ID: 1163329679

View in Genome Browser
Species Human (GRCh38)
Location 19:16628332-16628354
Sequence GCGCGCTTGCGCGGAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163329679_1163329690 27 Left 1163329679 19:16628332-16628354 CCCGCGCCTCCGCGCAAGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 116
Right 1163329690 19:16628382-16628404 CCCGCCCAGCCGCCCGGCCTAGG 0: 1
1: 0
2: 18
3: 875
4: 6461
1163329679_1163329687 21 Left 1163329679 19:16628332-16628354 CCCGCGCCTCCGCGCAAGCGCGC 0: 1
1: 0
2: 1
3: 14
4: 116
Right 1163329687 19:16628376-16628398 TGACGCCCCGCCCAGCCGCCCGG 0: 1
1: 0
2: 1
3: 15
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163329679 Original CRISPR GCGCGCTTGCGCGGAGGCGC GGG (reversed) Intronic
900096000 1:940352-940374 GGCCGCTAGCGCGGGGGCGCTGG + Intronic
900190162 1:1349772-1349794 GCGGGCGTGCACGGAGGCGTCGG + Intergenic
900475894 1:2876181-2876203 GCCAGCTTGCGCGGAGGTGCGGG - Intergenic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
904004903 1:27358503-27358525 GGGCGCTGGCTCGGAGGCGGGGG + Exonic
908714444 1:67054400-67054422 GCGTGCTCGTGCGCAGGCGCAGG - Intergenic
910597174 1:88992712-88992734 GCGCGCTTTGGCGGAGGGGTAGG + Exonic
914710988 1:150213629-150213651 CTGCGCATGCGCGGGGGCGCAGG - Intergenic
917141633 1:171841457-171841479 GCGCGCCTGCGCGGGCGGGCAGG - Intergenic
921930192 1:220748542-220748564 GCGGGCCAGCGCGGAGGAGCTGG - Exonic
921934856 1:220786955-220786977 GCGCGCCAGCGCGGAGGAGCCGG - Exonic
923782926 1:237042180-237042202 GCGCACTTGCTCGGAGGAGCCGG + Intergenic
1064086530 10:12349762-12349784 GCGCGCTGGGGAGGGGGCGCCGG - Exonic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1073450035 10:103603669-103603691 GCGTGCTTGTGCGGCGGCTCAGG + Exonic
1077034025 11:486279-486301 GCGCGCATGCGGGGAGGGGTCGG + Intronic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1078180295 11:9004737-9004759 GTGCGCTCCCGCGGAGGCGGGGG - Intergenic
1082787420 11:57324632-57324654 GCGCGTGTGCGCGGAGGCGGAGG - Intronic
1083419760 11:62546212-62546234 TCGCGGAGGCGCGGAGGCGCTGG + Intronic
1084128972 11:67119070-67119092 GCGCGCACGCGCGGATGCGTCGG - Intergenic
1092462533 12:8698512-8698534 GCGCGTGTGCCGGGAGGCGCCGG + Intronic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1100963133 12:99984930-99984952 GCGGGCTGGCGGGGAGGGGCCGG + Intergenic
1103954091 12:124567109-124567131 GCCCGCGTGCTCGGGGGCGCCGG - Intronic
1104697077 12:130871940-130871962 GCGTGCGTGCGCGCACGCGCGGG + Exonic
1110443373 13:75549748-75549770 GCGCGCGTGGGCGGAAGCGGCGG + Intronic
1111397016 13:87677336-87677358 GCGAGCTTGGGCGCAGGCGGAGG + Exonic
1113082873 13:106535728-106535750 GCGCGCGGCCGCGGAGCCGCGGG - Intergenic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1117875927 14:60249719-60249741 GCGGGCCTGCGCGGCGGCGGCGG + Intronic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1127867251 15:63042756-63042778 GCGCGGTCGGGCGGAGGAGCGGG - Exonic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1137272762 16:46913130-46913152 GCGGGCATGCTCTGAGGCGCTGG + Intronic
1139467110 16:67159900-67159922 CCGGGTGTGCGCGGAGGCGCTGG + Exonic
1140504646 16:75463986-75464008 GAGCGCCTGCGCGGAGGGGCCGG + Intronic
1141972434 16:87492717-87492739 GCCGGCCTGGGCGGAGGCGCGGG - Intergenic
1142209783 16:88803620-88803642 GCGCGCATGCGCCGACGTGCGGG - Exonic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143183488 17:4997900-4997922 GCGAGCGCGCGCGGAGGGGCGGG - Intergenic
1143562809 17:7705428-7705450 GCGCTCTGCCGCGGGGGCGCGGG + Exonic
1143565427 17:7717658-7717680 GGGCGCCTGCGCGGAGGAGGCGG + Exonic
1144107274 17:11997404-11997426 GCGCGCTTGCGGGGCGGTCCCGG - Intronic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1150265130 17:63827426-63827448 GCGCGCAAGCGCGGAAGCGGAGG - Exonic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1153805215 18:8705060-8705082 GCGCCCTTGGGAGCAGGCGCAGG - Intergenic
1160204503 18:76822283-76822305 GGGCGCATGCGCGGCGCCGCGGG - Exonic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160765559 19:806068-806090 GCGCGCATGCGCGGTGGTCCCGG + Intronic
1160831283 19:1105908-1105930 GGGCGGTTGCGGGGAGGTGCTGG + Intronic
1160930569 19:1567943-1567965 GCGCCCTCGGGCGGGGGCGCAGG + Exonic
1160961869 19:1725724-1725746 GGGCGCATGCGCGGGGCCGCGGG + Intergenic
1161290584 19:3491662-3491684 GCACGAGTGCGCGGAGGCCCTGG - Exonic
1161643074 19:5436368-5436390 GCGCGCGTGCGGGGAGGGGAGGG + Intergenic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1162795972 19:13087907-13087929 GCGAGCTGGCGCGGCCGCGCAGG + Intronic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG + Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1168696761 19:58408242-58408264 GCGGGCTTCTGCGGAGGCCCTGG + Intronic
924987692 2:287357-287379 GCGCGCGTGAGCTGCGGCGCGGG - Intronic
925730598 2:6917517-6917539 GCGCGGGCGCGGGGAGGCGCGGG + Exonic
928143540 2:28751677-28751699 GTGCGGTTGCGCGGCGGCCCAGG + Intronic
936279176 2:111122737-111122759 GCGGGCTGGCGGGAAGGCGCGGG + Intronic
937262687 2:120596492-120596514 GCGGGGTTGCGTGGAGGTGCTGG + Intergenic
937950876 2:127387511-127387533 CCGCGCTGGGGCGGAGGGGCGGG - Intronic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
938895050 2:135741788-135741810 GCGCGCTTGTGCGGAGCCGGAGG + Exonic
941021039 2:160407967-160407989 GCGGGCGGGCGGGGAGGCGCGGG - Intronic
948115882 2:235494159-235494181 GCGGGCTCGCGCGGGGGCCCCGG + Exonic
948895680 2:240925846-240925868 GCGAGCTGGAGCTGAGGCGCTGG + Exonic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1172083231 20:32358705-32358727 GCGGGCTGGGGCGGTGGCGCGGG - Exonic
1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG + Intronic
1175715818 20:61253405-61253427 GCGCCCCTGGGCGGAGGCGGAGG + Intronic
1178417110 21:32412823-32412845 GCGCGGCGGGGCGGAGGCGCAGG - Exonic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
961603179 3:128076204-128076226 GCGCTCTGGCGCGGAGGAGGGGG + Intronic
962301959 3:134250884-134250906 GCGCGCTCCCGGGGAGGCGGCGG - Intergenic
964227798 3:154428061-154428083 GCGCGCATGGGCGGAGGTGAGGG - Intronic
968010531 3:195271198-195271220 GCGCCGGTGCGCGGAGGGGCGGG + Intergenic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
972686854 4:41360597-41360619 GGGAGCGAGCGCGGAGGCGCCGG - Intronic
975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG + Intronic
976733278 4:88284841-88284863 GCGCGCTTGCGCGGTGGGTGGGG + Intergenic
982616151 4:157637978-157638000 GCGCGGCTGCGCTGCGGCGCGGG - Intergenic
983649843 4:170026682-170026704 CCGCGCTGCCGCGGAGGCCCTGG - Intronic
986747911 5:10760736-10760758 GTGCGATTGCGCGCAGGCTCCGG - Intronic
992067478 5:73120778-73120800 CCGCGGCAGCGCGGAGGCGCTGG + Intronic
992473145 5:77077372-77077394 GCGCCCTGGAGCGGAGGCGGAGG - Exonic
992663679 5:78985208-78985230 GCGAGCTTGCCCCGAGGCCCCGG - Exonic
995342299 5:111073208-111073230 GAGCCCGAGCGCGGAGGCGCCGG - Intronic
999328278 5:150656764-150656786 GAGCGCATGCGCGGGGGCGGGGG - Intronic
1001065045 5:168529517-168529539 GCGAGCTCGCGCGGGGGCGGTGG + Exonic
1003086262 6:3063826-3063848 GCGCGTTCGCGCGGCGGCGGAGG - Intergenic
1006271991 6:32972088-32972110 GCGCGCGCGCGCGGAGGGGGTGG + Exonic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1009964789 6:70566907-70566929 TTGCGCCTGCGCGGAGGCTCGGG + Exonic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1029238834 7:99144158-99144180 GCGCGCACGCACGCAGGCGCGGG - Intergenic
1031846038 7:126806817-126806839 GCGCGGTTCCGGGTAGGCGCGGG - Intronic
1033197501 7:139340396-139340418 GCCCGCTTTTGCGCAGGCGCGGG + Intronic
1033595332 7:142854924-142854946 GCGCGCCGGGGCGGAGGAGCGGG + Intergenic
1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG + Intergenic
1038540502 8:28386333-28386355 GTGCGGGGGCGCGGAGGCGCGGG - Intronic
1038727591 8:30095360-30095382 TCGGGCTCGCGCGGGGGCGCGGG - Intergenic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1049844288 8:144792537-144792559 GTGCGCCTGCGCGGGGGCCCTGG - Exonic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1057466371 9:95317730-95317752 GCGCGCTCCCGCGGCGTCGCGGG + Intergenic
1057490458 9:95516244-95516266 GCGAGCGAGCGTGGAGGCGCGGG + Intronic
1059119726 9:111631289-111631311 GTGCGCCTGCGCGGAGGCGTCGG + Intergenic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1061293637 9:129665950-129665972 GCGCGCCTGGGCGCAGTCGCCGG - Exonic
1061859353 9:133460213-133460235 GAGCGCATGCGCGGCGGGGCCGG - Intronic
1062579248 9:137222234-137222256 GCGCTCTGCGGCGGAGGCGCGGG + Intergenic
1203792627 EBV:159939-159961 GGGGGCCTGCGAGGAGGCGCTGG - Intergenic
1187648324 X:21374143-21374165 GTGCGCGTGCGCGGCGGCGGAGG - Intergenic
1189325186 X:40107406-40107428 GCGCGCTTGGGTGGGGGCGGGGG - Intronic
1190789263 X:53684001-53684023 GCGGGATCGCGCGGAGGCGGCGG - Exonic
1197870506 X:131058679-131058701 GAGCGCGTGGGCGGAGTCGCTGG + Intronic
1200059021 X:153475894-153475916 GCGGGGTTGCGAGGAGGAGCGGG - Intronic
1200138512 X:153886185-153886207 GCGGGCGTGCGCGCAGGGGCGGG + Intronic