ID: 1163321226

View in Genome Browser
Species Human (GRCh38)
Location 19:16576194-16576216
Sequence GGACCTCCCTGGTCTGACCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163321226_1163321233 -6 Left 1163321226 19:16576194-16576216 CCCGGGTCAGACCAGGGAGGTCC 0: 1
1: 0
2: 1
3: 22
4: 221
Right 1163321233 19:16576211-16576233 AGGTCCGTGGGCGGGCTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 92
1163321226_1163321238 29 Left 1163321226 19:16576194-16576216 CCCGGGTCAGACCAGGGAGGTCC 0: 1
1: 0
2: 1
3: 22
4: 221
Right 1163321238 19:16576246-16576268 CAGCTGCCTGGCCCCTTGCCGGG 0: 1
1: 2
2: 5
3: 130
4: 4058
1163321226_1163321237 28 Left 1163321226 19:16576194-16576216 CCCGGGTCAGACCAGGGAGGTCC 0: 1
1: 0
2: 1
3: 22
4: 221
Right 1163321237 19:16576245-16576267 GCAGCTGCCTGGCCCCTTGCCGG 0: 1
1: 0
2: 2
3: 33
4: 323
1163321226_1163321235 17 Left 1163321226 19:16576194-16576216 CCCGGGTCAGACCAGGGAGGTCC 0: 1
1: 0
2: 1
3: 22
4: 221
Right 1163321235 19:16576234-16576256 CACCAGCACATGCAGCTGCCTGG 0: 1
1: 0
2: 4
3: 20
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163321226 Original CRISPR GGACCTCCCTGGTCTGACCC GGG (reversed) Exonic
901490924 1:9595811-9595833 GGACCTCCATGCCCTGCCCCAGG - Intronic
902666093 1:17939569-17939591 GGACCTCCATGGTTTGATCCAGG + Intergenic
902693025 1:18122064-18122086 ATCCCTCCCTGGTCTGAGCCTGG + Intronic
902703485 1:18189059-18189081 GGGCCTCCCTGGCCTTTCCCTGG - Intronic
903326220 1:22570060-22570082 TGACCTCCCAGGTCTGCGCCAGG + Intronic
904274158 1:29369508-29369530 TGACCTCACTGCTCTGAGCCAGG - Intergenic
904322796 1:29707827-29707849 CGCCCTCTGTGGTCTGACCCAGG + Intergenic
904364448 1:30001599-30001621 TGACCTCACTGCTCTGAGCCAGG - Intergenic
904376561 1:30085701-30085723 TGCCCTCTGTGGTCTGACCCAGG - Intergenic
904423807 1:30410583-30410605 TGACCTCACTGCTCTGAGCCAGG + Intergenic
904480180 1:30788441-30788463 GGGCCTCGCAGGTCTGGCCCAGG - Intergenic
904490035 1:30852965-30852987 AGTCCTCCCTGATCTCACCCCGG - Intergenic
904679264 1:32217340-32217362 TGACCACCCAGATCTGACCCTGG - Exonic
912568512 1:110605965-110605987 GGGCCTCCCTGGGTTGATCCAGG + Intronic
913972248 1:143423990-143424012 CGGCCTGCCTGGGCTGACCCTGG - Intergenic
914066629 1:144249603-144249625 CGGCCTGCCTGGGCTGACCCTGG - Intergenic
914112524 1:144716751-144716773 CGGCCTGCCTGGGCTGACCCTGG + Intergenic
922003637 1:221505233-221505255 TGAGCTCCCTGCTCTGCCCCAGG - Intergenic
923760466 1:236838056-236838078 AGACATCCCTGATCTGACTCAGG - Intronic
924673034 1:246148073-246148095 GGCCCTCCCTGGTCTGAAGGAGG - Intronic
1062961452 10:1576127-1576149 GGACCCCCCTCTTGTGACCCTGG - Intronic
1065102079 10:22340958-22340980 GGGCCTCCCGGGGCGGACCCGGG - Intergenic
1068060619 10:52064056-52064078 GGCCCTCCCTGGTCTGAAGGTGG + Intronic
1075069873 10:119313731-119313753 GGAGCACTCTGGTGTGACCCAGG - Intronic
1076857100 10:133122747-133122769 GTGCCTCCCTGGCCTGGCCCTGG + Intronic
1077307610 11:1875042-1875064 CGGCCTCCCTGGGCTGACCCTGG + Intronic
1077557387 11:3232164-3232186 AGCCCTGCCTGCTCTGACCCTGG + Exonic
1079830079 11:25253780-25253802 GGACCTCCCTGGCCTTTCTCTGG + Intergenic
1081771987 11:45655831-45655853 GGGCCTCCCAGTTCTAACCCTGG + Intronic
1082750119 11:57006105-57006127 GGCCCTCCCTGGCCTGAACATGG + Intergenic
1083859412 11:65411933-65411955 GGGCCTCCCTGGATTGAACCGGG + Exonic
1084599496 11:70136439-70136461 GCACCTCCCTCGCCTCACCCTGG + Intronic
1084656166 11:70520267-70520289 TGACGTCCCTTGTCTGTCCCAGG + Intronic
1084732869 11:71084639-71084661 GGACCTCACTGGGCTGTGCCTGG - Intronic
1085392970 11:76191894-76191916 TCCCCTCCCTGGCCTGACCCGGG + Intronic
1088594150 11:111427429-111427451 GGACCGCTCTGATCTCACCCAGG + Intronic
1089975492 11:122728260-122728282 GGGCTTCCCTAGGCTGACCCTGG + Intronic
1090307029 11:125699939-125699961 TGACCCCACTGGTCTGCCCCAGG - Intergenic
1090486085 11:127113262-127113284 GGATCTCCTGGGTCTGACCTGGG + Intergenic
1091447669 12:553357-553379 GGCCCTCCCGGGGCTGAGCCAGG - Exonic
1093973184 12:25393085-25393107 GGACTTCCCAGGTCACACCCAGG - Intergenic
1096172018 12:49479269-49479291 GGTCCTCCCTGGCCTGACAGTGG + Intronic
1096256727 12:50066557-50066579 TGACTGCCCTGGTGTGACCCTGG - Intronic
1096558452 12:52418708-52418730 GGACAACCCTGTTCTGGCCCTGG + Intergenic
1099467504 12:83005599-83005621 GGATCTACGTGCTCTGACCCTGG + Intronic
1101086233 12:101239386-101239408 GGACCTCCCTGGTCTGAAGGTGG - Intergenic
1103561543 12:121795546-121795568 GCAACTCCATGATCTGACCCCGG - Intronic
1103884886 12:124192813-124192835 GGACCTCAAAGGTCTGACCATGG - Intronic
1104844193 12:131838658-131838680 AGACCTCCCTGTCCTGACCCAGG + Exonic
1105805311 13:23948743-23948765 ACTCCTCCCTGCTCTGACCCTGG - Intergenic
1114257783 14:21017604-21017626 AGACCTCCATGGTGTGCCCCGGG + Exonic
1122623585 14:103073247-103073269 CCACCTCCCTTGTCTGAGCCAGG + Intergenic
1122864050 14:104595567-104595589 GCCCCTCCCTGTCCTGACCCAGG + Intronic
1123450457 15:20356673-20356695 GGTCCTCCCTGGGCTCCCCCAGG - Intergenic
1124154045 15:27209636-27209658 GGGCCTCCCTGGTCTTATACAGG + Intronic
1124362435 15:29047564-29047586 GGGCCTCCCTGATCTCCCCCTGG + Intronic
1125278053 15:38014321-38014343 AAACCTCCCTGCTCTGACCCTGG + Intergenic
1129844502 15:78762052-78762074 GGACATCCCTGGTCTCACTGTGG + Intronic
1130257311 15:82331811-82331833 GGACATCCCTGGTCTCACTATGG - Intergenic
1131295322 15:91143095-91143117 GGACCCACCCGGTCTGTCCCTGG - Intronic
1132825808 16:1904668-1904690 GGAGCTCCCTGCACTGGCCCCGG + Intergenic
1133838714 16:9389118-9389140 GGTCCTGCATGGTCTGACCTTGG - Intergenic
1134250132 16:12568575-12568597 GGGTCTCCCGGGGCTGACCCCGG - Exonic
1135983338 16:27165825-27165847 GCACCTCCTTGGTCTCACCCTGG - Intergenic
1136316211 16:29455826-29455848 GGATCCCCCTGGTCTGGCTCAGG - Exonic
1136430788 16:30195168-30195190 GGATCCCCCTGGTCTGGCTCAGG - Exonic
1140419583 16:74807502-74807524 GGCCCTCCCTGGTCTGAAGGTGG + Intergenic
1140479010 16:75252539-75252561 GTGCCTCCCTGGCCTGGCCCAGG - Intronic
1142177216 16:88650815-88650837 GCACCCTCCTGGCCTGACCCCGG + Intronic
1144677871 17:17173427-17173449 GGGCCACCCTGCTCTGACCAAGG - Intronic
1144766587 17:17736289-17736311 GAGCCTCCCAGGTCTGACCTGGG - Intronic
1146143274 17:30388280-30388302 GGACCTCCCTGGCCTGAAGGTGG + Intronic
1146824228 17:36009335-36009357 GGTCCTTACTGGTCTGAACCAGG + Intergenic
1147657024 17:42096869-42096891 GGACCTCTCTGGGCTGCCCAGGG - Intergenic
1147999626 17:44380178-44380200 GGACCTCCCTGGCCAGCCTCCGG + Intronic
1149334609 17:55622620-55622642 GCACCTCACTTGCCTGACCCTGG - Intergenic
1150645251 17:66973811-66973833 GGCCCTCCCTGGCCTCTCCCTGG - Intronic
1151562542 17:74878282-74878304 GCCCCTCCCTGGCCTGGCCCTGG - Exonic
1151733822 17:75926537-75926559 AGACCTGCCTGGTCTGTCCACGG + Intronic
1152337985 17:79708664-79708686 GGTCCTCCCTGGGCTCCCCCAGG + Intergenic
1152374285 17:79911015-79911037 GGCTCTCCCTGGTCTGCCCGTGG + Intergenic
1152926090 17:83088410-83088432 GGACCTGCCTGGACTGTCTCGGG - Intronic
1157566301 18:48681141-48681163 GGAGGTCCCTGGGCTGACCCTGG - Intronic
1160192053 18:76722624-76722646 GGACGTCCTTGTCCTGACCCAGG - Intergenic
1160806314 19:993709-993731 GGTCCTTCCAGGTCTGGCCCAGG + Intronic
1161160834 19:2761146-2761168 TGACCTCCCTGGGCTCAGCCAGG + Intronic
1161867576 19:6844756-6844778 GAGCCTCCCTGGTCTCACCCTGG - Intronic
1162424410 19:10585731-10585753 GGTCCTCCCTGTTCAGACACTGG - Intronic
1163321223 19:16576188-16576210 TGACCTCCCGGGTCAGACCAGGG + Exonic
1163321226 19:16576194-16576216 GGACCTCCCTGGTCTGACCCGGG - Exonic
1163712224 19:18853643-18853665 GCACGTCCCTGGACTGACTCTGG + Intronic
1164230471 19:23283052-23283074 TGATCTCCCTGGTCTTGCCCAGG - Intergenic
1164245813 19:23427909-23427931 GGATCTCCCCAGTCTCACCCGGG - Intergenic
1164246844 19:23437779-23437801 TGACCTCCCTGGTCTTGCCCAGG + Intergenic
1164304653 19:23994872-23994894 TGACCTCCCTGGTCTCTCCCAGG - Intergenic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167713192 19:51124786-51124808 GGATCTCCCAGGGCTGACCCGGG + Intergenic
1168115538 19:54219919-54219941 TCACCTCCCTGTCCTGACCCAGG - Intronic
1168118530 19:54239663-54239685 TCACCTCCCTGTCCTGACCCAGG - Intronic
1168454551 19:56496297-56496319 GGACTTCCCAGGTCAGACACTGG + Intergenic
1202647834 1_KI270706v1_random:157909-157931 TGGCGTCCCTGGTTTGACCCTGG + Intergenic
1202648673 1_KI270706v1_random:161881-161903 GGTCCTCCCTGGTCTCTCTCAGG - Intergenic
925315730 2:2921645-2921667 GGACCTTCCTTCTCTGTCCCAGG - Intergenic
925712754 2:6757789-6757811 GGACCTCACTTCTCTGTCCCTGG + Intergenic
927406961 2:22781541-22781563 GGAGCTCCCTGGTTTGATCACGG + Intergenic
930013937 2:46958027-46958049 GAACCTCCATGCTCTGACTCTGG + Intronic
932571514 2:72940843-72940865 GGACCTCCCTTCTCTCACTCAGG - Intergenic
932751729 2:74375566-74375588 GCCCCAGCCTGGTCTGACCCTGG - Intronic
933709245 2:85313713-85313735 CGACCCCCCTGCTCTGCCCCTGG - Intergenic
933713661 2:85345104-85345126 CGACCTCCCTGCTCTGCCCCTGG + Intronic
934176940 2:89584927-89584949 CGGCCTGCCTGGGCTGACCCTGG - Intergenic
934287247 2:91659287-91659309 CGGCCTGCCTGGGCTGACCCTGG - Intergenic
934818854 2:97354670-97354692 GGGCTGCCCTGGTCTGACCTGGG + Intergenic
935226431 2:101056975-101056997 GGGCCTGCCTGGCCTGAGCCTGG - Intronic
936030653 2:109067867-109067889 CGACCACCCTGTTCTGACCCTGG + Intergenic
938092769 2:128444197-128444219 GGACCTCGCTGGGCTGTTCCTGG + Intergenic
942150935 2:173075722-173075744 GGGCCTCCCTGGCCTGCGCCCGG - Intronic
944686460 2:202122125-202122147 GGCTTTCCCTGGTCTGGCCCTGG - Intronic
945720695 2:213415292-213415314 GGAACTCCATGGCCTGGCCCAGG - Intronic
946188767 2:217996272-217996294 TGACCTCCCAGGTCTGTCCTAGG - Intronic
946245877 2:218387122-218387144 GGACCAGGCTGGGCTGACCCGGG + Intronic
948304068 2:236933698-236933720 GGACCCCCGAGGTCTGATCCCGG + Intergenic
1173426299 20:42946337-42946359 GGACCTCCCAGGACTGGCCAGGG - Intronic
1174420213 20:50394569-50394591 GGTCCTCACTGGTCTCACACGGG - Intergenic
1175295218 20:57903746-57903768 GCTCCTGCCTGGTCTGTCCCAGG + Intergenic
1175610589 20:60347922-60347944 GGACCTCTCAGGTCTTACCCTGG - Intergenic
1175798801 20:61789114-61789136 GGACCTCCCTGGTACCAACCCGG + Intronic
1175947121 20:62564154-62564176 GGGCCTTCGTGGCCTGACCCTGG - Intronic
1175949813 20:62577372-62577394 GGAACTCCCTGGTCTGAAAATGG + Intergenic
1176603180 21:8810807-8810829 GGTCCTCCCTGGTCTCTCTCAGG + Intergenic
1176604017 21:8814820-8814842 TGGCGTCCCTGGTTTGACCCTGG - Intergenic
1178364223 21:31975180-31975202 GGACTTGCCTGGCCTGACTCTGG + Intronic
1179510025 21:41866472-41866494 GGACCACCCTGGTCTGGCTTTGG + Intronic
1179788340 21:43741820-43741842 GGACCTCCCTGAGCCCACCCTGG - Intronic
1180046874 21:45310636-45310658 GGACTTACCTGGGCTGACCTGGG - Intergenic
1180345466 22:11702364-11702386 GGTCCTCCCTGGTCTCTCTCAGG + Intergenic
1180346301 22:11706397-11706419 TGGCGTCCCTGGTTTGACCCTGG - Intergenic
1180352253 22:11814948-11814970 GGTCCTCCCTGGTCTCTCTCAGG - Intergenic
1180354072 22:11824554-11824576 TGGCGTCCCTGGTTTGACCCTGG - Intergenic
1180384173 22:12167771-12167793 TGGCGTCCCTGGTTTGACCCTGG + Intergenic
1180385955 22:12177118-12177140 GGTCCTCCCTGGTCTCTCTCAGG + Intergenic
1181031540 22:20150640-20150662 GGAGCCCCCTGGTTCGACCCTGG + Exonic
1181116838 22:20636681-20636703 GGTGCTCCCTTGTCTGACCAGGG - Intergenic
1181431120 22:22882475-22882497 GGCCCTCCCTGTGCTCACCCTGG + Intronic
1181511853 22:23392885-23392907 GGAGCCCCCTGGTTCGACCCTGG - Intergenic
1183732593 22:39627175-39627197 GGACCTCTCTCCTTTGACCCTGG - Intronic
1184173858 22:42774951-42774973 GGCCCTCCCTGGTCTGAAAGTGG - Intergenic
1184388393 22:44189058-44189080 GGTGCTCTCTGGTCTGTCCCCGG + Intronic
1184703839 22:46196608-46196630 GGCCTTCCCTGGCCTCACCCCGG + Intronic
950186009 3:10945903-10945925 TGACCTCACTGGCCTGAGCCAGG - Intergenic
950475173 3:13210397-13210419 GCACCTCCCTGGGCTGCCCAGGG + Intergenic
953664862 3:44918298-44918320 GGACCTCCCGGGGGTGACCTGGG - Intronic
953884698 3:46708623-46708645 GGACATCCCTGGGCTCTCCCTGG - Intronic
954123892 3:48517455-48517477 GGTCTTCCCTGGGCTGACCTGGG - Intergenic
954130777 3:48559725-48559747 GAACCTGGCTGGCCTGACCCTGG + Intronic
958294931 3:91891506-91891528 GGGCCTCCCTGGTCTCTCTCAGG + Intergenic
965542045 3:169880259-169880281 GGCCCTCCCTGGCCTGAACATGG - Intergenic
968149755 3:196327702-196327724 GGCTCTCATTGGTCTGACCCTGG - Intronic
968516348 4:1017189-1017211 GGAATTCTCTGGCCTGACCCAGG - Intronic
968538683 4:1151195-1151217 GGACCTCCCTGGCCTGAAGGTGG + Intergenic
968576238 4:1367558-1367580 GGCCCTCCCTGGGCGGCCCCAGG - Intronic
969638234 4:8381821-8381843 GGACAGCCCTGGGCTGAGCCAGG - Intronic
973374100 4:49276098-49276120 TGGCGTCCCTGGTTTGACCCTGG + Intergenic
973374895 4:49279844-49279866 GGTCCTCCCTGGTCTCTCTCAGG - Intergenic
973376698 4:49291885-49291907 GGTCCTCCCTGGTCTCTCTCAGG - Intergenic
973377618 4:49298037-49298059 GGTCCTCCCTGGTCTCTCTCAGG - Intergenic
973378538 4:49304173-49304195 GGTCCTCCCTGGTCTCTCTCAGG - Intergenic
973380523 4:49317330-49317352 GGTCCTCCCTGGTCTCTCTCAGG + Intergenic
973382516 4:49330397-49330419 GGTCCTCCCTGGTCTCTCTCAGG + Intergenic
973383312 4:49334141-49334163 TGGCGTCCCTGGTTTGACCCTGG - Intergenic
973386920 4:49519156-49519178 TGGCGTCCCTGGTTTGACCCTGG - Intergenic
974278488 4:59759230-59759252 GGACCTCCCTGGCCTGAAGATGG + Intergenic
979145353 4:117239901-117239923 GGCCCTCCCTGGTCTGAAGATGG - Intergenic
980112701 4:128649747-128649769 GCACTTCCCTGGTCTGACACAGG - Intergenic
981243477 4:142506871-142506893 GGATCTCCCTTCTCTGCCCCTGG - Intronic
984102127 4:175499376-175499398 GGCCCTCCCTGGTCTGAAGGTGG + Intergenic
985723447 5:1502590-1502612 GGACCTCCATCCTCAGACCCTGG - Intronic
985723755 5:1504848-1504870 GAAGTTCCCCGGTCTGACCCTGG + Intronic
989513680 5:42317660-42317682 AGCCATGCCTGGTCTGACCCAGG + Intergenic
991702887 5:69332645-69332667 CCACCTGCCAGGTCTGACCCCGG + Exonic
992088186 5:73296839-73296861 GGACCTCCCTGGGATGACCTTGG - Intergenic
996185155 5:120465104-120465126 TGCCCTCCCTGATCTGGCCCAGG - Intronic
996234467 5:121108769-121108791 GGTGCTCCCTGGTCTGAGGCAGG + Intergenic
1000022436 5:157329914-157329936 GGCCCTACCTGGTTTGGCCCTGG + Intronic
1001483326 5:172103202-172103224 TCACCTCCCTGCTCTGATCCCGG + Intronic
1002386514 5:178871182-178871204 AGACCTACATGGTCTGGCCCTGG + Intronic
1003405177 6:5822006-5822028 TGAGCTCTCTGCTCTGACCCAGG + Intergenic
1005637055 6:27762556-27762578 GGACTGCCTTGGACTGACCCTGG + Intergenic
1005941266 6:30561995-30562017 GGACCCCCATGGCCTGGCCCCGG - Exonic
1008355623 6:50549175-50549197 AGACTTCCCTGGTCTGTCCCTGG + Intergenic
1013375504 6:109510086-109510108 GGCCCTCCCTGGCCTGAAGCTGG - Intronic
1015228638 6:130887526-130887548 GGCCCTGCATGATCTGACCCAGG + Intronic
1017978046 6:159375244-159375266 TGACCTCCCTGCCCTGCCCCGGG + Intergenic
1019472418 7:1227979-1228001 GGCCCTTCCTGGCCTGCCCCGGG + Intergenic
1019573825 7:1726617-1726639 GGCCCTCCCTGGACAGAGCCTGG - Intronic
1020437255 7:8178004-8178026 GGACCTTCATGATCTGGCCCTGG + Intronic
1020568048 7:9822528-9822550 GGACCTCCCTGGCCTGAAGGTGG + Intergenic
1022141836 7:27499601-27499623 GGACCTGCCTGCTCTGGCCGTGG + Intergenic
1022628805 7:32065954-32065976 GGACCTCCAGGAGCTGACCCAGG + Intronic
1024284819 7:47747944-47747966 GGCCCTCTGTGATCTGACCCTGG + Intronic
1024525765 7:50347956-50347978 GGGCCTCCCTGGTATGAGTCGGG - Intronic
1024563835 7:50665646-50665668 TCACCTCCCTGGTCCCACCCAGG - Intronic
1028022202 7:85791234-85791256 GGACCTGCCAAGTCTGACACAGG - Intergenic
1029360973 7:100088597-100088619 GGCCCTGCCTGATCTGGCCCCGG - Intergenic
1030514075 7:110519446-110519468 GGACCTCCCTGGACTGAAGGTGG + Intergenic
1031973017 7:128077369-128077391 TGACCTGCCTGGTCTGTGCCTGG + Intronic
1033314391 7:140285550-140285572 GGCCCTTCCTGATCTGCCCCAGG - Intergenic
1034490934 7:151392686-151392708 GGACCTCCCAGGCCTGTCACAGG + Intronic
1037753734 8:21698482-21698504 GAGCCTCGCTGGTCTGGCCCAGG + Intronic
1040339493 8:46433286-46433308 GAACCTCCCAGGGCTGTCCCTGG + Intergenic
1041956203 8:63559910-63559932 GGACCTGTCTGTTCTCACCCAGG + Intergenic
1042254444 8:66788733-66788755 GGATTTCCCTGGTCTGACCCAGG - Intronic
1043724581 8:83594021-83594043 GGACTTACCTTGGCTGACCCAGG - Intergenic
1044371594 8:91418665-91418687 GGACCTCCCTGGTGTAACCTAGG - Intergenic
1045583396 8:103501463-103501485 GGTGCTCCCTGGACGGACCCGGG + Intronic
1048449695 8:134522686-134522708 AGCCCTCCTTGCTCTGACCCTGG + Intronic
1049751148 8:144284883-144284905 GGACCTGCCTGGGTGGACCCAGG - Intronic
1051484903 9:17597801-17597823 GGGCCTGCCTGATCTGACCCTGG + Intronic
1052707552 9:32011099-32011121 GGCCCTCCCTGGTCTGAAGGTGG - Intergenic
1056848264 9:90058886-90058908 TGACCTCTCTGGGCTAACCCGGG - Intergenic
1058773655 9:108263708-108263730 GGACATCCCTCTTCTCACCCTGG - Intergenic
1059257603 9:112945480-112945502 AGACCTCTCTGGTCTCATCCAGG - Intergenic
1060404844 9:123368127-123368149 GGAGCTCCCTGGGCTCACCGGGG - Intronic
1060979795 9:127785622-127785644 GGAGCTCCCTGGCCGGACCCGGG - Intergenic
1061231220 9:129316939-129316961 GGCCTTCCCTGCCCTGACCCTGG + Intergenic
1061590749 9:131596147-131596169 GGCTCTCCCTGCTCTGACTCAGG + Intronic
1062112926 9:134791972-134791994 GGACCTTCTGGGTCAGACCCTGG - Intronic
1062161836 9:135084835-135084857 GGACCTCACTGTTCTGACTGTGG + Intronic
1062250848 9:135592788-135592810 GGACCTCCTGGGTCTCAGCCTGG + Intergenic
1203480220 Un_GL000224v1:4986-5008 GGTCCTCCCTGGTCTGTCTCAGG - Intergenic
1203481187 Un_GL000224v1:11314-11336 GGTCCTCCCTGGTCTCTCTCAGG - Intergenic
1203482151 Un_GL000224v1:17623-17645 GGTCCTCCCTGGTCTGTCTCAGG - Intergenic
1203548713 Un_KI270743v1:151343-151365 GGTCCTCCCTGGTCTCTCTCAGG - Intergenic
1203549704 Un_KI270743v1:157062-157084 GGTCCTCCCTGGTCTCTCTCAGG + Intergenic
1203550647 Un_KI270743v1:163227-163249 GGTCCTCCCTGGTCTCTCTCAGG + Intergenic
1203551427 Un_KI270743v1:166976-166998 TGGCATCCCTGGTGTGACCCTGG - Intergenic
1203568177 Un_KI270744v1:109094-109116 GGTCCTCCCTGGTCTCTCTCAGG - Intergenic
1186546721 X:10457702-10457724 GAAACTCCCTGGTGTGGCCCAGG + Intronic
1189318855 X:40075108-40075130 GGACCGCACTGGCCTGATCCGGG - Exonic
1190444887 X:50514698-50514720 GGCCCTCCCTGGTCTGAGGGTGG + Intergenic
1191252246 X:58265238-58265260 AGTCCTCCCTGGGATGACCCAGG - Intergenic
1191788837 X:64946335-64946357 GGACCTCCCTGTTCTAGCCAAGG - Intronic
1191846281 X:65550295-65550317 GGTCCTCCCTGGATTGAACCCGG - Intergenic
1199818279 X:151419633-151419655 GGACAGCCCTGTTCTGACCTAGG - Intergenic
1200047104 X:153408985-153409007 GGACCTCCCTGCTGGGCCCCTGG + Intergenic