ID: 1163331343

View in Genome Browser
Species Human (GRCh38)
Location 19:16640188-16640210
Sequence CAGCTACTTGGAAGGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3715
Summary {0: 2, 1: 67, 2: 539, 3: 1126, 4: 1981}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163331343_1163331349 6 Left 1163331343 19:16640188-16640210 CCTGTCAGCCTTCCAAGTAGCTG 0: 2
1: 67
2: 539
3: 1126
4: 1981
Right 1163331349 19:16640217-16640239 CAGGTACGTGCCACCACGCCTGG 0: 54
1: 2300
2: 21564
3: 85083
4: 181636

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163331343 Original CRISPR CAGCTACTTGGAAGGCTGAC AGG (reversed) Intronic
Too many off-targets to display for this crispr