGATGG + Exonic
948893315 2:240917256-240917278 CCGCAGACCCAGGCTCAGCATGG - Intergenic
948916035 2:241035537-241035559 CTGCGGCCCCAGGCTTGGCAGGG - Intronic
948995079 2:241573914-241573936 CAGGAGATACAGGCTGGACATGG + Exonic
949081272 2:242101818-242101840 ATAAAGAAACAGGCTGGGCACGG - Intergenic
1168749676 20:273583-273605 ATGCAGAATCAGGCTGGGCATGG + Intronic
1168811314 20:706469-706491 CTGCAGAGACAGGCAGTGCCAGG - Intergenic
1169001725 20:2172832-2172854 CTGAAGACCCTGCCTGGGCAGGG - Intronic
1170558491 20:17535238-17535260 CTGAGGGCTCAGGCTGGGCACGG + Intronic
1170570445 20:17629471-17629493 CTGCGGACCCAGGCTTGGGAGGG + Intronic
1170573276 20:17644579-17644601 CTGTAGTTACAGACTGGGCAGGG + Intronic
1171185300 20:23120435-23120457 CTGCTGCCACAGCCTAGGCAAGG - Intergenic
1171362789 20:24600903-24600925 ATGAAGACATGGGCTGGGCATGG - Intronic
1171367647 20:24637067-24637089 CTGCAGCCACGGGCAGGGCCCGG + Intronic
1171368841 20:24647264-24647286 ATGAACACACAGGCAGGGCAGGG + Intronic
1171400637 20:24871225-24871247 ATGCAGGGACAGGCTGAGCATGG + Intergenic
1172543137 20:35737570-35737592 ATAAAGACAGAGGCTGGGCACGG + Intronic
1172564326 20:35917052-35917074 CTGTAAACAAAGGCTGAGCATGG - Intronic
1172599402 20:36173534-36173556 CTGCAGACACAGGGTGGGAGGGG + Intronic
1172665887 20:36599610-36599632 CAGCAGAAAAAGGCTGAGCACGG + Intronic
1172873085 20:38147870-38147892 GTGGAGACACAGGCTAGGCGCGG - Intronic
1172892513 20:38277021-38277043 CTGCAAACACAGGCCGGGTGCGG + Intronic
1173203055 20:40968222-40968244 CTTCAGTCACAAGCTGGGCGAGG - Intergenic
1173450188 20:43157059-43157081 AAAAAGACACAGGCTGGGCACGG + Intronic
1173640744 20:44600242-44600264 CTGCAGAGGCAGGCAGGGCCAGG + Intronic
1173850242 20:46213228-46213250 CTGCTGGCAGAGGCTGGGGAAGG - Intronic
1174620849 20:51873508-51873530 CTAAAAATACAGGCTGGGCACGG - Intergenic
1175217103 20:57397095-57397117 CTGCAGAGACAGGCTGGGCCTGG - Intronic
1175267596 20:57711809-57711831 CTGCAAATACTGGCTGGGCCTGG + Intergenic
1175357897 20:58383399-58383421 CTGCAAAACCTGGCTGGGCATGG + Intergenic
1175366839 20:58461520-58461542 ATGAGGCCACAGGCTGGGCACGG + Exonic
1175515492 20:59567349-59567371 CTGCAGAAACACCCTGGGCTGGG + Intergenic
1175816983 20:61888310-61888332 CTGCAGAGATGGGCTGGGGACGG - Intronic
1176121239 20:63455512-63455534 ATGCAGTCACAGACTGAGCATGG + Intronic
1176186645 20:63783879-63783901 CTGCTGAAACAGGCTGTGAAAGG + Intronic
1176200814 20:63859517-63859539 CTGCAGCCAAGGGATGGGCAAGG - Intergenic
1176845894 21:13876139-13876161 CTGCACACAGAGGGGGGGCATGG + Intergenic
1176848627 21:13895682-13895704 CTGCACACAGAGGGGGGGCATGG + Intergenic
1177370567 21:20198095-20198117 GTGCAGAGAGAGGCTGGGCGCGG + Intergenic
1177723749 21:24940824-24940846 AAGCAAACACAGGCTGGACATGG - Intergenic
1178016393 21:28351233-28351255 CTGAAGAAACAGTGTGGGCACGG - Intergenic
1178397928 21:32259162-32259184 ATGCAGACCCTGGCTGGGCACGG - Intergenic
1178868985 21:36355657-36355679 CTGTTCAAACAGGCTGGGCATGG + Intronic
1178908281 21:36653960-36653982 CAGCAGGCCCAGGCTGGGGAGGG - Intergenic
1178933627 21:36841782-36841804 CTGCAGCCACAGGGTAGGCCTGG + Intronic
1179026934 21:37686755-37686777 CTTCACACAGAGGCTGGGCGCGG - Intronic
1179145447 21:38763997-38764019 ATGAACAGACAGGCTGGGCATGG - Intergenic
1179256898 21:39724769-39724791 CTGCAGCCACCAGCTGGGCAGGG + Intergenic
1179391631 21:40997614-40997636 AACAAGACACAGGCTGGGCATGG - Intergenic
1179484938 21:41704125-41704147 CTGCAGAGCCAGGCTGGGCGGGG - Intergenic
1179508885 21:41859184-41859206 GTGCACACCCAGGCGGGGCAGGG - Exonic
1179722218 21:43322317-43322339 CGGCCGGCACAGGCTGGGCTGGG - Intergenic
1179782020 21:43707471-43707493 ATGCAGTCACAGGCTGGGCGCGG + Intergenic
1179894211 21:44352241-44352263 CTGCAGGAAAAGGCCGGGCAGGG + Intronic
1180076760 21:45467093-45467115 TTGCAGCCACAGTCTGGGCCAGG - Intronic
1180085296 21:45505467-45505489 CTGCAGAACCAGCCAGGGCACGG - Intronic
1180199308 21:46215149-46215171 CTGCAGTCAGAGGCCGGGCAGGG + Intronic
1180588342 22:16914005-16914027 CAGCAGTCACAGCCTGGGGAAGG - Intergenic
1180720172 22:17902106-17902128 GTGGAGACAGAGGCTGTGCACGG + Intronic
1180800110 22:18627728-18627750 CTGCAAACACAGGCTGGGGCGGG - Intergenic
1180851343 22:19023293-19023315 CTGCAAACACAGGCTGGGGCGGG - Intergenic
1181044668 22:20208906-20208928 GAGCAGCCACAGGCTGGCCAGGG + Intergenic
1181116053 22:20633100-20633122 CTGGAGAAACAGGCCAGGCAAGG + Intergenic
1181221605 22:21367538-21367560 CTGCAAACACAGGCTGGGGCGGG + Intergenic
1181492493 22:23269245-23269267 AGGCAGACACAGGCTGGAGAAGG - Intronic
1181922219 22:26329175-26329197 CTAAGGAAACAGGCTGGGCACGG + Intronic
1182201127 22:28571655-28571677 ATGTATACTCAGGCTGGGCACGG + Intronic
1182225253 22:28792845-28792867 CTTCAGAAACAGGCCAGGCATGG - Intergenic
1182408654 22:30162020-30162042 ATACACACACAGGGTGGGCATGG + Intronic
1182435913 22:30329735-30329757 CTGCAGCCACAGGCTGTGATGGG - Intergenic
1182458643 22:30469025-30469047 AAACAGACACTGGCTGGGCATGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182517542 22:30867545-30867567 CTGCAGAGACAGGCAGGGAGAGG - Intronic
1182577226 22:31281135-31281157 CTGGACACACAAGCCGGGCACGG + Intergenic
1182677097 22:32047868-32047890 ATGCAGACATCGGCCGGGCATGG + Intronic
1182857478 22:33530713-33530735 CTGGAGACTCAGGCTCTGCAGGG - Intronic
1183291586 22:37004976-37004998 CCGAAGTCACAGGCCGGGCACGG - Intronic
1183384461 22:37506986-37507008 ATGCAGACTTCGGCTGGGCATGG + Intronic
1183554285 22:38513129-38513151 CTGCAGAAACAGCCTGGGCATGG + Intergenic
1183618697 22:38960224-38960246 CTCCAGACAGAGGCTGTGCTGGG - Intronic
1183623900 22:38990169-38990191 CTCCAGACAGAGGCTGTGCTGGG - Intronic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1184380054 22:44139744-44139766 CTCAAAACACAGGCTGGGCCGGG - Intronic
1184388341 22:44188810-44188832 CTGCAGGCACAGGCTGATCAAGG + Intronic
1184497633 22:44851532-44851554 ATGAAGACCCAGGCTGGGCATGG + Intronic
1184625934 22:45730051-45730073 ATGCCAACATAGGCTGGGCACGG + Intronic
1184629125 22:45762480-45762502 GTGCAGACACAGGTTCGGCTAGG - Intronic
1184671520 22:46014281-46014303 CTCGAGACACAGGGTGGGCGGGG - Intergenic
1184715608 22:46280171-46280193 CTGCAGCCCCAGGCTGGTGAGGG + Intronic
1184933797 22:47703519-47703541 ATGGAGACTCAGGCTGTGCATGG - Intergenic
1184998582 22:48227869-48227891 CTGCAGGCTGAGGCTGGGCTTGG + Intergenic
1185107495 22:48882696-48882718 CTGCAGACCCAGCCTGGGGGAGG + Intergenic
949089724 3:12747-12769 TTAAAGACACTGGCTGGGCATGG + Intergenic
949930890 3:9077639-9077661 TTGGAGACACAGGCCAGGCAGGG - Intronic
949977640 3:9475665-9475687 CTGTGGACACAGGGTGGGCGGGG - Exonic
950065848 3:10111097-10111119 GTGAAGACAGGGGCTGGGCACGG + Intergenic
950428049 3:12935219-12935241 CAACACACACAGGCTGAGCAGGG - Intronic
950449397 3:13057227-13057249 CTGAAGACACAGCCAGGGGATGG + Intronic
950764136 3:15260748-15260770 CTGGAGAGGCAGGGTGGGCATGG + Intronic
950790254 3:15465894-15465916 CTAGAGAAAGAGGCTGGGCATGG - Intronic
950873525 3:16249660-16249682 GTGCAGGGACAGGCTGGGGAGGG + Intergenic
951673495 3:25210823-25210845 AATCAGACAAAGGCTGGGCATGG - Intronic
952361803 3:32637612-32637634 CAGCATATACTGGCTGGGCATGG - Intergenic
953198437 3:40755301-40755323 CTGCAGTCAGAGGCAGGACAGGG - Intergenic
953325444 3:42008787-42008809 CAACAGACACAGGCTGGGCATGG + Intergenic
953641521 3:44712481-44712503 CTGGAGTTACAGGCTGGGCTTGG + Intergenic
953651319 3:44807512-44807534 TTTCAGTCACAGGCTGGGCGCGG - Intronic
954408846 3:50360488-50360510 CTGTACATATAGGCTGGGCACGG + Intronic
954607385 3:51923434-51923456 CTACATAAGCAGGCTGGGCACGG + Intergenic
954964698 3:54599992-54600014 CTGCTGGCACAGCCTGTGCACGG + Intronic
955403923 3:58613485-58613507 CAGCAGGCAGGGGCTGGGCAGGG - Intronic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
956342536 3:68242041-68242063 CTGCAGACTTAGGCAGGGCAAGG - Intronic
956777112 3:72574455-72574477 ATAAAGACTCAGGCTGGGCATGG + Intergenic
957029401 3:75222475-75222497 TTAAAGACACTGGCTGGGCATGG + Intergenic
957629512 3:82701187-82701209 ATGCATTAACAGGCTGGGCACGG - Intergenic
958464622 3:94442721-94442743 CTGGGGACACAGTCTGGCCATGG + Intergenic
958634774 3:96729818-96729840 CTGCTGCCATAGGGTGGGCACGG + Intergenic
958806828 3:98821755-98821777 ATGCAGACACTGGCTGGGCACGG + Intronic
958912611 3:100011351-100011373 CTCAAGAAACACGCTGGGCATGG - Intronic
960181272 3:114582668-114582690 TTTAAAACACAGGCTGGGCATGG - Intronic
960206473 3:114906695-114906717 TTGCAGACGCTGGCTGGCCAAGG - Intronic
960335649 3:116414397-116414419 TGGAAGACACCGGCTGGGCAGGG - Intronic
960500431 3:118431177-118431199 GTACACAAACAGGCTGGGCACGG - Intergenic
960503589 3:118466695-118466717 AAGCGGACAGAGGCTGGGCATGG - Intergenic
960667965 3:120129480-120129502 CTCCAAACTCAGGCTAGGCAAGG - Intergenic
960959893 3:123062994-123063016 ATCAAGATACAGGCTGGGCATGG + Intergenic
961166176 3:124765424-124765446 CTCCACACACAGCCTGGGCGGGG - Intronic
961313219 3:126016919-126016941 CAGCACACACAGGCTGGGCCTGG + Intronic
961392034 3:126557959-126557981 CTGCAGCCACAGCCTGGGCCAGG + Intronic
961468576 3:127097012-127097034 CTGCAGCCACCGGCTGGTCAGGG - Intergenic
961780746 3:129318878-129318900 CTGCAGCCACAGGCTGGGCCAGG + Intergenic
961782056 3:129326173-129326195 TTGCAGACACAGCCTGGGCCAGG - Intergenic
961810329 3:129518387-129518409 CTGCAGACTCAGTCAGTGCAAGG - Intronic
962535319 3:136324234-136324256 GTTAAGAAACAGGCTGGGCATGG - Intronic
962979720 3:140476947-140476969 ATGCTAAAACAGGCTGGGCACGG - Intronic
963049263 3:141127714-141127736 ATGGAGACACAGGCTGGAGAAGG + Intronic
963103019 3:141623621-141623643 CAGCAGCCACAGGCGGGCCAAGG - Intergenic
963114827 3:141718542-141718564 AAGCAGCCAGAGGCTGGGCATGG - Intergenic
963163779 3:142180199-142180221 CTGCAGCCACAGGATTGCCAGGG - Intronic
963316736 3:143766862-143766884 TTGCAGTCTAAGGCTGGGCATGG - Intronic
963884864 3:150570770-150570792 CTGCTGACAGAGGCTGGGCACGG + Intronic
964128020 3:153257015-153257037 GTGCAGAAACAGGCTGGGTGCGG + Intergenic
964502895 3:157368230-157368252 CTGGAGACACAGGCACGGAAAGG - Intronic
965582987 3:170289402-170289424 CTCCAGAGACATTCTGGGCATGG - Intronic
965769102 3:172162132-172162154 ATACAGAAACTGGCTGGGCATGG - Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
966473866 3:180322450-180322472 AAGCAGGCAGAGGCTGGGCACGG - Intergenic
966524997 3:180911086-180911108 GTGAATACATAGGCTGGGCACGG + Intronic
967029557 3:185592905-185592927 ATGGAGACCCAGGCCGGGCACGG - Intronic
967904782 3:194490853-194490875 CTGTAAACTGAGGCTGGGCATGG + Intronic
967952711 3:194853251-194853273 ATGCAGCCACAGGCTGTGGAAGG + Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968361150 3:198147860-198147882 CTGGAGACAGACACTGGGCAGGG - Intergenic
968864020 4:3196178-3196200 AGGCAGACACCTGCTGGGCATGG - Intronic
969092605 4:4706505-4706527 CTGTAGCCAAAGCCTGGGCAGGG + Intergenic
969594989 4:8143796-8143818 CAGCATCCACAGGCTTGGCAGGG - Intronic
969859783 4:10026751-10026773 ACCCAGACACAGGCCGGGCATGG + Intronic
970304523 4:14717988-14718010 ATGCAGAAACAGGCTGGGCACGG - Intergenic
970314829 4:14819255-14819277 CAGCAGAAATGGGCTGGGCATGG - Intergenic
971314209 4:25553662-25553684 AAGCAGGCACTGGCTGGGCAGGG + Intergenic
971915606 4:32866625-32866647 ACTCACACACAGGCTGGGCAAGG + Intergenic
971993074 4:33927217-33927239 CTACAGTCATAGGATGGGCAAGG + Intergenic
972157487 4:36182200-36182222 ATGCAGAAACTGGCCGGGCATGG + Intronic
972343316 4:38171835-38171857 CTGCAGACAAAGGGATGGCAAGG + Intergenic
972619413 4:40732649-40732671 CTTCAGATACAGGCTGGGCACGG - Intergenic
972964354 4:44491153-44491175 CAGCAAATACAGGCTGGGCATGG + Intergenic
973670403 4:53211317-53211339 ATGCACACCCAGGGTGGGCATGG + Intronic
973808486 4:54547969-54547991 CGCCAGATACAGGCAGGGCAGGG + Intergenic
973809565 4:54557031-54557053 ATGTAGACCCTGGCTGGGCATGG + Intergenic
974034619 4:56807033-56807055 AAGAAGAAACAGGCTGGGCACGG + Intergenic
974431269 4:61799507-61799529 CTCCAGACAAAAGCTGGCCATGG - Intronic
975553553 4:75637608-75637630 ACGGTGACACAGGCTGGGCATGG - Intergenic
975592085 4:76010889-76010911 CTGCGGACACGGGCTCAGCAAGG - Intergenic
976510143 4:85899032-85899054 ATGTATACACAGGCTGGGCATGG - Intronic
977915077 4:102583131-102583153 CTGAAGAAACTAGCTGGGCATGG - Intronic
979300891 4:119085905-119085927 ATACAAACACTGGCTGGGCATGG + Intergenic
980108878 4:128615400-128615422 CTGCCAACAGTGGCTGGGCAGGG - Intergenic
980928873 4:139166045-139166067 CTCTAAAAACAGGCTGGGCATGG + Intronic
981166476 4:141565075-141565097 ACACAGACACAGGCTGGGCACGG + Intergenic
981528497 4:145731255-145731277 CTGCAGACACTGACTGGCAATGG - Intronic
981956037 4:150475604-150475626 CTGTAGGCTCAGGCTGGGCTTGG + Intronic
982116856 4:152105204-152105226 CTGCAGAGCCAGGCTGGGGCCGG + Intergenic
982487816 4:155989137-155989159 CTGGAAAAATAGGCTGGGCATGG - Intergenic
983333728 4:166365628-166365650 CTGCAGACACTGGGAAGGCATGG - Intergenic
984040997 4:174733667-174733689 CTGCAAAGGCAGGCAGGGCAAGG - Intronic
984522661 4:180819915-180819937 AAGAAGACACAGGCCGGGCATGG - Intergenic
984759335 4:183350382-183350404 TGGCAGCCACAGGCTGGGCGCGG - Intergenic
984883347 4:184429264-184429286 CTGGAGACACAGGATGGTCCAGG + Intronic
984976580 4:185235837-185235859 CTGCAGACCCTGGCTGAGCAAGG + Intronic
985205230 4:187528633-187528655 ATGCATGGACAGGCTGGGCATGG - Intergenic
989063166 5:37430848-37430870 ATACATACACATGCTGGGCACGG - Intronic
989507892 5:42248470-42248492 CTATAGAGATAGGCTGGGCATGG + Intergenic
990220850 5:53586811-53586833 AGGAAGAAACAGGCTGGGCACGG - Intronic
990446324 5:55897138-55897160 ATAAAGAAACAGGCTGGGCATGG - Intronic
991082789 5:62619561-62619583 CTGCACAAACAGGCCGGGCGTGG + Intronic
991267982 5:64745298-64745320 CTGATGATACAGGCTGGGCATGG + Intronic
992101244 5:73409852-73409874 ATACAGATTCAGGCTGGGCACGG + Intergenic
992577167 5:78126212-78126234 TTGCACAAATAGGCTGGGCACGG + Intronic
993595119 5:89844677-89844699 CTGCTGACACTGGCAGGGCTGGG - Intergenic
995320007 5:110823788-110823810 CTGCAGGCCAAGGCAGGGCAAGG + Intergenic
995476136 5:112550151-112550173 CTCCAGCCAAGGGCTGGGCATGG + Intergenic
995914524 5:117228506-117228528 ATGCAGATGCAGGCTGGGCACGG + Intergenic
996557063 5:124788892-124788914 TTGGTGACACAGGCTGGGCGTGG - Intergenic
996779778 5:127172604-127172626 CTGAAGACAGAAGCTGTGCATGG - Intergenic
997690638 5:135825567-135825589 TTGCAGGCACAGGCTGGTCCCGG + Intergenic
997808000 5:136938811-136938833 CTGCAGACTCGTGCTGGGCTTGG - Intergenic
999079731 5:148831728-148831750 CTGCAGTCACATGCTTGGAAGGG - Intergenic
999222626 5:149993687-149993709 TTTAAGACATAGGCTGGGCATGG - Exonic
999272711 5:150306851-150306873 CTGCAGACACAGGCTCAGTGAGG + Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999751042 5:154628402-154628424 CTTCAGACTCAGGCTGGGACTGG + Intergenic
1000318452 5:160115399-160115421 ATACAAAAACAGGCTGGGCACGG + Intronic
1000814595 5:165905304-165905326 CTGCAGACACAGTTTTGCCATGG - Intergenic
1001547332 5:172578831-172578853 GTGCAGACACAGGCAGGGCCTGG + Intergenic
1001592232 5:172873441-172873463 CTGGAGGCCCTGGCTGGGCAAGG - Intronic
1002639600 5:180624516-180624538 CTCCAGAAACAGGCCGGGCTCGG - Intronic
1002788227 6:419788-419810 CTGCAGACAGATGCTGGATATGG - Intergenic
1002896804 6:1384268-1384290 CCGCGCACACACGCTGGGCAGGG - Intergenic
1003629204 6:7771658-7771680 CTGAAGACTTAGGCAGGGCATGG + Intronic
1003642549 6:7887890-7887912 CTGGACAGATAGGCTGGGCAGGG - Intronic
1003852225 6:10236970-10236992 CAGGAGACAAAGGCTGGGGAAGG - Intergenic
1004324800 6:14665036-14665058 CTGGAGAAACAGGCTGGAAAGGG - Intergenic
1004647856 6:17580425-17580447 ATACACATACAGGCTGGGCACGG - Intergenic
1005937997 6:30538925-30538947 TTGGAGACATCGGCTGGGCATGG - Intergenic
1006610201 6:35290074-35290096 CAGAAGAAACAGGGTGGGCATGG - Intronic
1006730890 6:36235527-36235549 CTGCAGACTCAGGGTAGTCAAGG - Intergenic
1006857794 6:37147701-37147723 AGGCACACACAGGCTGGGCACGG + Intergenic
1007078593 6:39083381-39083403 CTGCAGACCCAGGGTTGCCATGG + Intronic
1007239110 6:40412402-40412424 GTGCAGCCCCAGGCTAGGCAGGG - Intronic
1007549195 6:42716086-42716108 CCTCTGACACAGACTGGGCATGG - Intronic
1007828360 6:44618761-44618783 CTGGAGACACCTTCTGGGCAGGG + Intergenic
1008084398 6:47229040-47229062 ATGCAGCCTCAGGCTGGGCATGG + Intergenic
1010221067 6:73449698-73449720 CTCAAGACACAGTCTGGGCTGGG + Intronic
1011637800 6:89390605-89390627 CCTCAAACATAGGCTGGGCATGG + Intronic
1012059329 6:94458071-94458093 TTACAGGCACAGGCCGGGCATGG - Intergenic
1012480438 6:99661215-99661237 ATAAAAACACAGGCTGGGCACGG - Intergenic
1013013339 6:106139522-106139544 ATGCATATATAGGCTGGGCACGG - Intergenic
1013098472 6:106967566-106967588 ATGCAAACAAGGGCTGGGCATGG + Intergenic
1013148832 6:107424605-107424627 CTGAAGATACAGGCTGTGTAAGG + Intronic
1013996183 6:116310920-116310942 CTGGACACACAGGCAAGGCAGGG - Intronic
1013999460 6:116348135-116348157 GTCAAGAAACAGGCTGGGCACGG + Intronic
1014030850 6:116702390-116702412 GTGCATACTGAGGCTGGGCATGG + Intronic
1015739075 6:136434014-136434036 CTACACAAACTGGCTGGGCACGG + Intronic
1017018284 6:150118711-150118733 CTGCGGGCACAGCCTGGGGAAGG + Intergenic
1017985646 6:159441147-159441169 CTGCAGCCAGAGACTGGGAATGG - Intergenic
1018169446 6:161132865-161132887 CTACAGACACAGGCGGGTTAGGG + Exonic
1018302056 6:162413889-162413911 TTGCAGATACAGGCTGGGCGCGG + Intronic
1018707550 6:166474092-166474114 CTGCAGACAGGCCCTGGGCATGG + Intronic
1018740539 6:166725473-166725495 CTGGAGAAAGAGGCTGGGCTGGG - Intronic
1018844516 6:167546622-167546644 CTGCTGACCCTGGCTGGACATGG + Intergenic
1018962016 6:168456008-168456030 CTGCAGTCAGAGGCTGGGCTGGG - Intronic
1019190790 6:170249445-170249467 CGGGAGCCACAGGCTGGGCTGGG + Intergenic
1019254537 7:40861-40883 CTGGAGACAGACACTGGGCAGGG + Intergenic
1019549147 7:1593639-1593661 GTGCTCACAGAGGCTGGGCAGGG + Intergenic
1019558451 7:1644138-1644160 CTGTCCACACAGGCTGGGCATGG + Intergenic
1019709003 7:2509894-2509916 CTGGAGACACAGCCAGGACAGGG + Intergenic
1019862452 7:3672245-3672267 CTACAGAAACAGGATGGGTATGG - Intronic
1020412068 7:7903426-7903448 ATGAAAATACAGGCTGGGCATGG + Intronic
1021839324 7:24709708-24709730 CTGCAGGCACATCCTGGGCATGG + Intronic
1022041799 7:26588319-26588341 CTGCACACACAGGCGGGGATGGG + Intergenic
1022052080 7:26685957-26685979 GTGGAGACACAGGCTGGACCAGG + Intronic
1022089501 7:27098240-27098262 CTGCAAACCCAGGCTGAGGAGGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023790731 7:43751265-43751287 ATTCATACACAGGCCGGGCACGG + Intergenic
1024201740 7:47115378-47115400 CTGCACACACAGGAAGTGCATGG + Intergenic
1024643744 7:51354298-51354320 CAGCAAAAATAGGCTGGGCACGG - Intergenic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1025946487 7:66108703-66108725 TTGCAGACATGGGCTGGGCATGG + Intronic
1026045393 7:66902965-66902987 CTGCAGGCAGGGGCTGGGCCTGG - Intergenic
1026580546 7:71612808-71612830 ATGCAGACATAAACTGGGCAGGG + Intronic
1026907984 7:74073994-74074016 AGGCAGAGACAGGCTGGGCGCGG - Intergenic
1027016824 7:74784706-74784728 CGATAGCCACAGGCTGGGCAAGG - Intronic
1027071203 7:75161230-75161252 CGATAGCCACAGGCTGGGCAAGG + Intergenic
1027140734 7:75655286-75655308 AGCCAGACACAGGCCGGGCACGG + Intronic
1027202406 7:76072239-76072261 CTGCAGGCTGGGGCTGGGCATGG + Intergenic
1028522144 7:91743091-91743113 CTTCAGCCACAGGATGGGAAAGG + Intronic
1029019667 7:97351232-97351254 ATACACATACAGGCTGGGCATGG + Intergenic
1029349105 7:100000475-100000497 CTACAGATACTGGCCGGGCATGG - Intergenic
1029447083 7:100619756-100619778 AAGCAGAAACAAGCTGGGCACGG - Intergenic
1029561592 7:101306541-101306563 CTAAAGAGGCAGGCTGGGCACGG + Intergenic
1029692740 7:102193048-102193070 CTGCAGCCCCAGGTTGGGGAAGG - Intronic
1029856122 7:103518624-103518646 CAGGAAACACATGCTGGGCATGG - Intronic
1030136558 7:106257324-106257346 ATGCACATACAGGCTGGGAATGG + Intronic
1032399183 7:131611764-131611786 CTGCAGGGGCAGGCCGGGCATGG - Intergenic
1032617459 7:133490032-133490054 CTTCACACACAGGCTGGGCTGGG - Intronic
1032767759 7:135015722-135015744 CAGCATACACAGGCCGGGCATGG + Intronic
1032889853 7:136182564-136182586 CTGCAGACAAAGGCTAGGGAAGG - Intergenic
1033155313 7:138951495-138951517 CTGCTTACACAGGCTGGCCCTGG + Intronic
1033194477 7:139315784-139315806 ATGGAGGCTCAGGCTGGGCATGG + Intergenic
1033775761 7:144608947-144608969 CTACAAACACTAGCTGGGCATGG + Intronic
1034077631 7:148247942-148247964 CTGAAGAAAGAGGCTGAGCATGG - Intronic
1034283290 7:149868242-149868264 CTCCACTCTCAGGCTGGGCAGGG + Intergenic
1034695548 7:153050044-153050066 CTGAAGAAACAGGCCAGGCACGG + Intergenic
1034878830 7:154748631-154748653 CTCCAGAGGCAGGCTGTGCAGGG - Intronic
1034914725 7:155027428-155027450 TGGCAGACACTGGCTGGGCGTGG - Intergenic
1035057327 7:156044214-156044236 CTGCAGGTTTAGGCTGGGCATGG + Intergenic
1035201452 7:157269895-157269917 CTGCAGGCTCACGATGGGCAGGG - Intergenic
1035214431 7:157354627-157354649 GTGCAGATATTGGCTGGGCACGG - Intronic
1035377629 7:158415920-158415942 CAGCAGACACAGGGGTGGCAGGG - Intronic
1035496159 7:159328701-159328723 AACCATACACAGGCTGGGCACGG + Intergenic
1035739492 8:1915477-1915499 CCCCAGACAGAGGCTGGGCCTGG - Intronic
1036776729 8:11617894-11617916 CAGCAGCCACAGGCAGGGCGGGG + Intergenic
1036782288 8:11658119-11658141 CTGCAGACCAGGGCTGGGGAGGG - Intergenic
1036980931 8:13469107-13469129 AAGCAGACACAGGCTGGGCGCGG - Intronic
1037298859 8:17430804-17430826 CGTCAGATCCAGGCTGGGCACGG + Intergenic
1037882960 8:22581756-22581778 GTGCAGTCACAGGCTGGGCAGGG + Intronic
1038197870 8:25384748-25384770 ATTAAGACATAGGCTGGGCACGG - Intronic
1039066644 8:33614337-33614359 CTGGAGACCTGGGCTGGGCATGG - Intergenic
1039269862 8:35868923-35868945 ATGCCAACACAGGCTGGGCATGG - Intergenic
1039415050 8:37386370-37386392 CTGCACACACCAGCAGGGCAAGG + Intergenic
1040034746 8:42859343-42859365 AAGTGGACACAGGCTGGGCACGG + Intronic
1040040397 8:42911075-42911097 CTGCACAGAGAGGGTGGGCATGG + Intronic
1040513086 8:48112677-48112699 CTGAAGTCACTGCCTGGGCAAGG - Intergenic
1040687285 8:49890218-49890240 AGGCAAAGACAGGCTGGGCATGG + Intergenic
1041190692 8:55351029-55351051 ATGGAAACACTGGCTGGGCATGG - Intronic
1041399624 8:57428322-57428344 CAGAAGCCTCAGGCTGGGCAAGG - Intergenic
1043557256 8:81445511-81445533 CTGCAGACATTGGCCGGGCGCGG - Intronic
1044636945 8:94334874-94334896 CTGTAAACTCTGGCTGGGCATGG - Intergenic
1044711024 8:95058143-95058165 CAGCAGACACTGTCTGGGCCAGG - Exonic
1045288344 8:100811152-100811174 GTGCAAAAAGAGGCTGGGCACGG - Intergenic
1045338761 8:101233230-101233252 CTGCAGACACTTGCCTGGCATGG - Intergenic
1046070583 8:109248137-109248159 TTGAAGACACAGGATGGGCCCGG + Intronic
1046938125 8:119905096-119905118 GTGCATTCACTGGCTGGGCATGG - Intronic
1047012799 8:120690770-120690792 CTCCAGGTACAGGCTGAGCAGGG - Intronic
1047029175 8:120857894-120857916 CTGCTGGTACAGGCTGGGCCTGG - Intergenic
1048318159 8:133377201-133377223 CTGCAAAGTCAGGCTGTGCAAGG + Intergenic
1048566236 8:135600757-135600779 CTGCAGACCAAGGCTGTGCAGGG - Intronic
1048609425 8:136005734-136005756 ATGCAAACATAGTCTGGGCACGG - Intergenic
1048930280 8:139309545-139309567 GTGCAGAAACAGGCTGGGTGTGG - Intergenic
1049304587 8:141894257-141894279 AGACAGGCACAGGCTGGGCATGG + Intergenic
1049392576 8:142379791-142379813 CTGCTGACATAGGCCTGGCAGGG + Intronic
1049423416 8:142526710-142526732 CTGCAGTCTCAGATTGGGCATGG - Intronic
1049556313 8:143283848-143283870 CTGCCGACTCGGGCTGGGCTTGG + Intergenic
1049648207 8:143746671-143746693 CTCCAAACAAAGCCTGGGCATGG - Intergenic
1049718295 8:144103957-144103979 CTCCGGACACCGGCTGGGCGAGG + Exonic
1049788403 8:144462237-144462259 CTGCAGCCCCGGGCTGGGCCGGG + Intronic
1049799405 8:144510800-144510822 CTGCAGACATAGGCTCAGCAAGG - Exonic
1050298222 9:4228560-4228582 CTGCAAATACAGCCAGGGCAAGG + Intronic
1050445362 9:5716315-5716337 TTTCAGAACCAGGCTGGGCACGG + Intronic
1050815192 9:9802135-9802157 GTGCAGACACAGTCTGGTCCAGG + Intronic
1051640569 9:19221077-19221099 AAGCAGAACCAGGCTGGGCATGG + Intergenic
1052988400 9:34504146-34504168 CCCCAGACAGAGGCTGGGCTGGG - Intronic
1053095482 9:35323812-35323834 CTGTAGAAACAGGTTAGGCAAGG - Intronic
1053545779 9:39021401-39021423 CTGGGGAGACGGGCTGGGCACGG - Intergenic
1054760635 9:69001195-69001217 CTGCACACCCAGGCTGGGTGTGG - Intronic
1054855911 9:69899507-69899529 CTGCACACACAGGATGGGAGAGG - Intronic
1055494189 9:76838352-76838374 ATGCAGGCAGAGGCTGGGCATGG + Intronic
1057243155 9:93430654-93430676 CTGGAGTCAGAGGCTGGGCTGGG - Intergenic
1057424081 9:94934824-94934846 CTGAAGACACAGGCAGGCAAAGG - Intronic
1057536925 9:95919149-95919171 ATGTAGACACAGGCCGGGCGTGG - Intronic
1057998262 9:99840247-99840269 GTACACACACAGGGTGGGCAGGG + Intronic
1058422734 9:104848322-104848344 ATGCAGATTCAGGCTGGGCATGG + Intronic
1058692397 9:107530661-107530683 TTGTCGACCCAGGCTGGGCACGG - Intergenic
1059254035 9:112912687-112912709 CTCTGGACACCGGCTGGGCATGG - Intergenic
1059352563 9:113676048-113676070 GTGGAGAAATAGGCTGGGCATGG + Intergenic
1059451051 9:114371739-114371761 CTGGACACCCAGGCTAGGCATGG - Intronic
1059889999 9:118790957-118790979 CATCAGACACATGCTAGGCATGG - Intergenic
1060354716 9:122894587-122894609 ATGAAGAGAGAGGCTGGGCACGG + Intronic
1060396517 9:123320384-123320406 CTTCAGGCTCAGGCCGGGCATGG + Intergenic
1060408534 9:123384655-123384677 TTGCAGTCATTGGCTGGGCACGG + Intronic
1060693053 9:125681880-125681902 CTGCAGTCCCAGGCTGGGGTGGG - Intronic
1060724559 9:125998356-125998378 CTTCAGATTGAGGCTGGGCAAGG + Intergenic
1060931513 9:127492188-127492210 CTGATGGCACAGGCTGGGCCTGG - Intronic
1060962587 9:127691546-127691568 CTGTGGACACAGGCTGGGGAGGG - Exonic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1061147096 9:128806383-128806405 CTGCTGCGACAGGCTGGGCAGGG + Intronic
1061637552 9:131922902-131922924 CAAAGGACACAGGCTGGGCACGG - Intronic
1061846329 9:133390550-133390572 CTGCAGAACCAGGTGGGGCAGGG + Intronic
1062004203 9:134231139-134231161 CTGCAGACACAGGCGGACCTGGG + Intergenic
1062175225 9:135158315-135158337 CTGCAGCCTGAGGCTGGGAAGGG - Intergenic
1062182025 9:135196012-135196034 CTGCAGACCCACGATGGACATGG - Intergenic
1062215306 9:135385903-135385925 CCTCAGACGCAGGGTGGGCACGG - Intergenic
1062241672 9:135544201-135544223 CTGCAGACACCGTCAGGGGATGG - Intergenic
1062252603 9:135605759-135605781 CTGATGGCATAGGCTGGGCATGG + Intergenic
1062275538 9:135728643-135728665 CCGCAGCCACGGGCTGGGAAGGG + Intronic
1062399781 9:136367305-136367327 CCCCAGGCACAGGGTGGGCAGGG + Intronic
1062460647 9:136661303-136661325 CTGGAGGGACAGGCTGGCCAGGG + Intronic
1062498056 9:136840842-136840864 CTGTTTACAGAGGCTGGGCAGGG + Exonic
1062566273 9:137165339-137165361 CGGGAGACACACGCAGGGCAGGG - Intronic
1062697094 9:137880995-137881017 CTTCAGCCATGGGCTGGGCAGGG + Intronic
1062745862 9:138211692-138211714 CTGGAGACAGACACTGGGCAGGG - Intergenic
1185487947 X:497511-497533 CGGCGGACACAGGGTGGGCTCGG + Intergenic
1185504707 X:623893-623915 CTGGAGACGCAGGCGGGGCTGGG - Intergenic
1185598198 X:1321177-1321199 GTGCAGACAGAGGCCGGGCACGG + Intergenic
1185642748 X:1597574-1597596 CTGCAGACACAGCCCAGGCCTGG + Intronic
1185765008 X:2718219-2718241 CTAAAGACACAGGCCGTGCATGG - Intronic
1185789692 X:2919409-2919431 CTAAACACACAGGCTGGGTAAGG + Intronic
1185867401 X:3636255-3636277 GTGCAGACACAGGCTGCGAAGGG + Intronic
1186537822 X:10368139-10368161 ATGCAGTCTCAGGCTGGGCGCGG + Intergenic
1187818393 X:23258078-23258100 CTACGGAGACAGGCCGGGCATGG + Intergenic
1187855023 X:23628567-23628589 ATGCAGAAACTGGCTGGGCGCGG + Intergenic
1188029209 X:25245716-25245738 ATGAAGAGAGAGGCTGGGCATGG - Intergenic
1188261513 X:28030419-28030441 CTCCAGACAGAGGATGGGCTGGG + Intergenic
1188470945 X:30538644-30538666 ATAAAGACACAGGCCGGGCATGG + Intergenic
1189133641 X:38526753-38526775 GTTCAAAAACAGGCTGGGCATGG + Intronic
1189223789 X:39395822-39395844 CTGCAGACACTGGCTGTTGAGGG + Intergenic
1189389056 X:40560630-40560652 GTGTATACATAGGCTGGGCATGG - Intergenic
1190267879 X:48839069-48839091 CTACAGATACAGGCCTGGCATGG - Intergenic
1190307761 X:49095348-49095370 CAGAAAATACAGGCTGGGCACGG + Intronic
1190325866 X:49206589-49206611 CTGCAGACACTGGATGGTGAAGG + Exonic
1191255237 X:58276813-58276835 CAACCCACACAGGCTGGGCATGG + Intergenic
1192434333 X:71133622-71133644 TTCAAGACTCAGGCTGGGCACGG - Intronic
1192557748 X:72103827-72103849 CTTCTGCCACAGGCTGGCCAGGG - Intergenic
1193211481 X:78811364-78811386 CAGCACAAACAGCCTGGGCATGG - Intergenic
1193384455 X:80854285-80854307 ATGAAGAAAGAGGCTGGGCATGG - Intergenic
1193937242 X:87637656-87637678 AAGCAGTCACAGGCTAGGCATGG + Intronic
1195696432 X:107671049-107671071 ATGGAGACACAGGCATGGCAAGG + Intergenic
1195982333 X:110592831-110592853 CTACAGATACTGGCCGGGCAGGG + Intergenic
1196283749 X:113855673-113855695 ATACAGAACCAGGCTGGGCATGG + Intergenic
1196731717 X:118947582-118947604 ATGGAGAATCAGGCTGGGCATGG + Intergenic
1196933632 X:120707027-120707049 CTAAAGAAACAGGCCGGGCACGG + Intergenic
1198044970 X:132892526-132892548 ATGGCAACACAGGCTGGGCATGG + Intronic
1198187044 X:134263780-134263802 TTACCTACACAGGCTGGGCACGG + Intergenic
1198392246 X:136188291-136188313 CTACTGGCACAGCCTGGGCAAGG - Intronic
1199840044 X:151636692-151636714 ATGAAAATACAGGCTGGGCACGG - Intronic
1199942163 X:152637698-152637720 CTCCAGACACAGGCAGGGCGGGG - Intergenic
1200796588 Y:7346437-7346459 GTGCAGACACGGGCTGCGAAGGG - Intergenic
1200988271 Y:9326005-9326027 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1201679295 Y:16624444-16624466 CTTTAGAAACTGGCTGGGCATGG - Intergenic
1202119750 Y:21510188-21510210 CTGCAGGCACAGCCTGGCCCTGG - Intergenic
1202122203 Y:21533729-21533751 CTGCAGGCACAGCCTGGCCCTGG - Intronic
1202156804 Y:21895654-21895676 CTGCAGGCACAGCCTGGCCCTGG + Intronic
1202159250 Y:21919195-21919217 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1202185699 Y:22184110-22184132 CTGCAGGCACAGCCTGGCCCTGG + Intergenic
1202205661 Y:22402286-22402308 CTGCAGGCACAGCCTGGCCCTGG - Intronic