ID: 1163299567

View in Genome Browser
Species Human (GRCh38)
Location 19:16435361-16435383
Sequence CTGCTGTTCTGAAAGACATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163299567 Original CRISPR CTGCTGTTCTGAAAGACATA GGG Intronic
901312256 1:8278422-8278444 TTGCTGTTTTAAAAGAGATAGGG - Intergenic
902359251 1:15933211-15933233 CTCTTGTTCGGAAAGACAAAGGG + Exonic
903367846 1:22815926-22815948 CTGCTGTTCTGAGAGGCAGAAGG + Intronic
905946048 1:41902207-41902229 TTTCTGGTCTGAAAGACATCCGG + Intronic
907715805 1:56924849-56924871 CTGCTGTTGTGGGAGACATGAGG + Intergenic
908660801 1:66432801-66432823 CTGCTGTTAAGAAAGACCAATGG - Intergenic
908778276 1:67663510-67663532 CTGCTGCTCAGAAAGATATCCGG - Intergenic
909208587 1:72792679-72792701 CTGCAGTTCAGAAAGTCAAAGGG - Intergenic
910926059 1:92399299-92399321 CTTTTGGTCTGCAAGACATAGGG - Exonic
916825702 1:168439900-168439922 CTGCGGTTTTCAAAGAAATATGG + Intergenic
917762452 1:178177155-178177177 ATGCTGTTTGGAAAAACATAAGG + Intronic
918238352 1:182600939-182600961 CTCTTCTTCTGAAAGACATGAGG - Intronic
919097382 1:193054421-193054443 CTGGGGTTGTGGAAGACATATGG - Intronic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
920099111 1:203505827-203505849 CTGCTGCTCTGAAAGTCAAGGGG - Intronic
920418893 1:205816958-205816980 ATTATGTTCTGAAAGACATGAGG - Intergenic
920637290 1:207716058-207716080 CTGCAGTATTGAATGACATAGGG + Intronic
921104385 1:211961111-211961133 CTGATGTCCTGAAAGAGATAGGG + Intronic
921182922 1:212645593-212645615 CTGGTATTGTGAAAGACATTGGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922639588 1:227214943-227214965 CTGCAATTCTCAAAGACAAAAGG + Intronic
922701419 1:227763386-227763408 CTGCTGTGCAGACAGACACACGG - Intronic
923652094 1:235883587-235883609 CTGCTCTTCTCAAAGCCAAAAGG + Intronic
923723668 1:236487810-236487832 CTGCTCTACTGAAAGCCACAAGG + Intergenic
1064304717 10:14154891-14154913 TTGTTGGTCTGAAAGAAATATGG + Intronic
1065307397 10:24381962-24381984 CAGCTTTTCTGAAAGGCAGAAGG + Intronic
1066249223 10:33616613-33616635 CTGACGTTCTGAAAGACCAATGG + Intergenic
1068737341 10:60429140-60429162 CTGCTGATATGAAAGTCACATGG + Intronic
1070631436 10:78087771-78087793 CTCCTTCTCTGAAAGACAGAAGG - Intergenic
1071885163 10:89941638-89941660 CTGCAGTACTGAAAGTCATTGGG + Intergenic
1072900946 10:99406203-99406225 CTGCTGGTTTTAAAGACATTCGG - Exonic
1073899119 10:108198717-108198739 CTGCTTTTCTGGAAGAAATCTGG - Intergenic
1074094865 10:110302744-110302766 CTGGTGTCCTGAAACACAAAAGG + Intronic
1077448590 11:2618633-2618655 ATTCTGTTCTGAAAAACAAAGGG - Intronic
1077979823 11:7288414-7288436 GTGATGTTCTGAAAGATATTTGG - Intronic
1078026640 11:7701774-7701796 CCGCAGCTCTGGAAGACATATGG + Exonic
1078895428 11:15593119-15593141 CTCCTGTTCTGCAAGTCACATGG + Intergenic
1081843184 11:46218496-46218518 CATCGGTTCTTAAAGACATATGG - Intergenic
1084530905 11:69727247-69727269 GTGTTGTTCTGAGAGTCATATGG - Intergenic
1085224452 11:74907060-74907082 GTGCTGTTCTGGAAGCCAAAAGG - Intronic
1085703808 11:78768356-78768378 CGGCTGTTCTGAAAGTCCCATGG + Intronic
1087568632 11:99895726-99895748 CTGCTGTTCTGGAAGCCCGAGGG - Intronic
1088377886 11:109161570-109161592 CTGATGTTAAGATAGACATAGGG - Intergenic
1089022881 11:115235226-115235248 CTGCTTTTCTGAAAAAAAAAGGG + Intronic
1089076829 11:115745235-115745257 CTGCTGTTCTGAAAGGTGGAAGG + Intergenic
1090311942 11:125748645-125748667 GTGCTGATGTGAAAGGCATAAGG + Exonic
1091327912 11:134705700-134705722 TAACTGTTCTGAAAGACAGATGG + Intergenic
1091457371 12:617992-618014 CTGGTGGTCTGAAAGGGATAAGG + Intronic
1091836038 12:3586478-3586500 CTTAGGTTCTGAAAGACATTTGG + Intronic
1093598099 12:20986315-20986337 CAGCTGTTAAGAAAGACAAATGG - Intergenic
1094371862 12:29747671-29747693 CTGGTGTTCAGAAACCCATACGG + Intronic
1097641586 12:62190281-62190303 CTGCAGTTCTGAGAGAAATAGGG + Intronic
1098274911 12:68803515-68803537 CAGATGTTTGGAAAGACATAAGG + Intergenic
1099039315 12:77631286-77631308 CTGGTGTCCTGAAAGAGTTAAGG - Intergenic
1100543725 12:95581588-95581610 ATGCTTTTCTCAAAGAAATAGGG + Intergenic
1100644831 12:96517956-96517978 GTGCTGTTCTGGAAGACATGAGG + Intronic
1101332699 12:103769700-103769722 CAGCTATTCAGAAAGATATATGG + Intergenic
1107223210 13:38012094-38012116 CTGCTGATTTGAAAGAGAAAAGG + Intergenic
1107382742 13:39875176-39875198 CTGCTGAGCTGACTGACATAAGG + Intergenic
1108065850 13:46577029-46577051 CTGCTGGCCTGAAAGAAAAAAGG - Intronic
1108162206 13:47652367-47652389 CCGCTGTTTTGAAACACACACGG - Intergenic
1109643650 13:65224169-65224191 CTGCTCTTCTGAAATAAATCTGG - Intergenic
1111847514 13:93530123-93530145 CTACTGTTACGAAAGACCTAAGG - Intronic
1111982453 13:95031239-95031261 CTCCTCTACAGAAAGACATAAGG - Intronic
1112564388 13:100540799-100540821 CTGCGGTTCTGAGAGGCATCTGG - Intronic
1113383101 13:109821411-109821433 CTGATGTTATGAAAAACAAAGGG - Intergenic
1113525765 13:110974490-110974512 TTGCTGTTTTAAAAGACAGAAGG + Intergenic
1118476328 14:66120853-66120875 CTGTGGTTCTGACAGGCATAGGG + Intergenic
1118889632 14:69897234-69897256 CTGCAGTTCTGAAAGAGACCTGG - Intronic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1119951446 14:78750015-78750037 GTGCTGTTCTCAAAGACTGAGGG - Intronic
1121804175 14:96800387-96800409 CTCCTGTTCTGAGTGACATATGG + Intronic
1122243727 14:100386028-100386050 CTGCAGTTCTGAAACACAGAAGG + Intronic
1123695239 15:22874243-22874265 CTTCTGTTCTTAAACACCTATGG + Intronic
1125348071 15:38740023-38740045 CTGCTTTTCTGATAGAACTAAGG - Intergenic
1126339550 15:47624061-47624083 CGGCAGTTCTGAATGACAGAGGG - Intronic
1133456836 16:5949683-5949705 CTGCTGTTCTACAAAACAAATGG - Intergenic
1133718293 16:8470260-8470282 CTGCTGGGCTCAAAGACTTAGGG - Intergenic
1133747873 16:8701237-8701259 CTGCTGTTGTTAAAGAATTAAGG - Intronic
1135720676 16:24815191-24815213 CTGCTGTTCATAAAGTCATAGGG - Exonic
1138029811 16:53551210-53551232 CTGCAGTGCAGAAGGACATATGG - Intergenic
1141193243 16:81840282-81840304 CTGCTGCTCTGAGACACCTATGG - Intronic
1141514248 16:84532701-84532723 ATGATGTTCTGACAGTCATAAGG - Intronic
1141858752 16:86702365-86702387 CGGCTGTTCTGAAAGAGGCAGGG + Intergenic
1142155805 16:88532444-88532466 CTGCTGTCCCGAGAGACAAAAGG + Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1142967620 17:3591109-3591131 CTCAGGGTCTGAAAGACATAAGG + Exonic
1144508985 17:15858994-15859016 CTGATTTTTTTAAAGACATAGGG + Intergenic
1145173101 17:20676634-20676656 CTGATTTTTTTAAAGACATAGGG + Intergenic
1148044449 17:44734174-44734196 CTGCTGAACTGAAGGACAAATGG + Intronic
1153369491 18:4297983-4298005 CTGCTTTTCTGTGAGTCATAAGG + Intronic
1153758490 18:8307228-8307250 CTTGTATTCTGGAAGACATAGGG + Intronic
1155991241 18:32281669-32281691 TTTCTGTTCTTAAAGACAGATGG + Intronic
1156565648 18:38186509-38186531 CTGCTGAACTTAAAGAAATATGG - Intergenic
1156895066 18:42236626-42236648 CTTGTGCTCTGAAGGACATAAGG + Intergenic
1157005771 18:43582227-43582249 CTCCTGTTCTGAAAGATAACAGG + Intergenic
1157712978 18:49862784-49862806 CATCTGTTCTGAATGACAGAGGG + Intronic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1158713775 18:59860183-59860205 CAGCTGTCCTGGAAGACAGATGG - Intergenic
1161382896 19:3975876-3975898 CTGCTTCTCTGAATGACACAGGG + Intergenic
1162361821 19:10224931-10224953 CTGCAGTTCTGAAAGCCCCATGG - Exonic
1163299567 19:16435361-16435383 CTGCTGTTCTGAAAGACATAGGG + Intronic
1165529618 19:36387007-36387029 TTCCTATTCTGAAAGAAATAGGG - Intronic
1166600150 19:44086626-44086648 CTGATGTCTTGAAAGACATGAGG - Exonic
1168723435 19:58567836-58567858 CTGCTGTTCTCAGAGAAATAAGG + Intronic
925447984 2:3943943-3943965 CTGCCTTTCTGAAAGACCTGAGG - Intergenic
925687014 2:6482995-6483017 CTGCTCTTCTGCAAGGCATGTGG - Intergenic
927755770 2:25706727-25706749 TTACTGTTCTGAAAGTCCTAGGG + Intergenic
932539845 2:72640391-72640413 TTGGTGTCCTGAAAGAGATAGGG + Intronic
937666867 2:124497840-124497862 CTGCTCTGCTGATAGACACAAGG - Intronic
940251932 2:151687963-151687985 CTGCTGTCCTGATTTACATAAGG + Intronic
941901983 2:170687578-170687600 CTGCTATTCTGAAAGTAAAATGG - Intergenic
942207910 2:173640710-173640732 CTGTTGTTCTGCATGACATATGG - Intergenic
1169913548 20:10666619-10666641 GTACTGTTCTGGAAAACATAAGG - Intronic
1173747483 20:45448935-45448957 CTGCTGTTCTGCAAAATATTGGG - Intergenic
1175130429 20:56785053-56785075 TTGCTACTCTGAAAGAGATACGG + Intergenic
1176909459 21:14546516-14546538 CTGCAGTTATGAGAGCCATAAGG + Intronic
1176996384 21:15560187-15560209 CTTCTTTTCTGAAAGAGACAGGG + Intergenic
1177595712 21:23239840-23239862 CTGATGGTCTCAGAGACATAGGG - Intergenic
1178491912 21:33057866-33057888 CTCTTGTTCTGGAAGCCATATGG - Intergenic
1179640994 21:42747182-42747204 CTGCTGTTGACAAAGACAAAAGG - Intronic
1182094837 22:27619130-27619152 CTGCTGGTCTGCAGGACACAAGG + Intergenic
1183918123 22:41140169-41140191 CTGCTGCTTTAAAAGACAGACGG + Exonic
1185399028 22:50606508-50606530 ATGCAATTCTGGAAGACATAAGG - Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
951048961 3:18072999-18073021 ATGCTTTTCTTAAACACATACGG - Intronic
952653393 3:35753815-35753837 ATGTTGTTCTGAAACACATTTGG + Intronic
955590723 3:60532237-60532259 TTGCTATTCTGAATGGCATAAGG - Intronic
955897791 3:63719079-63719101 CTGAGGTGCTAAAAGACATAAGG - Intergenic
956088901 3:65643109-65643131 CTGCAGTTCAGAAAGTCACATGG - Intronic
957296079 3:78334423-78334445 CTTCTGTTCTGCAAAAGATATGG - Intergenic
959609761 3:108280112-108280134 CTCCTGTTCTGAAAAACATAAGG + Intergenic
961020185 3:123498717-123498739 CTGCTGCTCTAAAAGACAGCTGG + Intronic
962807936 3:138939906-138939928 CTGCTTTTCTGAAAAAGAAAAGG + Intergenic
964377003 3:156057641-156057663 CTGCTGTACTGGAACACATATGG + Intronic
964964251 3:162471216-162471238 CAGGTGTTTTGAAAGACAAATGG - Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
967727189 3:192872809-192872831 CCCCTGTTTTTAAAGACATAGGG - Intronic
970781570 4:19744106-19744128 CTGCTGTTCAGAGAGAAAAATGG - Intergenic
971700272 4:29963762-29963784 TTGCTGTTCTGAGAGCCATAAGG + Intergenic
973939468 4:55891346-55891368 GTCCTGTTCTGCCAGACATAGGG - Exonic
976137353 4:81953013-81953035 CTGCTATTCTAAAAGTCATTTGG - Intronic
976515013 4:85955131-85955153 CTGCTGTTTAGAAAGAGATCTGG - Intronic
978974363 4:114850730-114850752 CTGATCTTCTGAAAGATCTAAGG + Intronic
979785121 4:124707729-124707751 CTGCTTTTCTGATTGACAGAAGG - Intronic
980148075 4:129014552-129014574 CTTCATTTCTGAAAGACATTAGG + Intronic
980754830 4:137144838-137144860 CTAATGTTCAGAAAGACATTTGG - Intergenic
981152151 4:141391685-141391707 CTGCTTCTGTGAAAGACAGATGG + Intergenic
982620604 4:157699056-157699078 CTGCTGTTTTGAAAGATACTTGG - Intergenic
983041390 4:162931742-162931764 CTCCTTTTCTGAAAGGCATGCGG + Intergenic
985426894 4:189839985-189840007 CTGCTTCCCTGAAAGAAATACGG + Intergenic
985872138 5:2565352-2565374 CTGATGTTCTCAAAGACTCATGG + Intergenic
988354452 5:30155225-30155247 CTGGAGTTCTGAAAGACATCAGG - Intergenic
989527522 5:42469908-42469930 ATGCCTTTCTGAAAGACAAAAGG - Intronic
992376624 5:76194130-76194152 GGGCAGTTCTGAAAGACATAAGG + Intronic
994028209 5:95109716-95109738 CTGCTGGACTCAGAGACATAAGG - Intronic
997588703 5:135060025-135060047 CTGCTGTTCTGAAAGCTGCAAGG - Intronic
999454972 5:151707698-151707720 CAGCTGTTCTAAAACACAGATGG - Intergenic
999788783 5:154917757-154917779 CTGTAGTTCTCAAAGACACAAGG + Intronic
999836716 5:155381594-155381616 GTGCTCTTTTGAAAGACATAAGG + Intergenic
1000443087 5:161286008-161286030 CTCCAGTTCTGAAAGATAGAAGG - Intergenic
1001141861 5:169151208-169151230 CTGCTGTGCTGAGAGAGAGATGG - Intronic
1002655151 5:180740061-180740083 CTGCTGTTCAGACAGGCAAAAGG - Exonic
1005402770 6:25451609-25451631 CTGCTGTGCTAAGAGACATGGGG - Intronic
1005484481 6:26286508-26286530 CTGCTGTTCTGCCAGGCACACGG - Intergenic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1006150349 6:31983698-31983720 CTGCTTTCCTGAAGGAAATAAGG + Intronic
1006156650 6:32016436-32016458 CTGCTTTCCTGAAGGAAATAAGG + Intronic
1006522519 6:34579583-34579605 CTGATGTTCAGTAAAACATATGG - Intergenic
1006958740 6:37904111-37904133 GTGCTGCTCTGACATACATAAGG + Intronic
1010470928 6:76227581-76227603 CTGATGTTTTGAAAGACCTGTGG - Intergenic
1010661846 6:78580699-78580721 CAGCTGTTCTAAAAAACATAAGG + Intergenic
1011117437 6:83909076-83909098 CTGCTGTTCTGAAAGGTAAGTGG + Exonic
1012717707 6:102698469-102698491 CTGCTGATTTTAGAGACATAGGG - Intergenic
1013670175 6:112393259-112393281 CTGCTGGTCTGAAAGATATCAGG + Intergenic
1015189956 6:130461592-130461614 CTCCTTTTCTGAAGGTCATATGG + Intergenic
1017543047 6:155422736-155422758 CTGCTCTTCTGAAATCTATATGG - Exonic
1017873804 6:158507031-158507053 CTGCTATTCTTTTAGACATAGGG + Exonic
1018055735 6:160050710-160050732 CTGCTGTTAAGAGACACATAAGG - Intronic
1018785361 6:167103796-167103818 CTGCTGTTCATAAAGCCACATGG + Intergenic
1023187684 7:37548866-37548888 CTGCTGTCCTAAAAGATTTAGGG + Intergenic
1027502650 7:78973099-78973121 CAGCTGTTCTGATTGTCATAAGG + Intronic
1028392424 7:90332186-90332208 CTGGAGTTCTGAAAGAATTAAGG - Intergenic
1030162666 7:106524975-106524997 CTGGTGTTCTGAGAGACCTGGGG + Intergenic
1034865891 7:154641711-154641733 GGATTGTTCTGAAAGACATATGG + Intronic
1036434913 8:8724048-8724070 CTGTTGTTATAAAAGGCATAGGG + Intergenic
1039078376 8:33712687-33712709 CTGCTGTTCTGAAGCAGACAGGG - Intergenic
1039293123 8:36120662-36120684 CTGCTGGCCTGCAAGACATCAGG + Intergenic
1039299141 8:36190698-36190720 GTTCTGTTTTGAATGACATATGG - Intergenic
1039679867 8:39720968-39720990 CTGATATTCTGACAGACATTTGG - Intronic
1039796053 8:40916336-40916358 CTGCTTTTCTGAAAGGCACCTGG + Intergenic
1040033820 8:42849889-42849911 CTAATGTTCTCAAAGACATTAGG + Intronic
1040842934 8:51803843-51803865 ATGCAGTTCTGAAAGTCATTGGG - Intronic
1044043253 8:87397183-87397205 TTGCAGCTCTGAAAGAAATAGGG - Intronic
1047913144 8:129553040-129553062 CTGTTGAACTGAAAGGCATAGGG + Intergenic
1048721403 8:137329838-137329860 CTTCTGTTCTGAAAAGCATGTGG + Intergenic
1049862047 8:144905644-144905666 GTGCAGTTCTGAAAGACATGGGG - Intergenic
1051221046 9:14848698-14848720 CTGCTGTTCTGATGGAGATGTGG + Exonic
1054968140 9:71053465-71053487 CTGCTTTTCTGGATGACATTGGG - Intronic
1056900077 9:90590587-90590609 CTACTGTTCTTAAAGAATTAAGG + Intergenic
1059924380 9:119193629-119193651 ATGCTGTTATGAGATACATATGG - Intronic
1061740937 9:132705522-132705544 CAGCTGTTGTGCCAGACATAAGG + Intergenic
1186648675 X:11535397-11535419 GTGATGTTCTGCAAGCCATATGG + Intronic
1189645848 X:43130526-43130548 CTGCTGTCCTGACAGGAATAAGG - Intergenic
1189804553 X:44722315-44722337 CTTCTCTGCTGAAAGACATGGGG - Intergenic
1190171167 X:48113349-48113371 CTGGTGTTGTGATAGACATGGGG - Intergenic
1190177268 X:48161097-48161119 CTGGTGTTGTGATAGACATGGGG - Intergenic
1190180980 X:48192104-48192126 CAGGTGTTGTGATAGACATAGGG + Intronic
1194212620 X:91087306-91087328 CTGCTGGTCTGAAAGACATAAGG - Intergenic
1194579201 X:95650942-95650964 CTGCTGATCTGAGAGACAGGAGG + Intergenic
1195579569 X:106485714-106485736 CTGCTGATCTGAAAGATTAAGGG + Intergenic
1196210484 X:112990511-112990533 CTCCTATTCTGAGAAACATAAGG - Intergenic
1197905080 X:131415929-131415951 ATGCTGTCCTTAAAGACATCTGG - Intergenic
1197937623 X:131755778-131755800 TTGCTCTTCTGAAAGACCTTAGG - Intergenic
1198327629 X:135589656-135589678 CTGCTGTTCAGAAAGTGAAAAGG + Intergenic
1199277716 X:145965193-145965215 CTGCTGATTTGAGAGCCATAGGG + Intergenic
1199555409 X:149102580-149102602 CTGCTTCTTTGAAAGGCATATGG + Intergenic
1201988550 Y:19996462-19996484 CTGTTGTTGTGAAAGACCCATGG + Intergenic
1202168750 Y:22018917-22018939 CTCCTTTTCTGAAACAAATAAGG - Intergenic
1202222611 Y:22567451-22567473 CTCCTTTTCTGAAACAAATAAGG + Intergenic
1202320504 Y:23628209-23628231 CTCCTTTTCTGAAACAAATAAGG - Intergenic
1202550263 Y:26041847-26041869 CTCCTTTTCTGAAACAAATAAGG + Intergenic