ID: 1163305038

View in Genome Browser
Species Human (GRCh38)
Location 19:16472340-16472362
Sequence GTCCCGACCCTCCGCGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163305038_1163305050 12 Left 1163305038 19:16472340-16472362 CCCACCCCGCGGAGGGTCGGGAC No data
Right 1163305050 19:16472375-16472397 CCGCAAAGCGCCCTGTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163305038 Original CRISPR GTCCCGACCCTCCGCGGGGT GGG (reversed) Intergenic