ID: 1163299686

View in Genome Browser
Species Human (GRCh38)
Location 19:16436267-16436289
Sequence TGTGACAGTCTGAAAGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163299684_1163299686 -4 Left 1163299684 19:16436248-16436270 CCACATAAACGTGAGGAAATGTG 0: 1
1: 0
2: 3
3: 23
4: 586
Right 1163299686 19:16436267-16436289 TGTGACAGTCTGAAAGTGAAGGG 0: 1
1: 0
2: 0
3: 31
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163299686 Original CRISPR TGTGACAGTCTGAAAGTGAA GGG Intronic
904248964 1:29208896-29208918 GGTGACAGGCTAAGAGTGAAAGG + Intronic
905370329 1:37479593-37479615 CCTTTCAGTCTGAAAGTGAAAGG - Intronic
905856156 1:41315999-41316021 CATGACAGTCTGTGAGTGAAGGG - Intergenic
905911966 1:41661645-41661667 TCTGACAGACTGAAACTGCATGG + Intronic
906050278 1:42865563-42865585 TATAATAGACTGAAAGTGAAGGG + Intergenic
907694414 1:56707581-56707603 TGAGAGAGCCAGAAAGTGAATGG - Exonic
907748342 1:57237477-57237499 AGTGACATTCTGAGAGAGAAAGG - Intronic
908884346 1:68770564-68770586 AGTGTGAGTCTGAAAGTGGATGG - Intergenic
909056123 1:70823220-70823242 TTGAACAGTCTGAAATTGAAGGG + Intergenic
909338417 1:74503880-74503902 TGTGACAGTGTGAAAGTGTTTGG + Intronic
911713300 1:101099501-101099523 TTTGAATGTCTGAAAGAGAATGG - Intergenic
912691160 1:111805474-111805496 TGTGTCAGTCTGACTGTGAGGGG - Intronic
912910547 1:113755322-113755344 TTTCACAGTCTGATAGTGATGGG - Intronic
913030281 1:114895567-114895589 TGTGAGAGTCTATAAGTTAAGGG - Intronic
913260278 1:116991479-116991501 TCTGATAGTCTGAAAATGATGGG + Intergenic
914734991 1:150407534-150407556 TGTTACATTTTGAGAGTGAAAGG - Intronic
916213753 1:162378941-162378963 GGTGACACTCTCAAAGTGACTGG + Exonic
920524591 1:206657512-206657534 TGTGTAACTCTGTAAGTGAATGG + Intronic
921115764 1:212089587-212089609 TATAACAGTATGAAAGTTAATGG - Intronic
921781709 1:219173497-219173519 TGTGCGAGTCCCAAAGTGAAAGG + Intergenic
921837083 1:219789481-219789503 TGTGACAGTCTGAGATTCAAAGG - Intronic
922067596 1:222158931-222158953 AGTGAAAGTCAGACAGTGAAAGG + Intergenic
922204777 1:223436803-223436825 TGTGACTGTCTGAAGTTGAAGGG - Intergenic
923324222 1:232866606-232866628 TGTGAAAGGATGAAATTGAAGGG - Intergenic
1066720015 10:38327976-38327998 TGTTAAAGTCTGAAAAGGAAGGG - Intergenic
1069099881 10:64306998-64307020 TGAGGGAATCTGAAAGTGAAAGG - Intergenic
1070101185 10:73388406-73388428 TGTGGCAGGCTGAAAATAAAAGG + Exonic
1071536954 10:86441318-86441340 TGAGTCAGCCTGAAAGTGAAAGG - Intronic
1071702661 10:87957788-87957810 TTTGACAGTTTGACAGTTAAAGG + Intronic
1071939036 10:90567156-90567178 TTTCATAGACTGAAAGTGAAGGG - Intergenic
1078102643 11:8338767-8338789 TCTGTCAGTCTGACAGTCAATGG + Intergenic
1078320128 11:10327021-10327043 TGTTTTAGGCTGAAAGTGAAGGG + Intronic
1079165345 11:18035826-18035848 GCTTACAGTCTGATAGTGAAGGG - Intronic
1079651086 11:22930999-22931021 TCTGACAGTTTTAAAGTGTATGG + Intergenic
1080102379 11:28474554-28474576 CCTGACAGTCTTAAAGTGGATGG + Intergenic
1082993103 11:59225807-59225829 TGAGACATACTGAAAGAGAATGG + Intergenic
1084542462 11:69796221-69796243 GGTGACAGGCCCAAAGTGAAAGG - Intergenic
1084756590 11:71243148-71243170 TGTGAGAGTCAGAAAAAGAACGG + Intronic
1085042978 11:73337744-73337766 TGGCAGAGACTGAAAGTGAAGGG - Intronic
1085560465 11:77468111-77468133 CTTAACAGTCTGAAAGGGAAAGG + Intronic
1086211575 11:84327036-84327058 GCTGAAAGTCTGAAAGTGAAAGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1087253754 11:95932810-95932832 ATTCATAGTCTGAAAGTGAAAGG + Intergenic
1087326951 11:96736483-96736505 TGTTACAGGCTCAAAGTAAAGGG - Intergenic
1088398282 11:109392959-109392981 AAGGACAGTCTGAAAGTGAAAGG + Intergenic
1088565295 11:111165903-111165925 TGTGCCAGTTTTAAAGTGACAGG - Intergenic
1088933099 11:114372077-114372099 TGTGACCATATGAAACTGAACGG - Intergenic
1089104990 11:115995307-115995329 TCTGGCAGTCTGATAGAGAAAGG + Intergenic
1089612406 11:119676893-119676915 TGTGACAGTGTCAAGGTCAATGG - Intronic
1089796788 11:120987093-120987115 AGTGACAGTCAGAAAGAGAAAGG - Exonic
1091949259 12:4579467-4579489 TGTGACAGTACTAAAGTGACCGG - Intronic
1092206713 12:6619045-6619067 TGTGAGAGAATGAGAGTGAAAGG - Exonic
1092237224 12:6817813-6817835 TGTGACAGTGTGTGAGTGCATGG - Intronic
1092470781 12:8778316-8778338 TGTGACTTTATAAAAGTGAAAGG + Intronic
1092835863 12:12487737-12487759 TCTGACATTTTGAATGTGAAGGG - Intronic
1093323574 12:17744521-17744543 TGTGACTGTCTGAGAGTGTTGGG + Intergenic
1094386487 12:29900014-29900036 TGTGCCCAACTGAAAGTGAATGG + Intergenic
1094481294 12:30884333-30884355 TGTTACAATCTGAAAGAGGAAGG + Intergenic
1096316703 12:50573996-50574018 TCTTGCAATCTGAAAGTGAATGG + Intronic
1097405385 12:59183105-59183127 TTTGAGAGGCTGAAAGTGAGGGG + Intergenic
1097675118 12:62592112-62592134 TGTGACAGTTTGTAATTAAAAGG + Intronic
1099689206 12:85928657-85928679 TGAGACAGTAAGAGAGTGAAAGG + Intergenic
1102708489 12:114904135-114904157 TGTGAAAGTGTGAGAGTGCATGG + Intergenic
1104187501 12:126447089-126447111 TCCGACAGTCTGAAAAAGAAAGG + Intergenic
1105859614 13:24397522-24397544 TCATACAGACTGAAAGTGAAGGG + Intergenic
1106016713 13:25876208-25876230 TGGAAGAGGCTGAAAGTGAAGGG + Intronic
1108269040 13:48740640-48740662 GGAGACAGTCAGCAAGTGAAAGG + Intergenic
1109604785 13:64678612-64678634 GGTGAAAGTCTGCAAGTGGAGGG - Intergenic
1109887181 13:68557634-68557656 GGAGGCAGTCTGAAAGTTAAAGG - Intergenic
1110074780 13:71226512-71226534 TCTATCAGTCTGACAGTGAAAGG - Intergenic
1112391932 13:98992954-98992976 TGTGGAAGTCTGAAAGAGCATGG + Intronic
1112958240 13:105088238-105088260 TGTCACTGTTTGAATGTGAATGG + Intergenic
1112977822 13:105342555-105342577 AGTGACAGACTGACAGTGCATGG - Intergenic
1114303454 14:21399083-21399105 TGTTACAGTCTGAAAGAGTACGG - Intronic
1117505689 14:56400762-56400784 TCTGACTGTCTAAAAGTGGAAGG - Intergenic
1121585050 14:95057669-95057691 TCAGTCAGTCTGGAAGTGAAGGG - Intergenic
1124531797 15:30514906-30514928 TTTGAATGTCTGAAAGAGAATGG + Intergenic
1124766861 15:32492784-32492806 TTTGAATGTCTGAAAGAGAATGG - Intergenic
1125365395 15:38909533-38909555 AGACACAGACTGAAAGTGAAGGG - Intergenic
1125548711 15:40528351-40528373 TGGGGGAGTCTGAGAGTGAAGGG + Intergenic
1127309396 15:57739120-57739142 TGTGACAGTCTGAATCTGTCTGG + Intronic
1127893076 15:63271983-63272005 TGAAACTGTCTGAAAGTAAATGG - Intergenic
1127973475 15:63980081-63980103 TGAGACAGCTTGGAAGTGAAGGG + Intronic
1128403512 15:67310847-67310869 AGTGACTGTCTGAAAGAGAAGGG + Intronic
1128952617 15:71902548-71902570 TGTGAAAGGATTAAAGTGAACGG + Intronic
1131502683 15:92984811-92984833 TGTGACTTTCTGAAAGTTGAAGG - Intronic
1132795230 16:1717619-1717641 TGTGACAATAGCAAAGTGAAAGG - Intronic
1138009377 16:53363172-53363194 TCTGAGAGTCTGAGAGTTAAAGG - Intergenic
1138593316 16:58015267-58015289 TGTGCCAGTGTGAAAATGAAAGG - Intronic
1138712442 16:58984959-58984981 AGACACAGACTGAAAGTGAAGGG + Intergenic
1138905753 16:61330177-61330199 ACTTACAGGCTGAAAGTGAATGG - Intergenic
1139100196 16:63756753-63756775 TGATATAGACTGAAAGTGAAGGG + Intergenic
1139267692 16:65655767-65655789 TGTGAGAGTTTGAAATTAAACGG - Intergenic
1142008813 16:87703424-87703446 TGTCACAGCCTGTAAGTGAATGG + Intronic
1144043852 17:11437263-11437285 CCTGGAAGTCTGAAAGTGAATGG - Intronic
1145803561 17:27709081-27709103 TGAGACAGGATGAAATTGAATGG + Intergenic
1146153042 17:30493329-30493351 TGAGACAGGATGAAACTGAATGG + Intronic
1149602099 17:57899658-57899680 TGTGGCACTGTGCAAGTGAATGG - Intronic
1150824122 17:68459554-68459576 TGTGAAATTCTGGAAGTAAAGGG + Intergenic
1150990954 17:70258555-70258577 TGGGAGTGTCAGAAAGTGAATGG - Intergenic
1151039672 17:70844056-70844078 TATGACAATCAGAAAGTGGAAGG - Intergenic
1153244089 18:3056659-3056681 TGTGCAAGTGTAAAAGTGAATGG - Intergenic
1153957080 18:10106054-10106076 TCTGACAGTTTAAAAGTGCATGG + Intergenic
1155813236 18:30266967-30266989 TGTGAAATTCAGGAAGTGAAGGG + Intergenic
1155883513 18:31179577-31179599 TTTGACACTTTGAAAATGAAAGG + Intergenic
1156219731 18:35039213-35039235 GGGGACAGTCTGAAATTGAAAGG - Intronic
1156246349 18:35303009-35303031 TGTAACTGTCTGAAAGTGGGTGG - Intergenic
1156937626 18:42729962-42729984 GGTGATAGTATGGAAGTGAAGGG - Intergenic
1161524004 19:4742432-4742454 CGTGACCATCTGAAAGTGCACGG + Intergenic
1163299686 19:16436267-16436289 TGTGACAGTCTGAAAGTGAAGGG + Intronic
1163979532 19:20885987-20886009 AGTGAGTGGCTGAAAGTGAACGG - Intergenic
1163979653 19:20887158-20887180 AGTGACAGACTGACAGTGACAGG - Intergenic
1164787710 19:30947308-30947330 TGTCACAGTCTCACAGTGTAAGG - Intergenic
1165383964 19:35499772-35499794 TGAGACAGTTTGGAAGTGGAGGG - Intronic
1166229863 19:41420362-41420384 TGTGAGAGACAGCAAGTGAATGG + Intronic
1166442942 19:42831990-42832012 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166462627 19:43002752-43002774 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166468765 19:43059213-43059235 TGTCAAATCCTGAAAGTGAATGG + Intronic
1168287432 19:55341591-55341613 TGTGTCAGTCTGAGTGTGCATGG + Intronic
1168445147 19:56405304-56405326 TGTGACAGTGTGACTGAGAATGG + Intronic
926318809 2:11733346-11733368 TGTGGCAATATGAAAGTGTATGG + Intronic
926372971 2:12198966-12198988 GGAGACAGTCAGATAGTGAAGGG - Intergenic
927290523 2:21400634-21400656 TGGGATAGCCTGAAGGTGAAAGG - Intergenic
927417514 2:22894107-22894129 TTTGACAGGCTGATAGGGAAAGG - Intergenic
927943917 2:27123419-27123441 TGTCACAGTCGGACAGTGACTGG + Intergenic
930001359 2:46863847-46863869 TTTGTCACCCTGAAAGTGAAGGG + Intergenic
930891071 2:56388709-56388731 TTTTAAAGTCTGAAAATGAAGGG + Intergenic
933891511 2:86775746-86775768 TGTGACCGTCTTCAAGTGCATGG + Exonic
935887211 2:107635259-107635281 TGTGACAGGGTGTAAGGGAAGGG + Intergenic
937587449 2:123570160-123570182 TGTGAGAGTCTACAAGTAAAGGG - Intergenic
938563738 2:132497825-132497847 TGTGGATGTCTGAAAGAGAAGGG + Intronic
940712803 2:157182686-157182708 AGAAACAGTCTGAAAGTCAAAGG - Intergenic
940980058 2:159991406-159991428 TGGGACAGGCTGAAAGTGCAGGG + Intronic
941900669 2:170675272-170675294 TATGACCTTCTGAGAGTGAAAGG - Intergenic
942868397 2:180704773-180704795 TCTCATAGTCTGAAAGTGAAGGG - Intergenic
943643173 2:190381149-190381171 TGTAACATTCTGACAGGGAAGGG - Intergenic
945139414 2:206667988-206668010 TGTGACTGTCTGGAAGTTAGAGG - Intronic
945892709 2:215447146-215447168 TGCAACAGTCTCAAAGTGAATGG - Intergenic
946035593 2:216739893-216739915 TGTGATATTATGAAAGTAAATGG + Intergenic
946491143 2:220150304-220150326 ATTCACAGTCTGAAAGTGTATGG - Intergenic
947692627 2:232153818-232153840 GGTGTCACTCTGAAAGTGATGGG - Intronic
947695286 2:232181429-232181451 GGTGTCACTCTGAAAGTGATGGG - Intronic
947718986 2:232356627-232356649 GGTGTCACTCTGAAAGTGACAGG + Intergenic
1169529527 20:6469542-6469564 TATTACATTCTGAAAATGAATGG + Intergenic
1169957955 20:11126823-11126845 TGTGAGAGGGTGAAAGTGGAAGG - Intergenic
1171241743 20:23574369-23574391 GGACACAGTCTGAAAGTGAAGGG - Intergenic
1174060067 20:47826382-47826404 TGTGTCAGTCAGAAACTAAAAGG - Intergenic
1174071829 20:47904994-47905016 TGTGTCAGTCAGAAACTAAAAGG + Intergenic
1174152223 20:48493675-48493697 TGTGTCAGTCAGAAACTAAAAGG - Intergenic
1174539666 20:51278907-51278929 GGTGACAGTCTGGAAGTAAGGGG + Intergenic
1177146127 21:17409146-17409168 TCTGACAGTTTGAAGGTGAGAGG + Intergenic
1178158553 21:29883678-29883700 TGTGACATTCTGAATGGGAATGG + Intronic
1178218127 21:30624594-30624616 TGTGATAGTATGATAGTGAGTGG - Intergenic
1180874097 22:19166635-19166657 AGTGACAGCCTGATAGTGAAGGG - Intergenic
1181099934 22:20532242-20532264 GGTGGCAGTCAGAAAGTGAAGGG + Intronic
1182438601 22:30347654-30347676 TGTGTCAGTCAGAAAGTACACGG + Intronic
1182583628 22:31330014-31330036 TGTGTAATTTTGAAAGTGAATGG - Intronic
1183125333 22:35774169-35774191 TGGGACATTCTGAGAGAGAAAGG + Intronic
949360117 3:3222618-3222640 AGTGACAGCCAGATAGTGAAGGG + Intergenic
950797534 3:15522162-15522184 TGTCACAGGCTGACAGTGGAGGG - Intergenic
951248122 3:20364431-20364453 AGTGAGAGTCTCAAAGTGAGGGG - Intergenic
951458203 3:22917469-22917491 TGTGACGGTCTTACAGTGGATGG - Intergenic
951962007 3:28336532-28336554 TGTGACAGACTAAAAGTATATGG + Intronic
952196907 3:31085372-31085394 TGAGACACGCTGAAAGTGAAAGG + Intergenic
953759863 3:45678197-45678219 TGTGGAAGACTGAAAGTGAAGGG - Exonic
953760662 3:45684328-45684350 TGTGACGGAGTGAAAGTGAGGGG + Exonic
954862848 3:53704674-53704696 AGTTACAGTTTGCAAGTGAAGGG - Intronic
955911082 3:63861181-63861203 TGAGACAGTCTGTAAGTGGCAGG + Intronic
955994899 3:64669665-64669687 TGTCACTGTCAGAAAGTGTATGG + Intronic
956261726 3:67350471-67350493 TGTCCCAGTGAGAAAGTGAATGG - Intergenic
956305480 3:67819975-67819997 AGTCACAGTCTGAAATTGAAAGG - Intergenic
960462922 3:117959082-117959104 AGTGAGAGTTTGAAAGAGAAGGG + Intergenic
961000435 3:123370634-123370656 TGTCATAGTCTCAAAGTGATGGG - Intronic
961376048 3:126466771-126466793 TGTCTCAGTGGGAAAGTGAAAGG - Intronic
961397907 3:126609860-126609882 TGTTACCCTCTGAAAGTGAGAGG - Intronic
961682066 3:128606035-128606057 TGTGACATCCTGTAAATGAATGG + Intergenic
961754169 3:129117705-129117727 CGTGAGATTCTGAAAGTGAATGG - Intronic
962934441 3:140066773-140066795 TGTGAGTGTCTGTGAGTGAAAGG - Intronic
964259284 3:154816802-154816824 TTTGATAGTATGAAAGTGAAAGG - Intergenic
964688290 3:159421998-159422020 TGTTATCTTCTGAAAGTGAATGG + Intronic
964727399 3:159828131-159828153 TCTGACAGCCTGAAAGTGGGCGG + Intronic
965653840 3:170962773-170962795 TTTGACAGACTCAAATTGAAAGG - Intergenic
966263573 3:178009870-178009892 TGTCTCATTCTGAAATTGAAAGG - Intergenic
967428906 3:189359176-189359198 TCTGAAAGTCTGAAAGAGCACGG + Intergenic
967799769 3:193643514-193643536 TGTCACAGTCTTAAAGAAAAAGG - Exonic
969383875 4:6829621-6829643 TCCCACAGCCTGAAAGTGAATGG + Intronic
970153064 4:13110482-13110504 TGACACAGTCTCAAAGTAAAAGG + Intergenic
970477560 4:16439040-16439062 TGTGAGAGTGTGAAAGTAGATGG + Intergenic
970477812 4:16441483-16441505 TGTGAGAGTGTGAAAGTAGATGG + Intergenic
973579578 4:52329262-52329284 ACTCACAGACTGAAAGTGAAGGG - Intergenic
973877739 4:55237728-55237750 ACTCACAGTTTGAAAGTGAAGGG - Intergenic
974875048 4:67693707-67693729 TGTGGCTGTGTGAAAGAGAACGG + Intronic
975217266 4:71770060-71770082 TGTCACTATGTGAAAGTGAAAGG - Intronic
977841882 4:101716782-101716804 ACAAACAGTCTGAAAGTGAAGGG + Intronic
979808290 4:125002569-125002591 TGTGATAGTAAGAAAGTGAGAGG - Intergenic
979949021 4:126868210-126868232 TGTGACAGTTTAAAAGTGTGTGG - Intergenic
982860245 4:160439250-160439272 TCACATAGTCTGAAAGTGAAGGG - Intergenic
983359305 4:166708576-166708598 AGTGATAGACTGAAAGTGAAGGG - Intergenic
983669583 4:170220148-170220170 TCTTACAGACTGAAAGGGAAGGG + Intergenic
984086875 4:175324405-175324427 TGTGTCAATCTGAAAATAAATGG + Intergenic
984116721 4:175690546-175690568 TCTGAAAGTCGGAAAGTGCAAGG - Intronic
984569398 4:181373528-181373550 AGTTGCAGTCTGAAAGTGATTGG + Intergenic
984874534 4:184355487-184355509 TGGGACAGTCTGAAAAAGGAAGG + Intergenic
986028549 5:3873596-3873618 GGTGACAGTCAGAAGATGAATGG + Intergenic
986849147 5:11790777-11790799 TGGGACAATCTGACAGTGGAGGG + Intronic
986875247 5:12099427-12099449 TGTGAGAGTGTGAAAGTGTGAGG - Intergenic
987950745 5:24672669-24672691 AGTCACAGACTGAAAATGAAAGG - Intergenic
988098927 5:26654004-26654026 TGTGACAGTCTGAGAGCATATGG + Intergenic
990985016 5:61633167-61633189 AATGACAGCCTGAAAGAGAATGG + Intergenic
991458574 5:66832232-66832254 CGTGAGAGTCTGGAAGTGGATGG - Intronic
991471938 5:66978222-66978244 TGTAAAATTCAGAAAGTGAAGGG - Intronic
991534581 5:67653509-67653531 TATGATATTCTGAAATTGAAAGG + Intergenic
993857195 5:93090990-93091012 TTGGACAGACTGAAAATGAAGGG - Intergenic
994162098 5:96568209-96568231 TATGACAGTTTGAGAGTCAAGGG - Intronic
994758406 5:103822823-103822845 TGTGACATTATAAAAGTGACAGG + Intergenic
994958828 5:106571460-106571482 TGGGAGACTCTGAAAGGGAAGGG + Intergenic
995728838 5:115214001-115214023 TTTTATAGTCTGAAAGTCAAAGG - Intronic
996611087 5:125381486-125381508 TGAAACAGTTTTAAAGTGAATGG + Intergenic
1004811358 6:19267490-19267512 CGTCACTGTCTGAAAGTTAAAGG + Intergenic
1005434593 6:25794946-25794968 TGTGTCAGTTTGAGAGTGACAGG + Intronic
1005495721 6:26385957-26385979 TGTGCACGTCTGAGAGTGAAAGG + Intronic
1006262383 6:32885890-32885912 TATCATAGTCTGAAACTGAAGGG + Intergenic
1007263940 6:40583543-40583565 AGTGACAGTCTTAAAGAGAAAGG + Intronic
1008791728 6:55243102-55243124 AATGACAGTCTGAAAGATAAAGG + Intronic
1012056765 6:94422435-94422457 TCTGAGAGACTGAAAGTAAAGGG - Intergenic
1012152312 6:95769744-95769766 TGTGCCATTCTAAAAATGAATGG + Intergenic
1012612802 6:101236311-101236333 TGTGACACCATGGAAGTGAAGGG + Intergenic
1013080020 6:106804317-106804339 TTTAATAGTCTGAAAGTCAATGG - Intergenic
1013350641 6:109302683-109302705 GGTGACAATCCGTAAGTGAATGG - Intergenic
1013690844 6:112640945-112640967 AGAGAAATTCTGAAAGTGAAAGG + Intergenic
1014817840 6:125954464-125954486 TGTGCTAGTGTGTAAGTGAATGG + Intergenic
1015126761 6:129763597-129763619 AGTGACAATCTGAAAGTCACTGG + Intergenic
1015624954 6:135171418-135171440 TGTAACAGTGTGAAGGTAAAAGG + Intergenic
1015936318 6:138408670-138408692 AGTGACACTCTGAAAGTTAAAGG - Intronic
1015953423 6:138576485-138576507 TTTGACAGCCTGACAGTGAGAGG - Intronic
1017186849 6:151610105-151610127 TGAGATAGTTTGTAAGTGAAAGG + Intronic
1018776011 6:167016684-167016706 TGTGAGAGTGTGACAGGGAATGG - Intronic
1019208497 6:170384067-170384089 TGTTACATTCTGAAAATGACAGG + Intronic
1019842112 7:3457435-3457457 TGTGACAGTGGGAAGGTAAAGGG - Intronic
1020180046 7:5915206-5915228 TGTGACAGACTGGCAGGGAAGGG + Intronic
1020302888 7:6809676-6809698 TGTGACAGACTGGCAGGGAAGGG - Intronic
1021626766 7:22601310-22601332 TGAAACAGTCTGGAAGAGAATGG + Intronic
1022567354 7:31416596-31416618 TGGCACAGTGTGACAGTGAAAGG - Intergenic
1023731781 7:43198554-43198576 TGTGAATGTGTGTAAGTGAAGGG - Intronic
1025234849 7:57227622-57227644 TGTGTCAGTCAGAAACTAAAAGG + Intergenic
1026438999 7:70426520-70426542 TGAGACACTCAGAAAGTGAGCGG - Intronic
1027974906 7:85140302-85140324 TGTGACAGAGTGAAAATGCACGG + Intronic
1028838880 7:95404734-95404756 TGTGGAAAGCTGAAAGTGAATGG - Intergenic
1030225744 7:107148267-107148289 TCTGACAATCTGAATCTGAACGG - Intronic
1030787718 7:113683640-113683662 TCTGACAGTTTGACAGTGAGGGG - Intergenic
1031972421 7:128074339-128074361 CGTGAGAGGCTGAAATTGAAGGG + Intronic
1032616935 7:133482943-133482965 TGTGACAGGCTGAGAGAGGAGGG - Intronic
1035866392 8:3087352-3087374 TGTGAGAGTCTATAAATGAATGG + Intronic
1038621628 8:29148981-29149003 TGTGACAAGCTCAGAGTGAAAGG + Intronic
1039032587 8:33326247-33326269 TGTGAGAGTCTGGGACTGAAAGG + Intergenic
1039876472 8:41590669-41590691 AGTGACAGTGTGAAAGTGGAAGG + Intronic
1040034653 8:42858732-42858754 TGTGACAGCCTTAAGGTGGAAGG + Intronic
1041431172 8:57782351-57782373 TGTTAGTGTCTGAAAGTGATGGG - Intergenic
1041755527 8:61309226-61309248 TGGTTCAGTTTGAAAGTGAAAGG + Intronic
1042651192 8:71043182-71043204 CCTGACACTCTGCAAGTGAATGG + Intergenic
1043317458 8:78939443-78939465 TATGCCAGTCTGAAATTCAACGG - Intergenic
1044093976 8:88039493-88039515 TGTGCCAGTTTGCAAGTTAAAGG + Exonic
1045282250 8:100759218-100759240 TGTTACAGTGTAAAAGTGAGTGG + Intergenic
1045763016 8:105632494-105632516 TCTGTCAGTCTGATAGTAAAAGG + Intronic
1046497074 8:115027823-115027845 AGTGAAACTCTGAATGTGAAAGG - Intergenic
1046567382 8:115918843-115918865 TGAGAAAGACTGAAAATGAAAGG + Intergenic
1048077155 8:131084135-131084157 GGTTACAGACTGAAAGAGAAAGG - Intergenic
1048524800 8:135192595-135192617 TGGGACAGGTTGGAAGTGAATGG - Intergenic
1048649146 8:136454779-136454801 TATTTCAGTCTGAAAGTGAAAGG - Intergenic
1049245142 8:141558412-141558434 AGTGTCAGTGTGAAACTGAAAGG - Intergenic
1049491814 8:142908207-142908229 TGTGCCACTCTGAAAATTAATGG + Intronic
1049607326 8:143535826-143535848 TGTGACACTCAGAAAGGGCAGGG + Intronic
1051944866 9:22555687-22555709 TCTCCAAGTCTGAAAGTGAAAGG + Intergenic
1052402210 9:28014733-28014755 TGTGACTGTCTGACCTTGAAGGG + Intronic
1052425117 9:28293924-28293946 TCTGACAGTCTGTAAATGAAAGG - Intronic
1055963700 9:81844741-81844763 TGTGAGAGACTGAAAGCCAAAGG + Intergenic
1059474028 9:114529546-114529568 TGTGACAGTCGAGAAGTGTAAGG + Intergenic
1059908553 9:119017081-119017103 AGTAACAGTTTGAAAGTGAAAGG + Intergenic
1060690916 9:125659387-125659409 TGTGAATGTCTGAGAATGAAAGG - Intronic
1062119023 9:134824164-134824186 TGTGGCCTTCTGGAAGTGAATGG + Intronic
1186933886 X:14425816-14425838 TGTAGCAATCTGAAACTGAAAGG - Intergenic
1189784144 X:44544007-44544029 TCTGACAGTATGCAAGTGATGGG - Intergenic
1190155676 X:47990438-47990460 GGTGACAGTTTGAGAGTTAATGG - Intronic
1192080912 X:68047031-68047053 AGAGAGAGTCTGAAAGTGCAAGG + Exonic
1192276953 X:69642144-69642166 TGTCACAGACTGAAAATGAGTGG + Intronic
1192356625 X:70410132-70410154 TTTGGCAGTCTGAAAGTACATGG + Intronic
1193624320 X:83797412-83797434 GGAAACAGACTGAAAGTGAACGG + Intergenic
1194881646 X:99259621-99259643 TGTGTGAGTCTTAATGTGAAAGG + Intergenic
1195916781 X:109943769-109943791 TCTGGGAGCCTGAAAGTGAATGG - Intergenic
1196972378 X:121123831-121123853 CGTGACATTATGAAAGTTAAAGG - Intergenic
1197145655 X:123169481-123169503 TGGGACACTTTGAGAGTGAAAGG - Intergenic
1198919883 X:141713556-141713578 CGGGACAGTCAGAAAGTGATTGG + Intergenic
1199667864 X:150115646-150115668 AGTGACAGTATGAAAGTCAGGGG - Intergenic
1199685125 X:150258695-150258717 TGTGCAAGTGTAAAAGTGAATGG - Intergenic