ID: 1163314971

View in Genome Browser
Species Human (GRCh38)
Location 19:16535540-16535562
Sequence GCCGGCGGGATGGGCGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 407}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163314956_1163314971 23 Left 1163314956 19:16535494-16535516 CCACTGGCTCTGCTGGATGAGCT 0: 1
1: 0
2: 0
3: 26
4: 217
Right 1163314971 19:16535540-16535562 GCCGGCGGGATGGGCGCGGCGGG 0: 1
1: 0
2: 6
3: 54
4: 407
1163314961_1163314971 -3 Left 1163314961 19:16535520-16535542 CCATGGATGGCGCGCCCTGGGCC 0: 1
1: 0
2: 1
3: 12
4: 168
Right 1163314971 19:16535540-16535562 GCCGGCGGGATGGGCGCGGCGGG 0: 1
1: 0
2: 6
3: 54
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163314971 Original CRISPR GCCGGCGGGATGGGCGCGGC GGG Exonic
900003579 1:29387-29409 GCGGGCGGACTGGGGGCGGCGGG - Intergenic
900151790 1:1182121-1182143 GCCAGCGGGAGGGGCCCGGGTGG + Intronic
900284046 1:1890839-1890861 GGCGGCGGTGTGGGCGCGTCAGG - Exonic
900284112 1:1891060-1891082 GCCATCGGGATGGGCGCGGCGGG + Exonic
900349264 1:2227257-2227279 GCCGGCGGGCGGGGCGGGGCCGG + Intergenic
900414697 1:2529581-2529603 GCGGGCGCGGCGGGCGCGGCCGG + Exonic
900502331 1:3012598-3012620 GGCGGCGGGGTGGGGGCGGTGGG - Intergenic
900599283 1:3496242-3496264 GCTGGCGGGGTGGGCGGGGGTGG - Intronic
900786768 1:4654653-4654675 GCGGGCGCGGTGGGCGCGGGCGG + Intergenic
901007701 1:6179847-6179869 GGCGGCGGGGGCGGCGCGGCCGG - Intronic
901019670 1:6249432-6249454 CCCGGGGGGCTGCGCGCGGCGGG - Exonic
901381857 1:8879312-8879334 CCCGGCCAGACGGGCGCGGCTGG - Intergenic
901526063 1:9824019-9824041 GGCGGCGGGAGGGGCGGGGATGG + Exonic
901843245 1:11966492-11966514 GGCGGCGGGATGGGAGTGGGGGG + Intronic
902337041 1:15759547-15759569 GCCCGGGGGCTGGGCTCGGCTGG - Intronic
903466392 1:23554972-23554994 GGCGCCGGGAGGGGCGGGGCGGG + Intergenic
903724661 1:25431379-25431401 CCGGGCGGGCAGGGCGCGGCGGG + Intronic
903897853 1:26620600-26620622 GCCGGGGGGAGGGGTGCGGAGGG - Intergenic
904033882 1:27549059-27549081 GCCGGCGCTGTGGGCGCTGCTGG + Exonic
904591413 1:31617621-31617643 GCCGGCGGGAGGGGCAGGGCGGG - Intergenic
904751080 1:32741803-32741825 GACGGCGGGAGCGGCGCGGGAGG - Intergenic
905174038 1:36125228-36125250 GGCGGCAGGAGGGGCGCGTCGGG + Intergenic
905374984 1:37514320-37514342 GCCGCGGGGGTGGGCGAGGCGGG - Intronic
905414377 1:37794375-37794397 GGCGGCGGGGGCGGCGCGGCAGG - Exonic
905515636 1:38559844-38559866 GCGAGCGGGAGGGGCGGGGCGGG + Intergenic
907197489 1:52698358-52698380 GCCGGCGGAGGGGGCGGGGCGGG + Exonic
907513808 1:54980823-54980845 GGCGGCGGAGAGGGCGCGGCTGG + Exonic
910277465 1:85464714-85464736 GCCGACTCGAGGGGCGCGGCCGG - Intronic
912568608 1:110606442-110606464 GCCGGCGGGATTGGGTCGGCAGG - Intronic
914293624 1:146298095-146298117 CCCGGCGGGGTGGCGGCGGCCGG + Intergenic
914554668 1:148748878-148748900 CCCGGCGGGGTGGCGGCGGCCGG + Intergenic
915141452 1:153771029-153771051 GGCGGTGGGGGGGGCGCGGCGGG - Intronic
915247660 1:154567975-154567997 GCCGGGGGGAGGGCCGCGGGTGG - Exonic
916588202 1:166166308-166166330 GCCGGCGTGACGGGCGCCCCCGG - Exonic
916782985 1:168056337-168056359 CTCGGCGGGCAGGGCGCGGCGGG + Intronic
918066400 1:181104991-181105013 GCCGGTGGGCTGGGGGCGGCAGG - Intergenic
920528588 1:206685604-206685626 GGCGGAGGGGTGGCCGCGGCGGG + Intronic
922250633 1:223845992-223846014 GCGGGCGGGGTCGGCGCGGGGGG - Intergenic
1062874216 10:931977-931999 GCGGGCGGGGCGGGCGGGGCGGG - Intergenic
1064418278 10:15168812-15168834 GCCGGCGGGCTGGGCGCGGACGG - Intergenic
1064418285 10:15168830-15168852 GCCGGCGGGCAGGGCGGGGCCGG - Intergenic
1065025494 10:21535464-21535486 GCCTGTGGGGTGGCCGCGGCAGG + Intronic
1069186538 10:65429676-65429698 GCCGGCGGGGCTGGCGGGGCAGG + Intergenic
1069456829 10:68560602-68560624 GCGGGCGCGAGGGGCGCGGGCGG - Intergenic
1072253692 10:93601121-93601143 GGCGGCGGGATGGGCCGGGGTGG - Intronic
1072731491 10:97849954-97849976 GCGGCGGGGATGGGGGCGGCCGG - Intergenic
1073099433 10:100999223-100999245 GCCCGCGTGTTGGGGGCGGCTGG + Intronic
1073106005 10:101032331-101032353 GCCCACCGGGTGGGCGCGGCCGG + Exonic
1076707018 10:132307750-132307772 GCCGGCGGGGCGCGCGCGGCCGG + Exonic
1076735855 10:132458642-132458664 GGCAGCGGGCTGGGCGCTGCGGG - Intergenic
1076868918 10:133183167-133183189 GCCAGCGGCGTGGGCGCGGGCGG + Intronic
1077093531 11:789988-790010 GCGGGCGGGGCGGGCGGGGCGGG - Intronic
1077226038 11:1439546-1439568 GCGGGGGGGATGGGCACAGCAGG + Intronic
1077293558 11:1813001-1813023 GCAGGCGCGATGGGTGAGGCGGG - Intergenic
1077332265 11:1988891-1988913 GCAAGCGGGAAGGGAGCGGCTGG - Intergenic
1077359859 11:2136096-2136118 GCCAGGGGGAGGGGCGGGGCTGG - Intronic
1077361206 11:2140826-2140848 GCGGAGGGGATCGGCGCGGCGGG + Intronic
1078057545 11:8019686-8019708 GGCGCCGGGAGGGGCGGGGCAGG + Intronic
1078175026 11:8964043-8964065 GCAGTCGGGAGGGGCGGGGCTGG + Intronic
1083340548 11:61955994-61956016 GGGGCCGAGATGGGCGCGGCAGG + Intronic
1083799990 11:65041196-65041218 GCCGGGGGGTGGGGAGCGGCGGG - Exonic
1083927608 11:65818042-65818064 GCCTGCGGGAGCCGCGCGGCCGG - Intergenic
1083945002 11:65918878-65918900 GGCGGCGGGAGGGGCAGGGCAGG - Intronic
1083992889 11:66257774-66257796 GCCGGCGGGATGGAGGCGGCGGG + Intronic
1084891227 11:72238066-72238088 GCCAGCGGGCTGGGCGAGGCAGG + Exonic
1084891743 11:72240128-72240150 GCCAGCGCCAAGGGCGCGGCGGG - Exonic
1084967546 11:72752415-72752437 CCCGGGGGGGTGGGCGCGCCCGG - Intronic
1088481076 11:110296733-110296755 GCCTGCGGGAGGGGCGGGGCGGG - Intergenic
1089402377 11:118171703-118171725 GCCGGCAGGACGGGGGCAGCCGG + Intronic
1089533951 11:119149480-119149502 GCCGGCGGGAGGGGCCGGCCTGG + Intronic
1202815248 11_KI270721v1_random:44067-44089 GCAAGCGGGAAGGGAGCGGCTGG - Intergenic
1092155380 12:6278750-6278772 GCCGGCGGCCAGGGCGCGGCCGG + Intergenic
1092230674 12:6773849-6773871 TCCAGCTGGATGAGCGCGGCCGG + Exonic
1096153903 12:49331328-49331350 GCCTGAGGGAGGGGCTCGGCTGG - Exonic
1096680408 12:53252050-53252072 GCGGGCGGGCGGGGCGGGGCGGG + Intronic
1096777430 12:53972878-53972900 GGCGGTGGGATGGGCGAGGGTGG - Intergenic
1096778503 12:53978461-53978483 GGGGGTGGGGTGGGCGCGGCGGG - Intergenic
1097246833 12:57611648-57611670 GCCGCCGGGCTGGGCGGGGAGGG - Intronic
1098312107 12:69158761-69158783 GGCGGCGGGGTGGGGGCGGCGGG - Intergenic
1098425842 12:70365734-70365756 GCTGGCGGCGTGGGCGCGGCTGG + Intergenic
1098683110 12:73382865-73382887 GCGGGCGGCATGGGGGGGGCGGG - Intergenic
1100309173 12:93378248-93378270 CCCGGCGGGGTGGCGGCGGCCGG + Exonic
1101782162 12:107845893-107845915 GCCGGCGGGATGCGGCTGGCGGG - Intergenic
1101870616 12:108562614-108562636 GCCGGCAAGATGGCGGCGGCTGG + Exonic
1102534389 12:113569877-113569899 CCCGGCGGGATGGAGGAGGCCGG + Intergenic
1102689253 12:114747608-114747630 GCCGGAGGAAGGGGCGAGGCAGG - Intergenic
1103407719 12:120687396-120687418 GCCGGCGTGGCCGGCGCGGCGGG + Exonic
1103509861 12:121467010-121467032 GCCGGCGGGGCGGCCGGGGCCGG - Intronic
1103764656 12:123271630-123271652 GCGGGCGCGCCGGGCGCGGCGGG + Exonic
1103764724 12:123271864-123271886 GCCGGCGGGGCGGCCGGGGCCGG + Exonic
1104748438 12:131223957-131223979 GCAGGCTGGATGTGGGCGGCAGG + Intergenic
1105011812 12:132761519-132761541 GCCGGCTCCAGGGGCGCGGCCGG + Intronic
1105805254 13:23948573-23948595 GGCTGCGGGAGGGGCGGGGCTGG - Intergenic
1107058494 13:36131180-36131202 CTCGCCGGGCTGGGCGCGGCCGG + Exonic
1110318445 13:74135067-74135089 GGCGGAGGGCCGGGCGCGGCAGG + Intergenic
1113582170 13:111437521-111437543 TCCGGCTGGATGGTCCCGGCAGG - Intergenic
1113737885 13:112690713-112690735 GCGGGCGGGAAGGGGGCGCCAGG - Intronic
1113794799 13:113050765-113050787 GGCGGGGGGAGGGGGGCGGCAGG + Intronic
1114538356 14:23437060-23437082 GCCTGGGGGATGGGTGCAGCAGG + Intergenic
1115028197 14:28766626-28766648 GCCGGCGGGCGGGGCGGGGGTGG + Intergenic
1117251835 14:53946793-53946815 GCCCGCGGGAGCCGCGCGGCAGG - Intergenic
1117424485 14:55580437-55580459 GCAGGCGGGAGGGCCGCGCCGGG + Intronic
1117899142 14:60515152-60515174 GCCGACGGGAAGGCAGCGGCGGG + Intronic
1118992374 14:70808797-70808819 GCCGCCGGGCTGGCAGCGGCTGG + Exonic
1119208488 14:72812248-72812270 GCCTGTGGGATGGGAGAGGCTGG - Intronic
1119290580 14:73491850-73491872 GGCGGCGGGCAGCGCGCGGCCGG - Exonic
1119539328 14:75428277-75428299 GGCGCCGGGACGGGCGGGGCGGG + Intronic
1121994670 14:98593002-98593024 GCCTCCGGGATGGGCGTGGGAGG - Intergenic
1122065955 14:99174722-99174744 TCGGACGGGATGAGCGCGGCGGG + Exonic
1122545031 14:102517287-102517309 CCCGGCGGGGCGGGCGAGGCAGG + Intergenic
1122736855 14:103848046-103848068 GCCAGTGGGAGGGGCGCGGGGGG + Intergenic
1122739024 14:103860070-103860092 GCCGGCGGGAAGGACAGGGCAGG - Intergenic
1122866120 14:104604761-104604783 GGCGGCGGGAAGGCCGCGGGAGG + Exonic
1124453655 15:29821869-29821891 GGCGGCGGGGTGGGCAGGGCTGG - Intronic
1124497594 15:30195979-30196001 TCCGGCGGGAAGGGCGTGGAAGG - Intergenic
1124628738 15:31325798-31325820 GCGGGCGGGTGGGGCGCGGTGGG + Intergenic
1124745995 15:32342712-32342734 TCCGGCGGGAAGGGCGTGGAAGG + Intergenic
1124973746 15:34514779-34514801 TACGGCGGGAGGGGCGCGGAAGG + Intergenic
1125685075 15:41559171-41559193 GGCGGCGGGAAGGGAGCGGGAGG - Exonic
1125689611 15:41585497-41585519 GCCGCGGGGAGGAGCGCGGCGGG + Intergenic
1126113265 15:45187683-45187705 GGCGGCGCGGGGGGCGCGGCCGG + Intronic
1126436762 15:48645318-48645340 GTCGGCGGGGACGGCGCGGCTGG - Intronic
1127982711 15:64046350-64046372 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1127982714 15:64046359-64046381 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1127982717 15:64046368-64046390 GCGGGCGCGGCGGGCGCGGCGGG + Intronic
1128109616 15:65068129-65068151 CCCGGCGGTGGGGGCGCGGCCGG - Intronic
1128582943 15:68821261-68821283 GCGAGGGGGAGGGGCGCGGCCGG + Intronic
1129483174 15:75843632-75843654 TCCGGCGGGAGGGGCGCGGAAGG - Exonic
1129519349 15:76176248-76176270 TCCGGCGGGGTGGGAGCAGCAGG - Intronic
1130270727 15:82445615-82445637 TCTGGCGGGAGGGGCGCGGAAGG - Intergenic
1130463072 15:84172938-84172960 TCTGGCGGGAGGGGCGCGGAAGG - Intronic
1130489603 15:84421850-84421872 TCTGGCGGGAGGGGCGCGGAAGG + Intergenic
1130501193 15:84500612-84500634 TCTGGCGGGAGGGGCGCGGAAGG + Intergenic
1130508713 15:84570713-84570735 TCTGGCGGGAGGGGCGCGGAAGG + Intergenic
1130531035 15:84748306-84748328 GGCGGCGGGTAGGGCGGGGCGGG - Intergenic
1130952750 15:88605323-88605345 GACGGCGGGCTTGGGGCGGCTGG - Intergenic
1131215200 15:90530244-90530266 GCGGGCGGGACCCGCGCGGCGGG + Intronic
1132128438 15:99251461-99251483 GACGGCGGGCGGGGCGGGGCAGG - Exonic
1132186620 15:99806716-99806738 TCCGGCGGGAGGGGCGCGGAAGG - Intergenic
1132365133 15:101251589-101251611 GGGGCCGCGATGGGCGCGGCGGG - Exonic
1132419387 15:101652387-101652409 GCCGGGGGGCGGGGCGCGCCTGG + Intronic
1132429067 15:101745995-101746017 TCCGGCGGGAGGGGCGCGGAAGG + Intergenic
1132484006 16:180911-180933 CCCGGCGGGGTGGGTGCGGGGGG + Intronic
1132586045 16:706087-706109 GCGGGCGGGGAGGGCGCGGGAGG + Intronic
1132699939 16:1218044-1218066 GCCAGAGGCATGGCCGCGGCGGG - Intronic
1132779417 16:1614459-1614481 GGCGGCGGCGTGGGGGCGGCAGG + Intronic
1132841086 16:1978844-1978866 GGGTGCGGGATGGGCGTGGCAGG - Exonic
1133021595 16:2969322-2969344 GCCAGGAGGACGGGCGCGGCCGG - Exonic
1133097683 16:3458315-3458337 GCCGGGGGCGCGGGCGCGGCCGG - Intronic
1133282998 16:4677589-4677611 GCCTGCGGGATGGGCGGGAGAGG + Intronic
1133784498 16:8963749-8963771 GCCGGCGGGAGCGGCGGAGCGGG + Intronic
1136627639 16:31471970-31471992 GCCGGCGGGCTGGGCTCGGGTGG + Intronic
1136913114 16:34159960-34159982 GTCGCGAGGATGGGCGCGGCAGG - Intergenic
1137531742 16:49282354-49282376 GCCGGCGCGCTGGGCGAGCCTGG + Intergenic
1140839197 16:78823280-78823302 GCTGGCGGGTTGGGGGCTGCAGG + Intronic
1141086027 16:81096193-81096215 CTCGGCGGGCAGGGCGCGGCGGG + Exonic
1141132331 16:81444892-81444914 GGCGCCGGGGTGGGGGCGGCGGG - Intergenic
1141608538 16:85169134-85169156 GCGGGCGGGAGGGGCGGGGAGGG - Intergenic
1141660132 16:85437054-85437076 GGCGGGGGCATGGGCGCAGCCGG + Intergenic
1141683355 16:85556574-85556596 GGCGGCGCGATGGGGGCGGCGGG - Intergenic
1141697069 16:85625174-85625196 GGCGGCGGGAAGGGCGGGACTGG - Intronic
1141886497 16:86895828-86895850 GACGGCGGGATGGGCACGGTGGG + Intergenic
1142136347 16:88453561-88453583 GCGGGCGGCGGGGGCGCGGCGGG - Exonic
1142343066 16:89536636-89536658 GCGGGCGAGGTGGGCGAGGCAGG + Intronic
1142509358 17:384815-384837 GCTGGCGGGGAGGGGGCGGCTGG + Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1142810248 17:2392797-2392819 GCAGCCGGGAGGGGCGGGGCCGG - Intronic
1143443807 17:6995827-6995849 GCCAACGGGGTGGGTGCGGCGGG - Intronic
1143625837 17:8109750-8109772 ACCGGCGGAGTGGGCGGGGCTGG + Intronic
1144695892 17:17303623-17303645 GCGGGCGGGCTGGGCCTGGCGGG + Exonic
1144724959 17:17497058-17497080 GCAGGCGGGTGGGGAGCGGCAGG + Intergenic
1146057619 17:29589219-29589241 GCCGGAGGGCTGGGCGGGGCGGG - Intronic
1146398741 17:32487566-32487588 GCCGGCAGGCTGGGCGCGCAGGG + Exonic
1147006385 17:37407076-37407098 GGCGGCGGGCTTGACGCGGCAGG + Intronic
1147006396 17:37407106-37407128 GCCGGCGGGCGGGCAGCGGCGGG + Intronic
1147684195 17:42276919-42276941 GCCGCCTGCATGGGCACGGCAGG + Intergenic
1148048691 17:44759004-44759026 CCCGCCGGGATGGCCGCGGCCGG + Intergenic
1148122764 17:45222289-45222311 GGGGGCGGCAGGGGCGCGGCAGG + Intronic
1148262238 17:46193549-46193571 GCCCGCGGGGGCGGCGCGGCGGG - Intronic
1148432084 17:47650456-47650478 CGCGGCGGGATGGGCGCGGCGGG - Intronic
1148437420 17:47694688-47694710 GCCAGCGGGGTGGGCGCAGAGGG + Intronic
1148807855 17:50273273-50273295 GGAGCCGGGAGGGGCGCGGCCGG - Intronic
1151155645 17:72121829-72121851 CCCGGCGGGGGCGGCGCGGCAGG + Intronic
1151582904 17:74990229-74990251 CCGGGAGGGATGGGCCCGGCAGG + Intronic
1151836507 17:76585906-76585928 CCCGGCGGGCAGGGCGGGGCAGG - Exonic
1152321019 17:79608942-79608964 GCCGGCGGGGTGGGGGCGTGGGG - Intergenic
1152433111 17:80260522-80260544 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433124 17:80260552-80260574 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433137 17:80260582-80260604 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433150 17:80260612-80260634 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433163 17:80260642-80260664 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433176 17:80260672-80260694 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433189 17:80260702-80260724 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433202 17:80260732-80260754 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433215 17:80260762-80260784 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152433228 17:80260792-80260814 GGCGGCGGGCAGGGCGGGGCCGG + Intergenic
1152544135 17:80992235-80992257 CCCGCCGGGGTGGGCGCGGCTGG + Intronic
1152697494 17:81804309-81804331 GACCGCGGGGCGGGCGCGGCGGG + Intronic
1155474798 18:26226941-26226963 GCCGGCGGGTTCGGTGAGGCCGG - Exonic
1155519774 18:26656698-26656720 GCCTGCGAGAAGGGGGCGGCGGG + Intronic
1156298993 18:35818517-35818539 GCCGGCGTAATGGCCGCGGCAGG + Intergenic
1159770504 18:72542201-72542223 GCCGGCGCGAGCGGCGCGGAAGG + Exonic
1160453346 18:78979753-78979775 GGCGGCGGGGGGGGCGCGGGCGG + Intergenic
1160635332 19:70994-71016 GCGGGCGGACTGGGGGCGGCGGG - Intergenic
1160680105 19:408494-408516 GCCGGCGGGGTGGGGGTGGAGGG + Intronic
1160765990 19:808299-808321 GACGGGGAGATGGGCGGGGCAGG + Intronic
1160788702 19:913058-913080 GCGGGCGGGCGGGGCGCGGCGGG - Intronic
1160832000 19:1108509-1108531 GGCGGCGGGAAGGCCTCGGCCGG + Exonic
1160858167 19:1226656-1226678 GCCTGCAGGTGGGGCGCGGCGGG + Exonic
1160864287 19:1250263-1250285 GCTGGGGGGCTGGGGGCGGCGGG - Exonic
1160873266 19:1286414-1286436 GCCGCCGGGATGCGGGCGCCCGG + Intronic
1160904585 19:1446245-1446267 GCCGAGGGGCGGGGCGCGGCGGG + Intergenic
1160930582 19:1567985-1568007 GGCGGCGGCGTGGGGGCGGCGGG - Exonic
1161045608 19:2132806-2132828 GGAGCCGGGATGGGCGCGGCTGG + Intronic
1161231954 19:3178890-3178912 GCCGGCTGGCCGGGCGCGGGGGG + Exonic
1161352820 19:3803397-3803419 GGCGGCGGGACGGGAGTGGCAGG - Intergenic
1161422265 19:4182414-4182436 GGCCGCGGGCTGGGAGCGGCCGG - Intronic
1161723855 19:5917532-5917554 GCCGGTGGGGTGGGGGCGGGTGG + Exonic
1161729057 19:5947743-5947765 GCCGGCGGGGTGGGGGCTGGTGG + Intronic
1161752927 19:6110552-6110574 GCGGGCGGGCTGCGCGAGGCTGG - Intronic
1161973401 19:7596180-7596202 GGCGGCGGGCCGGGCGCGGCAGG + Intronic
1162070395 19:8149233-8149255 CCCGGCGGGAGGGGCTCGGCCGG - Intronic
1162111853 19:8403809-8403831 GGCGGCAGGATGGACGGGGCTGG + Exonic
1162410723 19:10503367-10503389 GAGGGCGGAAAGGGCGCGGCGGG + Exonic
1162426870 19:10602414-10602436 CCCGGCGGGAGGGGCGGGGCCGG + Intergenic
1162481391 19:10928894-10928916 GCCGGGAGTGTGGGCGCGGCTGG + Exonic
1162818184 19:13208512-13208534 GGCGGCGGGGAGGGGGCGGCGGG + Intronic
1162914176 19:13865459-13865481 GCCGGGGGCACGGGCGGGGCGGG + Intronic
1163167620 19:15508695-15508717 GGCGGCGGGCGGGGCGCAGCCGG + Intronic
1163314971 19:16535540-16535562 GCCGGCGGGATGGGCGCGGCGGG + Exonic
1163334339 19:16661156-16661178 GGCGGCGGGACGGACGAGGCCGG + Exonic
1163477846 19:17537437-17537459 GCCGGCGGAAGGGGTGCTGCAGG - Exonic
1163583876 19:18153758-18153780 GGAGGCGGGAGGGGCGGGGCAGG - Intronic
1163720464 19:18896059-18896081 GCGGGCGGTATGGCGGCGGCGGG - Exonic
1164120553 19:22261746-22261768 GCGGGCGGGGCGGGCGGGGCGGG + Intergenic
1164120558 19:22261755-22261777 GCGGGCGGGGCGGGCGGGGCGGG + Intergenic
1164160488 19:22623093-22623115 GCGGGCGGGGCGGGCGGGGCTGG + Intergenic
1164985126 19:32642892-32642914 GCCAGCTGGATGGGAGCCGCTGG - Intronic
1165349991 19:35269983-35270005 ACCAGCGGGAAGGGCGCTGCAGG - Exonic
1166367393 19:42284441-42284463 GCCGGGGGGCGGGGCGGGGCCGG + Intronic
1166367434 19:42284548-42284570 GGCGGCCGGAGGGGGGCGGCGGG + Intronic
1167146306 19:47682191-47682213 GCGGGCAGGAGGGGCGAGGCTGG - Intronic
1167268281 19:48493971-48493993 GCCGGCGGGGCGGGAGCGCCGGG - Exonic
1167293693 19:48637554-48637576 GCCGGAGGGAGGCACGCGGCTGG - Intergenic
1167304103 19:48696903-48696925 GCCGGAGGGGTGTGCGGGGCCGG + Intronic
1167376302 19:49114222-49114244 GGCGGAGGGCAGGGCGCGGCTGG + Intergenic
1168315337 19:55482496-55482518 GGCGGCGGGACGGGGGCGGCAGG - Exonic
926101844 2:10122902-10122924 GCCCGCGGGGAGGGCGCTGCGGG + Intronic
926172213 2:10559465-10559487 GTTGGCGGGATGGGCGGGGAGGG - Intergenic
926247225 2:11130384-11130406 GCTGGCGGGAGGGGCAGGGCGGG + Intergenic
926250951 2:11155300-11155322 CCGGGCGGGAGGGGCGGGGCGGG + Intronic
926250968 2:11155329-11155351 CCGGGCGGGAGGGGCGGGGCGGG + Intronic
927957379 2:27217329-27217351 GGCGGCGTGAGGGGCGGGGCCGG - Intergenic
931649223 2:64453932-64453954 GCTGGAGGGAGGGGCGCGGGTGG + Intergenic
932496605 2:72148677-72148699 GCGGGCGGGAGGGGTGAGGCGGG + Intergenic
932607622 2:73175640-73175662 GCCGGCGGAAGGGGCCCGGCGGG + Intergenic
933808434 2:86017080-86017102 GCAAGCGGGCTGGGCGTGGCAGG - Intergenic
934031846 2:88055534-88055556 CCCGGCGGGCTGGGCGCGCGAGG + Intronic
934079021 2:88452174-88452196 GCGGGCGAGGCGGGCGCGGCGGG + Exonic
936038401 2:109129991-109130013 GGCGGCGGGGGCGGCGCGGCAGG + Exonic
937290213 2:120777511-120777533 GCGGCAGGGAGGGGCGCGGCAGG + Intronic
937340608 2:121088424-121088446 GCAGGGGTGATGAGCGCGGCCGG + Intergenic
937369002 2:121284987-121285009 GCCGGCGGGCCGGGCGCCGTTGG - Intronic
938301107 2:130213643-130213665 GCCGGAGGGGAGGGGGCGGCGGG + Intergenic
940639914 2:156334307-156334329 GCCGGCGAGCTGGGGGCAGCAGG - Intronic
940830176 2:158457408-158457430 GCCGGGGGGAGGGGAGCAGCAGG - Intronic
943182450 2:184560942-184560964 GCCAGCGTGATGGTAGCGGCTGG + Intergenic
943185192 2:184598379-184598401 GGCGGCGGGGTGGGCGGGGGAGG + Exonic
945955414 2:216081869-216081891 GCCGGCGGGCGGGGCGGGGCCGG - Exonic
946340043 2:219060791-219060813 GCCGCCGGGCTGGGCTGGGCTGG + Intergenic
947792467 2:232876116-232876138 GGCGGCGGTACGGGCGGGGCGGG + Exonic
948209155 2:236179535-236179557 GCCGCCGGGAGGGGTGGGGCGGG - Intergenic
948645421 2:239401055-239401077 GCCGGCTGGCTGGGCGGGGCCGG - Intronic
948958785 2:241315871-241315893 GCCTGCGCGCTGGGCGGGGCGGG + Exonic
1168769809 20:408037-408059 GCAGGCGGGGTGGGCGGGGCCGG - Exonic
1168804450 20:664214-664236 GGCGGCGGGGCGGGGGCGGCGGG - Exonic
1169194873 20:3677678-3677700 GCCGGAGGGACGGGGGCTGCTGG - Intronic
1169383299 20:5127158-5127180 AGCGTCGGGGTGGGCGCGGCCGG + Intronic
1172118572 20:32585024-32585046 GGCTGCTGGATGGGCGCGGGCGG + Intronic
1172354292 20:34268939-34268961 ACCGGAGGGGTGGGCGTGGCCGG + Intronic
1172848418 20:37944170-37944192 GGCGGCGGGGCGGGCGCGGCGGG - Exonic
1173865084 20:46308153-46308175 GCCGGCGGGAGCGGCCGGGCAGG - Intronic
1174330449 20:49813093-49813115 GAGGGCGGGATGGGCGGGCCTGG + Intronic
1175847218 20:62065325-62065347 GCCGGCGGGCTTGGCGGGGCCGG + Exonic
1176173786 20:63708235-63708257 GCCGGGCGGGGGGGCGCGGCCGG + Intronic
1176194469 20:63830976-63830998 GCCGGCGGCGGGGGCGCGCCCGG + Intronic
1176234829 20:64049362-64049384 GGCGGCGAGGCGGGCGCGGCGGG + Exonic
1176237970 20:64063098-64063120 GCGGGCGCGGCGGGCGCGGCAGG + Intronic
1176385949 21:6138603-6138625 GCCGGCGAGAGGGGGCCGGCGGG + Intergenic
1177010915 21:15729878-15729900 GCCGGCGGGCGGGGCTCTGCGGG + Intergenic
1178350974 21:31873153-31873175 GCCGGAGAGAAGCGCGCGGCGGG - Intergenic
1178680727 21:34670240-34670262 TCCGGCAGGAAGGGCGCGCCGGG + Exonic
1179737524 21:43399649-43399671 GCCGGCGAGAGGGGGCCGGCGGG - Intergenic
1179794834 21:43776618-43776640 GCCGGTGGGTTGGGCGCGCAGGG + Intergenic
1179810188 21:43865187-43865209 GGCGGCGGGATGGGGGCCGGGGG + Intronic
1180156387 21:45979418-45979440 GTCCGCGGGGTGGGTGCGGCGGG - Intergenic
1181283366 22:21735640-21735662 CCGGGCCGGATGGGCGCTGCGGG - Exonic
1182445461 22:30387151-30387173 GCCGGCGGCCGGGGCGGGGCGGG - Exonic
1183093998 22:35541322-35541344 GACGCCGGGCTGGGCGCGGCCGG - Exonic
1183427288 22:37746585-37746607 GCCTGCGGGAAGGGTGAGGCCGG - Intronic
1183520614 22:38294344-38294366 GCCGGCTGGATGCGGGAGGCTGG + Exonic
1183648535 22:39140688-39140710 GCAGGCGGGCTGGGAGAGGCAGG + Intronic
1183720179 22:39557887-39557909 GGCGGCGGGCGGGGGGCGGCGGG - Intergenic
1183744817 22:39686218-39686240 GGCGGCGGCGTGGGGGCGGCCGG - Exonic
1183942280 22:41302358-41302380 GCCCGCGGGAAGGGGGCGGCAGG + Intronic
1184230790 22:43157297-43157319 GCAGGAGGGAGGGGCGGGGCAGG + Intronic
1184276553 22:43412167-43412189 GGAGGCGGGCGGGGCGCGGCGGG + Intronic
1184663744 22:45977033-45977055 GCCGGGGGCCCGGGCGCGGCTGG + Exonic
1184757626 22:46525924-46525946 GCCGGCAGGAGGGGCGGTGCTGG - Intronic
1184759404 22:46536465-46536487 GCCGGCGCGACGGGCCCGGCGGG - Exonic
1184791560 22:46703453-46703475 GCCGCCTGGATGCGCACGGCCGG - Intronic
1185317408 22:50185089-50185111 CCGGGCAGGACGGGCGCGGCGGG + Intergenic
950902920 3:16513416-16513438 GGCGGCGGGGGGGGCGCGACAGG - Intronic
951558606 3:23945179-23945201 GCGGGAGGGAGGGGAGCGGCGGG + Intronic
952367234 3:32685510-32685532 GACGGCGGGACGTGCGGGGCCGG + Intronic
952942202 3:38453835-38453857 GCGGGCGGGCTGGGCGGGGAGGG - Exonic
953246685 3:41199755-41199777 GGCGGCGGGCTGGGCGCAGCCGG + Intronic
953657033 3:44862153-44862175 GCGGGCGGGCGGGGCGCCGCTGG + Intronic
954265945 3:49470406-49470428 GCCGGCGGGAGGACCGCGGCAGG - Exonic
954778931 3:53045541-53045563 GCCGGCTGCAGGGGCGCGCCTGG - Intronic
955699788 3:61671875-61671897 GGCGGCTGGATGGGCGGGGGGGG + Intronic
956678119 3:71753986-71754008 GCCTGCGGGAGCGGCGAGGCAGG + Intronic
958026816 3:88058974-88058996 GCAGGCGGACGGGGCGCGGCGGG - Intronic
962134738 3:132722153-132722175 CCCCGCGGGGTGGGCGCGGGCGG - Exonic
965087098 3:164113528-164113550 GCCTGCGGGATGGCAGCGTCAGG - Intergenic
965881708 3:173395824-173395846 ACCGGCGGGAGGGGCGCGCAGGG + Intergenic
966181887 3:177196530-177196552 GCCGGCGTGCTGGGGGCTGCGGG - Intronic
966696255 3:182793440-182793462 GCCGGGGGGCCGGGCGGGGCGGG + Intergenic
966881435 3:184353342-184353364 GCCGGCGGGCTGGGCTCAGCTGG + Exonic
966912943 3:184569401-184569423 GCCGGAGGGATGTGCGGAGCCGG - Intronic
968010438 3:195270850-195270872 GCGGGCGGCGAGGGCGCGGCGGG + Exonic
968083638 3:195864002-195864024 GCAGGAGGGATGGGCAGGGCAGG + Exonic
968433862 4:575301-575323 CCCGGCGCGGTCGGCGCGGCAGG - Intergenic
968659530 4:1793374-1793396 GCCGGCCGGAGGGACGGGGCGGG + Exonic
968815182 4:2818258-2818280 GCCGGCGGGAGGCGGGCGCCCGG + Exonic
969344728 4:6563625-6563647 GCGGGCGCGGCGGGCGCGGCGGG + Intergenic
971457960 4:26861384-26861406 GGCGGCGGGCGGGGCTCGGCCGG + Intronic
973774108 4:54230003-54230025 GGAGGCGGGCTGGGCTCGGCTGG + Intronic
974715897 4:65669227-65669249 TCCAGGGGGATGGGTGCGGCTGG - Intronic
976194933 4:82523218-82523240 GCCAGAGGGATGGGGGCGGGGGG + Intronic
981616346 4:146648206-146648228 GCCAGCGGGAGGGAGGCGGCGGG + Intergenic
982202956 4:152976296-152976318 GCCCTCGGAGTGGGCGCGGCAGG - Exonic
985512619 5:321089-321111 ACCGGCGGGGTGGGCGGGGCAGG + Intronic
985550107 5:528569-528591 GCGGGCGGGGCGGGCGGGGCGGG - Intergenic
985660859 5:1155918-1155940 GCCGGCGGGGCGGGCGCGGGAGG + Intergenic
985946812 5:3191741-3191763 ACCGGCTGGATGGGTGCTGCGGG + Intergenic
988935523 5:36078693-36078715 GCCTGCGTGATGGCAGCGGCAGG + Intergenic
988993054 5:36690170-36690192 GCCTGCGGGCTGGGCAGGGCCGG + Intergenic
990043383 5:51398997-51399019 GCCCGCGGGAGTGGCGGGGCTGG - Intergenic
992473192 5:77077526-77077548 GGCGGCGGGCAGGGCGCGGCAGG + Exonic
993905709 5:93621235-93621257 GCAGGCGGGAGGGGCGGGGAGGG - Intronic
998406269 5:141876366-141876388 GCCGGCGCGAGCGGCGCAGCGGG + Intronic
1001586003 5:172834308-172834330 GCCGGCGGGGGCGGGGCGGCCGG + Exonic
1002339923 5:178509168-178509190 GCCGGTGGGGTGGGCGGGGGTGG - Intronic
1002662789 5:180802899-180802921 GCCGGGGGGCGGGGCGCGGCGGG - Intronic
1002895653 6:1378696-1378718 GCCGGCGGGGGTGGCGCGGCCGG + Intergenic
1005987596 6:30884301-30884323 GCGCGCGGGGTGGGCGTGGCGGG + Intronic
1006634556 6:35452590-35452612 GCCGGCGCCCTGGGCGCAGCTGG + Exonic
1006860696 6:37170101-37170123 GCGCGCGGGGAGGGCGCGGCGGG - Intergenic
1006860702 6:37170114-37170136 GCCGGCGGGGAGGGCGCGCGGGG - Intergenic
1007072683 6:39048709-39048731 GCCCGCGGGAGGGGCCTGGCAGG - Intergenic
1007111136 6:39314048-39314070 GGCGTCGGCCTGGGCGCGGCGGG - Intronic
1007444524 6:41895038-41895060 GCCGGCGGGCTGGGGGCGCCCGG - Intronic
1007749463 6:44063137-44063159 GCCAGAGGGGTGGGGGCGGCAGG + Intergenic
1010752425 6:79630878-79630900 GCAGGCGGGATCGGCGAGCCGGG - Intergenic
1011640440 6:89412194-89412216 GCCGGCGGGCGGGGCGGGGGAGG - Exonic
1013576024 6:111483748-111483770 GGCGGCGGAACGGGCGGGGCCGG + Intergenic
1013793309 6:113859010-113859032 GCCTGCGGGCAGGGCCCGGCTGG + Intronic
1014001503 6:116370883-116370905 GGCGGAGGGAGGGACGCGGCGGG - Exonic
1014569898 6:122996345-122996367 GCCGGGGAGGTGGGCGCAGCGGG - Exonic
1016386756 6:143537069-143537091 GCCGGCGGGGCGGGCGCCTCGGG - Intronic
1017164197 6:151391719-151391741 GGCGGGGGGAGGGGAGCGGCTGG - Intergenic
1017842421 6:158232425-158232447 GCGGGCTTGGTGGGCGCGGCGGG + Intronic
1017920735 6:158869864-158869886 GCCGGCGCGACCGGCGGGGCGGG + Intergenic
1018046181 6:159968856-159968878 CTCGGCGGGCTGGGCGCGGCGGG - Intergenic
1018613211 6:165662675-165662697 GCCGGCGGGGGGAGCGCGGCGGG - Intronic
1018613283 6:165662843-165662865 GCGGGCGGGAGGGGCGCGGCGGG + Intronic
1018876523 6:167826859-167826881 GGCGGCGGGCGGGGCGCGGGCGG + Intergenic
1019343042 7:517518-517540 GCCGGCGGGGTCGGGGCCGCGGG - Intronic
1019482443 7:1273138-1273160 GCCGGCCGGATGGGCGGTGTGGG + Intergenic
1019530072 7:1498940-1498962 CCCGGGGGGGTGGGCGGGGCAGG - Intronic
1020204536 7:6104875-6104897 GCGGCCCGGAGGGGCGCGGCGGG + Exonic
1020238451 7:6374424-6374446 GCGGGCGGGAGCGGCGCGGGCGG + Intergenic
1020552286 7:9621703-9621725 GCCGGCGGGGCCGGCGGGGCGGG + Intergenic
1021451203 7:20785146-20785168 GCGGGCGAGGTGGGCTCGGCCGG - Exonic
1021452796 7:20798127-20798149 GCCGGAGGGTGGGGCGGGGCGGG - Intergenic
1021983669 7:26079116-26079138 GCGGGCGGTGTGGGCGCGTCGGG - Intergenic
1022410289 7:30134880-30134902 GCCGTGGGGGTTGGCGCGGCCGG - Exonic
1022739638 7:33109088-33109110 GCAGGGGGGCTGGGCCCGGCAGG - Intronic
1023745567 7:43319522-43319544 GCCGGCGGGTGGGGGGCGGGTGG - Intronic
1023995624 7:45157623-45157645 GTGGGAGGGATGGGGGCGGCTGG - Intergenic
1025778999 7:64582754-64582776 CTCGGCGGGCAGGGCGCGGCGGG - Intergenic
1025940937 7:66075867-66075889 GGCGGCCGGATGGGCGGGACGGG + Intronic
1028417469 7:90595953-90595975 GCGGCCGGGAGGGGCGCGGCCGG + Intronic
1028817029 7:95157587-95157609 GTCGGCGTGATGGCAGCGGCAGG + Intronic
1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG + Exonic
1029123244 7:98281895-98281917 GGCGGCGGCGGGGGCGCGGCGGG - Exonic
1029563777 7:101321535-101321557 CCAGTCGGGATGGGCGCGGTGGG + Intronic
1029737442 7:102472623-102472645 GCCCGCGGGATGGGGCGGGCAGG - Intronic
1032122857 7:129169304-129169326 GCAGGCGGGGCGGGCGCGTCCGG + Intronic
1032274582 7:130442952-130442974 GCCGGCGGGTGGGGAGCGGGGGG + Intergenic
1033477185 7:141702173-141702195 GCGGGCGCGAGGGGCGGGGCGGG + Intergenic
1034439813 7:151080899-151080921 GCCCGCGGGAAGTGCGCGCCCGG + Intergenic
1034911568 7:155002671-155002693 GACCGCGGGGTGGGCGCGGGAGG - Intronic
1035264692 7:157684597-157684619 GCCGGAGGGAGGGGGGCGGAGGG - Intronic
1035717030 8:1763290-1763312 GGCGGCGGCATGGGGGCGGTGGG - Intronic
1035717046 8:1763327-1763349 GCCGGCGGGAGGGGCGGGGCCGG - Intronic
1035717076 8:1763408-1763430 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717085 8:1763425-1763447 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717094 8:1763442-1763464 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717103 8:1763459-1763481 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717112 8:1763476-1763498 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717121 8:1763493-1763515 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717130 8:1763510-1763532 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717139 8:1763527-1763549 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717148 8:1763544-1763566 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717157 8:1763561-1763583 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717166 8:1763578-1763600 GGCGGGGGGCGGGGCGCGGCGGG - Intronic
1035717193 8:1763631-1763653 GGGCGCGGGAGGGGCGCGGCGGG - Intronic
1035981350 8:4375629-4375651 GGCTGTGGGATGGTCGCGGCTGG + Intronic
1037589932 8:20303920-20303942 GCTGGCGGGTTGGCAGCGGCCGG - Exonic
1037810023 8:22081519-22081541 CCCGGCGGGTTGGGAGGGGCAGG + Exonic
1037886831 8:22599852-22599874 GCCCGCGGGGTGCGCGGGGCTGG - Intronic
1038725967 8:30082918-30082940 GCCTGCGGGCCGGGAGCGGCCGG - Exonic
1039936582 8:42051600-42051622 GCCGGCGGGATCGGGGGCGCGGG + Intronic
1041693601 8:60714089-60714111 GCGGGCGGGGTGGGCCGGGCTGG + Intronic
1042859029 8:73294989-73295011 GCCGGCCGGCCGGGCGCTGCGGG + Exonic
1044719815 8:95134206-95134228 CCCGGCGCGAGGGGAGCGGCCGG - Intronic
1044988586 8:97775921-97775943 GCCGGCAGCAGCGGCGCGGCGGG + Exonic
1045111618 8:98942309-98942331 GCAGGCGGCCTAGGCGCGGCCGG + Intronic
1045432087 8:102123896-102123918 GCCGGCGGGATGGGGCGCGCTGG - Intronic
1046606255 8:116375086-116375108 GCGGGCATGATGGGCGGGGCTGG + Intergenic
1046871327 8:119208512-119208534 GGCGGCGGGAAGGACACGGCGGG - Exonic
1049253156 8:141599959-141599981 GCGGGCTGGATGGGATCGGCAGG + Intergenic
1049614153 8:143568997-143569019 GCAGGCGGGAGGGGCGGGGGCGG + Intronic
1049746898 8:144266786-144266808 GCCGGCGGGCCGGGGGCGGGGGG + Exonic
1049998374 9:1051713-1051735 GGCGGCGGGCTGGGCCCGGGGGG - Exonic
1052991765 9:34522851-34522873 GCCTGCGGGCGGGGGGCGGCGGG + Exonic
1053129122 9:35605432-35605454 GCCGGCTGGCTGGGCCCGGGTGG - Intronic
1055030640 9:71768977-71768999 GCCGGCGGGAGGGGCCGGGCGGG - Intronic
1055308389 9:74952998-74953020 GTAGGCGGGAAGGCCGCGGCGGG + Intergenic
1055611904 9:78032004-78032026 GCGGAGGGGATGGGCGCGGGAGG + Intergenic
1056732047 9:89174748-89174770 GCCTGCTGGAGGGGCGAGGCTGG - Intronic
1057449501 9:95144133-95144155 GAGGGGGGGCTGGGCGCGGCTGG + Intronic
1057781915 9:98056973-98056995 GGCGCCGGGAGGGGCGGGGCGGG + Intronic
1059061418 9:111038311-111038333 CCCGGCGGGGTGGGCGCAGGGGG - Intronic
1059405865 9:114098193-114098215 GCGGGCGGCAAGGGCGTGGCTGG + Intronic
1060376353 9:123118040-123118062 GCCGACAGGATGGGCTCTGCTGG - Intronic
1061050303 9:128191341-128191363 GCTGGCGGGGTGGGAGCGGGCGG - Intronic
1061365879 9:130172319-130172341 GCGGGCGGGAGGGGGGAGGCGGG + Intergenic
1061449471 9:130660617-130660639 GCCGGCGGGGCGGGCAGGGCGGG + Intergenic
1061584042 9:131554964-131554986 GCGGGCGGCGTGGGCGCGGCTGG - Intergenic
1062230676 9:135479981-135480003 GCAGGCGGGGTCCGCGCGGCGGG + Exonic
1062412730 9:136433123-136433145 GCTGGAGGGGTGGGCGCGGCTGG - Intronic
1062537830 9:137028559-137028581 GCCAGCGCGGTGGGCGCAGCCGG - Intronic
1062574545 9:137200179-137200201 GCGGGCGGGCTGGGGGCCGCGGG + Exonic
1188006676 X:25020680-25020702 CCTGGAGGGATGGGTGCGGCAGG - Intergenic
1189323274 X:40098460-40098482 GCCGAAGGGATGGGGGCGGCGGG + Intronic
1191085568 X:56563900-56563922 GGCCGCGGGAGGGGCGCGGGGGG - Exonic
1192724042 X:73729010-73729032 GCAGGGGGGATGGGGGCGGGTGG - Intergenic
1196734666 X:118973763-118973785 ACTGGCCGGATGGGCGCGGCAGG - Intergenic
1197754305 X:129983708-129983730 GCCGCCGGGCCGGGCGCGGCGGG + Intronic
1198398984 X:136251444-136251466 GCCGGTGGGCGGGGCGGGGCGGG + Exonic
1199772329 X:150983080-150983102 GCTGGCGAGGTGGGCGGGGCGGG + Intronic
1199861250 X:151801821-151801843 GCCAGCGTGATGGCAGCGGCAGG + Intergenic
1200099670 X:153684411-153684433 GCTGGTGGGAAGGGCGCGGGTGG + Intronic
1202368542 Y:24182767-24182789 GGCTGCCGGATGGGCGTGGCCGG - Intergenic
1202502243 Y:25487350-25487372 GGCTGCCGGATGGGCGTGGCCGG + Intergenic