ID: 1163329679

View in Genome Browser
Species Human (GRCh38)
Location 19:16628332-16628354
Sequence GCGCGCTTGCGCGGAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163329679_1163329690 27 Left 1163329679 19:16628332-16628354 CCCGCGCCTCCGCGCAAGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 116
Right 1163329690 19:16628382-16628404 CCCGCCCAGCCGCCCGGCCTAGG 0: 1
1: 0
2: 18
3: 875
4: 6461
1163329679_1163329687 21 Left 1163329679 19:16628332-16628354 CCCGCGCCTCCGCGCAAGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 116
Right 1163329687 19:16628376-16628398 TGACGCCCCGCCCAGCCGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163329679 Original CRISPR GCGCGCTTGCGCGGAGGCGC GGG (reversed) Intronic