ID: 1163332242

View in Genome Browser
Species Human (GRCh38)
Location 19:16647256-16647278
Sequence AACAGCCTGGAGAAGTCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163332235_1163332242 22 Left 1163332235 19:16647211-16647233 CCGGGAAAGTGAGTTCCTGGTTT 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1163332242 19:16647256-16647278 AACAGCCTGGAGAAGTCAGAGGG 0: 1
1: 0
2: 4
3: 27
4: 314
1163332238_1163332242 7 Left 1163332238 19:16647226-16647248 CCTGGTTTCATCGCTGGGATTCA 0: 1
1: 0
2: 0
3: 14
4: 96
Right 1163332242 19:16647256-16647278 AACAGCCTGGAGAAGTCAGAGGG 0: 1
1: 0
2: 4
3: 27
4: 314
1163332234_1163332242 23 Left 1163332234 19:16647210-16647232 CCCGGGAAAGTGAGTTCCTGGTT 0: 1
1: 0
2: 1
3: 16
4: 201
Right 1163332242 19:16647256-16647278 AACAGCCTGGAGAAGTCAGAGGG 0: 1
1: 0
2: 4
3: 27
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163332242 Original CRISPR AACAGCCTGGAGAAGTCAGA GGG Exonic
900612990 1:3552262-3552284 CACAGCCTGGAGCAGGGAGAAGG - Intronic
900824217 1:4913393-4913415 GCCAGCCTGGAGATGTTAGAGGG + Intergenic
901379933 1:8866278-8866300 AACATCCTGGAGAATAAAGAAGG - Exonic
901648037 1:10727139-10727161 AACAGCCTGGAGAAGGAAGAGGG + Intronic
904406998 1:30297928-30297950 ACAGGCCTGGAGAATTCAGAAGG - Intergenic
905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG + Intronic
906142032 1:43539645-43539667 CACAGGCTGGAAAGGTCAGATGG + Intronic
907743065 1:57185602-57185624 AACAGCCTTGAGAAGTAAAAAGG + Intronic
908023502 1:59923009-59923031 AACTCCCTGCAGGAGTCAGAGGG + Intronic
908824638 1:68121590-68121612 GACAGCCTGCAGAAGTCAGATGG + Intronic
914322476 1:146578432-146578454 AACAGCCAGTAGAAGGCAAAGGG - Intergenic
914784610 1:150817141-150817163 AAGCCCCTTGAGAAGTCAGATGG - Exonic
914807327 1:151001272-151001294 AAGCCCCAGGAGAAGTCAGAGGG - Exonic
915341477 1:155179003-155179025 AAGCGCCTGAAGAAGGCAGAAGG - Intronic
915689499 1:157674850-157674872 AACAGTTTGGAGGACTCAGAAGG + Intronic
916066126 1:161137144-161137166 AACAGCCTGTAGAAGGTTGAAGG + Intergenic
916668192 1:166986754-166986776 AACAGCCTGAAGTAGAAAGAAGG + Intronic
916844606 1:168636909-168636931 AACAGGGTGGAGAAGCCAGGGGG + Intergenic
917867302 1:179209338-179209360 GACAGCGTGTAGAAGTCTGATGG - Intronic
917871023 1:179241885-179241907 ATCAGCCTGGGGAACTGAGACGG - Intergenic
920038088 1:203078314-203078336 AGCACCCTGAAGGAGTCAGATGG - Exonic
920102286 1:203524907-203524929 AACAGCCTGGAGCAAACAGAGGG - Intergenic
921830729 1:219724819-219724841 AACAGCCTGGAGAGGTGCGGTGG + Intronic
922972163 1:229751745-229751767 CAAAGCCTGGAGAAGGCAGAGGG - Intergenic
923238465 1:232057666-232057688 AAGAGGCTGGAGAAGGCAGTAGG + Intergenic
923694540 1:236234596-236234618 AACTGCCTGGAGAAGGAAGTTGG - Intronic
923723081 1:236483810-236483832 AACATCCTGGAGAATAAAGAAGG + Intronic
923812190 1:237330959-237330981 AACACCGTGGAGAAATCAGAAGG + Exonic
1064165271 10:12980342-12980364 AACAGCATGGGGAAGACAGGAGG + Intronic
1064977456 10:21133473-21133495 CACAGCCTGTAGAATTAAGATGG - Intronic
1065129204 10:22603387-22603409 AACAGCCCTGGGAAGTCAAACGG - Intronic
1065902949 10:30224435-30224457 AACTGCCTGGAGAAGTCAAAAGG - Intergenic
1067482945 10:46617149-46617171 ACCAGCCTTGTGGAGTCAGAGGG + Intergenic
1068524102 10:58107723-58107745 CACAGCCTAGAGACTTCAGAGGG + Intergenic
1069543797 10:69315139-69315161 AACAGCCTGGTGAGGTTAGAAGG - Intronic
1069772377 10:70907924-70907946 AGGAGCCTGGGGAGGTCAGATGG - Intergenic
1070044905 10:72823435-72823457 AACAGACAGGAGAGGTCAGCTGG + Intronic
1072780490 10:98247905-98247927 AAGACCGTGGAGAAATCAGAAGG - Exonic
1072807982 10:98437077-98437099 AATAGTCTGGAGAAGTTAAATGG - Intronic
1072880262 10:99219831-99219853 AACAGACTAAAGAAGGCAGAAGG - Intronic
1073108008 10:101043613-101043635 AACGACCTGGAGAAGGCAGGAGG + Intergenic
1074551248 10:114444403-114444425 AAGAGCCAGGAGACCTCAGAAGG + Intronic
1075377846 10:121993828-121993850 AACAGCCTGGGCAACACAGAGGG - Intronic
1075708501 10:124517700-124517722 GAGAGCCTGGAGACGACAGAGGG + Intronic
1077199481 11:1298362-1298384 AGCAGCATGGAGAAGCCAGTCGG + Intronic
1078079950 11:8196847-8196869 TAAAGCCAGGAGAAGTCTGAAGG - Intergenic
1078108945 11:8376391-8376413 CAAAGCCAGGAGAAGGCAGACGG + Intergenic
1079116055 11:17641190-17641212 AACCCCCAGGACAAGTCAGAGGG + Intronic
1079776268 11:24533200-24533222 AACAACCTGGCAAAGCCAGAGGG - Intronic
1079777308 11:24548132-24548154 AGCAGCCTGGAGATTTCACAAGG + Intronic
1080043886 11:27788220-27788242 AATAGACTGGAGAAATCAGAAGG + Intergenic
1080360779 11:31510353-31510375 AGCTGCCTGGAGAAAGCAGAAGG - Intronic
1080562010 11:33472653-33472675 CTCAGACTGGAGAAGTCAGTAGG + Intergenic
1080773409 11:35363497-35363519 GACAGCCTGGAGAGATCTGAAGG - Intronic
1081108391 11:39100970-39100992 AACAGTTTGGAGGATTCAGAAGG - Intergenic
1083059673 11:59856719-59856741 AACAGGCTGGAGAAGGAAGTTGG + Intronic
1083066835 11:59932278-59932300 GACAGCAGGGAGAAGCCAGATGG + Intergenic
1085353774 11:75817215-75817237 AACACCCTGGAGAAGTCCTAAGG + Intronic
1085370912 11:76004374-76004396 AACCGCATGTAGAAGACAGAAGG - Intronic
1085403703 11:76249402-76249424 AACAGGCTGGAGAGGTTTGAGGG + Intergenic
1085745632 11:79112037-79112059 AAGAGGCTGCAGAAGTCAGCTGG + Intronic
1086169890 11:83824245-83824267 CTCAGCCTGGGGAAGTAAGAAGG - Intronic
1086464364 11:87038016-87038038 AACAGCGCGGAGAAGACAGGAGG - Exonic
1087716343 11:101613099-101613121 AACAGCATGGAGGAGGCAAAAGG - Intronic
1088316387 11:108511049-108511071 CACAGCCTAGGGAAGGCAGAGGG - Exonic
1088448955 11:109962215-109962237 AACAGTCTGGAGAACACCGATGG + Intergenic
1088815054 11:113415065-113415087 AAGAGGATGGAGGAGTCAGAGGG + Intronic
1089750285 11:120646888-120646910 AACAGCCTGGTGAAGTAGGCAGG + Intronic
1089976815 11:122739529-122739551 AACAGCATGGAGCTGTCAGGAGG - Intronic
1090490598 11:127157338-127157360 GTCAGCCAGGAGAAGGCAGAAGG + Intergenic
1092601454 12:10070797-10070819 AACGGCATGGACAAGGCAGATGG + Exonic
1094625985 12:32124736-32124758 AACAGCCTGTAGAAGAGGGAAGG + Intronic
1095292680 12:40493390-40493412 ATAAGCCCAGAGAAGTCAGAAGG + Intronic
1095594338 12:43941495-43941517 AACTGCCTGAGGATGTCAGATGG - Intronic
1098627711 12:72693130-72693152 AACAGACTGGAGATGCCAGTGGG - Intergenic
1100651536 12:96595203-96595225 AACAGCCTTGAAAAGGCAAAGGG - Intronic
1100801930 12:98241178-98241200 AGCAGCCTGAAAGAGTCAGATGG + Intergenic
1103154041 12:118667950-118667972 AGCAGCAGGGACAAGTCAGAGGG - Intergenic
1104661820 12:130616827-130616849 CACAGGAAGGAGAAGTCAGAGGG + Intronic
1104811832 12:131624059-131624081 ACCTGCTTGGAGAAGTCAGTCGG - Intergenic
1104928323 12:132325157-132325179 AACAGCCTGGAGACTCCAGCAGG - Intronic
1105235013 13:18542645-18542667 TACAGCCTGAAGAACCCAGATGG - Intergenic
1106290575 13:28357450-28357472 AACAGACTGGAGCAGGCAGCAGG + Intronic
1106418909 13:29569339-29569361 CACAGCCTGGAGTAGTGAGGGGG - Intronic
1107466811 13:40658633-40658655 AACCAACTGGAGAAGCCAGATGG + Intronic
1108246801 13:48524224-48524246 AATAGCCTGGTGAAATCACATGG - Intronic
1109127994 13:58542779-58542801 CACAGCCTGTAGCATTCAGAGGG - Intergenic
1110177479 13:72574217-72574239 AAGAGCCAGAAGAAGTAAGATGG - Intergenic
1111163894 13:84432306-84432328 AACAGAGTGGGGAAATCAGAGGG - Intergenic
1112474974 13:99723168-99723190 ACCAGCCTGGGAAAGTCACACGG - Intronic
1113483306 13:110637284-110637306 AACAGCTTAGAAAAATCAGACGG - Intronic
1114444941 14:22781241-22781263 CACTGCCAGGAGAACTCAGAGGG - Intronic
1114556736 14:23566553-23566575 AACAGCATCAAGAAGTGAGAGGG - Exonic
1114632251 14:24166651-24166673 AAGAGGCTGGAGATGTCAGCAGG - Exonic
1114657344 14:24324048-24324070 ACCAGCCTGGTGAGGACAGAGGG - Exonic
1115045313 14:28985483-28985505 AACACACTGGAGAGATCAGAAGG - Intergenic
1116490783 14:45500552-45500574 AACAACCTGGTGAAGACAGGTGG - Intergenic
1117106524 14:52402692-52402714 AAAAGCCTGGAGAAGTATTAAGG + Intergenic
1120325698 14:83022869-83022891 AACAGCCTGGAGATTTAAGGGGG - Intergenic
1121641132 14:95485613-95485635 GACAGCCTGGTGAGGGCAGAGGG - Intergenic
1121951130 14:98171971-98171993 AACAGCCCAGAGAAGTCACTTGG + Intergenic
1123027863 14:105436970-105436992 AAAAGCCTGCAGAAGTGACAGGG - Intronic
1202873543 14_GL000225v1_random:187812-187834 ATCAGGCTAGAGAAGTCTGAAGG + Intergenic
1125421430 15:39508604-39508626 AAGAGACAGGAGACGTCAGAGGG - Intergenic
1126110983 15:45174599-45174621 AAGAGCCTGGAGTAGGGAGAGGG - Intronic
1126426492 15:48532245-48532267 CACAGACTGGACAAGTCATAAGG + Intronic
1126544433 15:49857301-49857323 CAAGGCCTGGAGAAGTCAGGTGG + Intergenic
1126566048 15:50100287-50100309 ATCAGCCTGGAGTTGTCAGAGGG - Intronic
1127903661 15:63359989-63360011 CAAAGCCTGGAGAAGTGAGTGGG - Intronic
1129392285 15:75226433-75226455 CACACCCTGGGGAAGGCAGAGGG - Intergenic
1129872317 15:78948408-78948430 GAGAGGTTGGAGAAGTCAGAGGG + Intronic
1129943510 15:79519113-79519135 AACATCATGGAGAAATGAGAGGG - Intergenic
1130608756 15:85341470-85341492 TGCAGCTTGGAGAATTCAGATGG - Intergenic
1133162406 16:3920714-3920736 AACTGCCTGCAGAAGGAAGAGGG - Intergenic
1133915410 16:10105158-10105180 AGAAGCCTGGGGAAGCCAGAAGG + Intronic
1135485395 16:22860487-22860509 AATAAACTGCAGAAGTCAGATGG - Intronic
1136484233 16:30561075-30561097 AACAGCCCTGAGAAGCCACAAGG - Intergenic
1137409286 16:48214260-48214282 AACACCCCCGAGAAGTCTGAGGG - Intronic
1137867738 16:51918240-51918262 AAAATCCTGGAGCAATCAGAAGG - Intergenic
1139619068 16:68122504-68122526 AGCCACCAGGAGAAGTCAGAGGG - Exonic
1139646982 16:68338575-68338597 CACAGCCTGGGGAAGGCAGCGGG + Intronic
1139682066 16:68572857-68572879 AACTGTCTGGAGATTTCAGAAGG + Intronic
1140011146 16:71132737-71132759 AACAGCCAGTAGAAGGCAAAGGG + Intronic
1140926244 16:79587005-79587027 AGCAGCCTAGAGAATTCAGCAGG - Intronic
1141259829 16:82442401-82442423 AACAACCCTAAGAAGTCAGATGG - Intergenic
1143497561 17:7321191-7321213 ACGAGACTGGAGGAGTCAGAAGG - Exonic
1143622057 17:8086378-8086400 CCCAAGCTGGAGAAGTCAGAAGG - Intronic
1144004232 17:11085710-11085732 CACAGCCTGGCACAGTCAGAAGG - Intergenic
1144580980 17:16459409-16459431 AAGAGGCTGGAGCAGTCAAAGGG + Intronic
1144621124 17:16819125-16819147 AACAGCCTGGAGGAGACCAAAGG - Intergenic
1144623048 17:16830578-16830600 AACAGCCTGGAGGAGACCAAAGG - Intergenic
1144706677 17:17373136-17373158 AACAGCCTGGAGAAGGGTGGAGG - Intergenic
1144890422 17:18491084-18491106 AGGACCCTGGAGAAGACAGATGG - Intronic
1145141794 17:20453234-20453256 AGAACCCTGGAGAAGACAGATGG + Intronic
1145794116 17:27645656-27645678 AGAACCCTGGAGAAGACAGATGG - Intronic
1145808918 17:27753197-27753219 AGAACCCTGGAGAAGACAGATGG - Intergenic
1147573102 17:41583418-41583440 AACAGCCTGGAGGAGACCAAAGG - Exonic
1147577371 17:41610514-41610536 AACAGCCTGGAGGAGACCAAAGG - Exonic
1148475682 17:47927182-47927204 AATAGACTGGAGAGGTCAAATGG + Intronic
1152229449 17:79107136-79107158 AACTGCCTTGAGATGTCAGTGGG - Intronic
1152319562 17:79600902-79600924 TGCAGCCTGGAGAAGTCCGCTGG + Intergenic
1153146276 18:2036430-2036452 AACAGCCTGGAGAAGGTACGGGG - Intergenic
1154046808 18:10913703-10913725 AACAGGCAGGACAAGTCAAAAGG + Intronic
1154174850 18:12079306-12079328 AACAGGCAGGACAAGTCAAAAGG - Intergenic
1154514532 18:15147361-15147383 TACAGCCTGAAGAACCCAGATGG + Intergenic
1157663143 18:49463244-49463266 AACTGCCTGCAGAAGTATGATGG + Intergenic
1157671795 18:49536470-49536492 AACAGGCTGGAGAGGAAAGAGGG - Intergenic
1160976399 19:1794802-1794824 ACCAGGCTGGAGAGGTCAGCAGG + Intronic
1163332242 19:16647256-16647278 AACAGCCTGGAGAAGTCAGAGGG + Exonic
1163621500 19:18363533-18363555 GACCTCCTGGAGCAGTCAGAGGG + Exonic
1163843173 19:19624041-19624063 CACTGCCTGGGGGAGTCAGATGG - Exonic
1164043516 19:21513317-21513339 AAAATCCAGGAGAAGTCAAATGG - Intronic
1164455054 19:28400055-28400077 CACAGCCTGGAGCAGATAGATGG - Intergenic
1164483102 19:28631283-28631305 AACAGAGTTGAGAAGCCAGAGGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165351300 19:35277439-35277461 CACAGCCCAGAGAAGCCAGAGGG + Intronic
1165944110 19:39431258-39431280 GACAGCCTGGAGGAGTCAGGTGG - Intergenic
1166406628 19:42526428-42526450 CTCAGCCTGGAGAGGACAGATGG - Intronic
1167278282 19:48552055-48552077 AACAGCGGGGAGAGGCCAGAGGG - Exonic
926569479 2:14513691-14513713 AACAACTGGGAGAAGGCAGAAGG + Intergenic
927330364 2:21855434-21855456 CAAAGGCTGGAGAAATCAGAAGG - Intergenic
928586101 2:32760213-32760235 AAAAGCCTGGAGAAGAGAGTAGG + Intronic
929014047 2:37476300-37476322 AGCAGTCAGGAGAAGGCAGAGGG + Intergenic
931573058 2:63690133-63690155 AACAGACTGGAAGAGACAGATGG - Intronic
931999820 2:67874555-67874577 AACAGCCTGCAGAAGTAACTTGG - Intergenic
933408489 2:81894039-81894061 AAAAGCCTGTAGAGGTCATAGGG + Intergenic
933567081 2:83963181-83963203 AAAATCCTAAAGAAGTCAGAGGG - Intergenic
933817249 2:86077962-86077984 AAGATCCTGGAGAAGAAAGAAGG - Exonic
934048539 2:88191146-88191168 CACACCCTGGAGAAGGCACAGGG + Intergenic
934121957 2:88848848-88848870 AACAAAGTGGAGATGTCAGATGG - Intergenic
934750301 2:96789545-96789567 CAAAGCCTGGAGAAGACAGTGGG + Intronic
935111530 2:100098899-100098921 ATCAGCCTGGAGGAGGCAGGGGG - Intronic
935260106 2:101347230-101347252 AAAAACTTGGAGAAATCAGATGG - Exonic
935644527 2:105323228-105323250 GAGAGCCTGGAAAAGTCAGGTGG + Intronic
936123438 2:109766265-109766287 ATCAGCCTGGAGGAGGCAGGGGG + Intergenic
937797243 2:126038361-126038383 AACAGCTTGGAATAGTCAGTGGG - Intergenic
937862342 2:126720861-126720883 CACAGCCTGGGGAAGTCTGGAGG + Intergenic
938514779 2:131991987-131992009 TACAGCCTGAAGAACCCAGATGG + Intergenic
938756380 2:134383535-134383557 AACAGCCTGGGGCAGCCAGCAGG - Intronic
939155983 2:138524868-138524890 AACAGTCTGGAGGGCTCAGAAGG - Intronic
939959615 2:148554747-148554769 AAGTGCCTGAAGAAGTAAGAGGG - Intergenic
942051543 2:172145478-172145500 CAAAGGCTGGAGAAGCCAGAGGG + Intergenic
942609848 2:177732061-177732083 GTCAGCTTGGAGAACTCAGAGGG + Intronic
946020997 2:216640027-216640049 GACAGCATGGAGAAGGCAGGAGG - Intronic
946441614 2:219701710-219701732 AAAAGCCTGGAGATATTAGAGGG + Intergenic
946466282 2:219914714-219914736 GACAGCCTGGACAAGCCAGCAGG - Intergenic
946654605 2:221932921-221932943 AGCAGACTGCAGAAGTCAGCTGG + Intergenic
947137865 2:226993148-226993170 AACTGCCTGGAGGAATTAGAAGG - Intronic
947403588 2:229752214-229752236 ATCAGGATGGGGAAGTCAGAAGG + Intergenic
948036953 2:234865443-234865465 AGCAGCAGGAAGAAGTCAGAGGG - Intergenic
1169247880 20:4038188-4038210 AGCAGCTTGGAGAAGACAGGGGG + Intergenic
1170096342 20:12649757-12649779 AACAGGCTGCAGAAGGCAGGTGG - Intergenic
1170652477 20:18255579-18255601 AACAGAGTTGAGAAGCCAGAAGG + Intergenic
1171029670 20:21666061-21666083 AACAGCCTGGAGAAGGAAAAAGG - Intergenic
1171237482 20:23539338-23539360 AGCAGCCTGTGGAGGTCAGAGGG + Intergenic
1172985104 20:38979985-38980007 AAAAGAGTGGAGAACTCAGATGG + Intronic
1173628561 20:44492176-44492198 AACATCCTGGTGAAGCCACAAGG - Exonic
1173850451 20:46214550-46214572 ATGAGGCTGGAGAAGCCAGAAGG - Intronic
1173941295 20:46913531-46913553 AACAGACTGCAGGGGTCAGAGGG + Intronic
1174005296 20:47406071-47406093 ACCAGCCTGGGGAACACAGAAGG - Intergenic
1174727496 20:52878267-52878289 ATGAGCCTGGAGAAGTAAGCTGG - Intergenic
1175776309 20:61656027-61656049 ATCACCCTGGAGGAGTGAGAGGG + Intronic
1175852109 20:62099229-62099251 GAGAGCCTGGAGAGGACAGAGGG - Intergenic
1175931498 20:62495905-62495927 AACAGCCTGGGGAAGGTAAATGG - Intergenic
1176689138 21:9882610-9882632 AACAGCTTGGAACACTCAGAAGG - Intergenic
1176779004 21:13170924-13170946 TACAGCCTGAAGAACCCAGATGG - Intergenic
1177646301 21:23903683-23903705 AACAGCAAGGAGAAGGGAGAGGG + Intergenic
1177769832 21:25502169-25502191 AACAGCATGGAGATTTCAGTTGG + Intergenic
1178496378 21:33089836-33089858 AGCAGGCAGGAGAAGTTAGAAGG - Intergenic
1180785060 22:18542527-18542549 CACAGCCTGGAGCAGGCAGAAGG - Intergenic
1181128643 22:20716560-20716582 CACAGCCTGGAGCAGGAAGAAGG - Intronic
1181241963 22:21481881-21481903 CACAGCCTGGAGCAGGCAGAAGG - Intergenic
1181767268 22:25100825-25100847 AAGTGCCTGTTGAAGTCAGAAGG + Intronic
1182920956 22:34078304-34078326 AACAATCTGGAGAAATAAGATGG - Intergenic
1183022077 22:35035336-35035358 AACATACAGGAGTAGTCAGATGG + Intergenic
1183256794 22:36767507-36767529 CTCAGCATGCAGAAGTCAGAGGG + Intronic
1183599669 22:38832625-38832647 AACAGCCTGGGGAAGTAGGGAGG + Intronic
1184859197 22:47163599-47163621 AACAGCCAGGAGAGGGCAGAGGG + Intronic
1185035796 22:48476185-48476207 CACAGTCTGGAAAAGACAGATGG + Intergenic
949233046 3:1773999-1774021 AAGAGACTGGATGAGTCAGAAGG - Intergenic
952646458 3:35664756-35664778 AAGTGCCTGGAGGAGGCAGAAGG + Intronic
953231664 3:41070776-41070798 AACAGCCTGGAGCATTTAAATGG + Intergenic
954249074 3:49354439-49354461 AGGTGCCTGAAGAAGTCAGAAGG - Intergenic
954561542 3:51561116-51561138 ATGAGCCTGGAGAAGTAACAGGG - Intronic
955469963 3:59276322-59276344 CAAAACCTGGAGAAGACAGAAGG + Intergenic
955857235 3:63286379-63286401 CACATCCTGGAGAATTCAGTTGG - Intronic
956311476 3:67885380-67885402 AACCGTCTGGAGAAAGCAGAAGG + Intergenic
956670090 3:71680747-71680769 AACAGCTGGGAGGAGTCAGAGGG - Exonic
956907989 3:73786792-73786814 AAGAGCCTGAAGAAGTTACAGGG + Intergenic
959050373 3:101519069-101519091 ATCAGTGTGGACAAGTCAGAGGG - Intergenic
959189982 3:103098469-103098491 AACAGAATAGAGAATTCAGAGGG - Intergenic
961938269 3:130609430-130609452 AGCTCCCTGGAGAAGTCAGCTGG - Intronic
962162984 3:133019280-133019302 GGCAGCCTGGAGTAGTGAGATGG + Intergenic
962616393 3:137130885-137130907 AATAAGCTGGAGAAGCCAGAGGG + Intergenic
965738300 3:171846042-171846064 AACAGGATGGAGAACTCAGCAGG - Intronic
966859324 3:184220668-184220690 GACAGTCTGGAGAAGTCAGGAGG - Intronic
966863763 3:184244878-184244900 AAGAGCCTGGAGTAGGCAGGAGG + Intronic
968571568 4:1344957-1344979 AGCAGGCTGGAGAAGTCAACCGG + Intergenic
969479379 4:7439847-7439869 AACATCTTGGTGACGTCAGATGG + Intronic
969497027 4:7532048-7532070 AACAGCAAGGAGAGCTCAGATGG - Intronic
970289126 4:14552542-14552564 CACAGGCTGGAGAAGACAGGGGG + Intergenic
971431296 4:26570701-26570723 AGAATCCTGGACAAGTCAGAAGG + Intergenic
972088391 4:35249401-35249423 AACAGAGTGAAGAGGTCAGAGGG + Intergenic
975383249 4:73726853-73726875 AAGAGTCTGGAGAGGCCAGAAGG + Intergenic
977633132 4:99264791-99264813 GGCAGCATGGAGAAGTGAGAGGG - Intergenic
977816267 4:101416973-101416995 AACAGCCTGGACATGGTAGAGGG - Intronic
978757430 4:112318487-112318509 AGCAACCTGGAGAAGTGAAAAGG - Intronic
980204744 4:129702816-129702838 AACAGCCCGGAGAAGAAAGATGG - Intergenic
980897481 4:138874112-138874134 AGCAGCATGGAGAAGGCAGCTGG - Intergenic
981833589 4:149029484-149029506 AACAGCCTGGATGACTCAGCAGG - Intergenic
981864769 4:149403719-149403741 AACAGCTTCGAGGATTCAGAAGG + Intergenic
981963869 4:150578760-150578782 TAAAGCCTAGAGAAGTCTGAAGG + Intronic
984089937 4:175360576-175360598 AAGAGCCTGGAGAAGCAAGCAGG + Intergenic
985830440 5:2224119-2224141 AGCTGCATGGAGAATTCAGATGG - Intergenic
986182815 5:5409345-5409367 AACAGCCTGGATGACTCAGCAGG + Intergenic
986616841 5:9626185-9626207 ATCAGCCTGAAGAAGACGGATGG + Intergenic
986741203 5:10707022-10707044 ACCCACATGGAGAAGTCAGAGGG + Intronic
987531507 5:19127386-19127408 ATCAGCCTGGAGAATTAAGCAGG + Intergenic
987713793 5:21539447-21539469 AACAGCATGGAGAAACCTGAAGG + Intergenic
988960568 5:36367060-36367082 AACACCCTGGAGATGTTGGAAGG - Intergenic
989726954 5:44598085-44598107 AACAGTTTGGAGAGCTCAGAAGG - Intergenic
990362739 5:55037653-55037675 AAAAGACTGGAGAAGTCAACAGG - Intergenic
990515292 5:56525744-56525766 ATCAGCTGGGAGCAGTCAGAAGG - Intronic
991105024 5:62833686-62833708 AACAGTTTGGAGGACTCAGAAGG - Intergenic
992641411 5:78771303-78771325 AGCAGGCTGGAGAAGAAAGAGGG + Intergenic
992794069 5:80239742-80239764 TACAGCCTTGAGAAGCCAGCAGG + Intronic
992968066 5:82023956-82023978 TACACCCTGGTGAAGTCAGCAGG - Intronic
993321374 5:86471810-86471832 ATCATCCTGGAGAAATAAGAAGG + Intergenic
993609691 5:90039158-90039180 AAGAGTCTGGAGAATCCAGAAGG + Intergenic
993685983 5:90938173-90938195 AACAGCCTGGTTGAGTAAGAGGG + Intronic
996277504 5:121685091-121685113 AATAGCCTGCAGCAGGCAGAAGG + Intergenic
997083690 5:130771083-130771105 AACAACATGGAGAAGTTAAATGG + Intergenic
997661354 5:135591616-135591638 AACAGCCTGGAGATGTGGAAGGG + Intergenic
997953558 5:138260829-138260851 ACCAGCCTGGAGAACACAGCAGG + Intronic
998390259 5:141782967-141782989 CACAGGCTGGGGAAGTCAAAGGG - Intergenic
998894805 5:146788086-146788108 AACGGCATGGAGGAGGCAGAGGG - Intronic
1000451981 5:161400713-161400735 AACAGCCAGGAGCAGTTACAAGG - Intronic
1001151347 5:169230711-169230733 AACAACCTTCAGGAGTCAGAAGG - Intronic
1001264551 5:170263951-170263973 AACAGAGTCGAGAAGCCAGAGGG + Intronic
1005008302 6:21311977-21311999 AACTACCTGGAGAAGGCAGAAGG - Intergenic
1006083267 6:31579754-31579776 CACAGGCTGGAGGAGGCAGAGGG - Intergenic
1009002924 6:57742448-57742470 AACAGCATGGAGAAACCTGAAGG - Intergenic
1009209717 6:60847583-60847605 TCCAGCCTGCAGAAGGCAGATGG - Intergenic
1012739567 6:102998800-102998822 AACAGCCTGGAAAAGGAAGAGGG + Intergenic
1015684464 6:135844094-135844116 AACAGGGAGGAGAATTCAGATGG + Intergenic
1016026135 6:139288796-139288818 AATGGCCTGGAGAAGGAAGATGG - Exonic
1019226029 6:170510238-170510260 AACAGTGTGGAGAAGGGAGAGGG + Intergenic
1022394817 7:29977761-29977783 AAAAGCTTGGAGAAGTGACAGGG - Intronic
1024062399 7:45708866-45708888 AGGAGCCTGGAGAAGACACAGGG - Intronic
1024098409 7:46004943-46004965 TACAGGCTGGAGAAGTCAAAAGG - Intergenic
1024538353 7:50457223-50457245 AGGAACCTGGAGAAGTCAGGAGG + Intronic
1025004960 7:55346190-55346212 AACAGCCTCAAAAATTCAGATGG + Intergenic
1027615400 7:80417242-80417264 AACAGCCTTGAGAAGGTAGGAGG + Intronic
1027812296 7:82919330-82919352 AAAAGCCTGCAGGAGCCAGAAGG + Intronic
1028990052 7:97039517-97039539 CACTGCCTGGAGAAGTCACAGGG + Intergenic
1029575545 7:101401140-101401162 ACCTGCCTGGAGAAGGCATAGGG + Intronic
1031179325 7:118394496-118394518 AGCAGACGGGAGAAGCCAGAAGG + Intergenic
1033053963 7:138032508-138032530 AGCAGGCTGGAGGAGACAGAGGG - Intronic
1033562504 7:142545888-142545910 CACAGCCTGGAAAAGGCATAAGG + Intergenic
1034949762 7:155289276-155289298 GACAGAGTGGAGAAGTCAGCTGG - Intergenic
1035251523 7:157600334-157600356 AAGAGACTTGAGAAGTCAAATGG - Intronic
1035797855 8:2375925-2375947 AACAGGATAGAGAGGTCAGAGGG + Intergenic
1035951911 8:4031108-4031130 AACAGTTTGGAGGACTCAGAAGG - Intronic
1036273633 8:7331377-7331399 AAAAACCTTGAGAAATCAGAAGG - Intergenic
1036347713 8:7978975-7978997 AAAAACCTTGAGAAATCAGAAGG + Intergenic
1038324929 8:26565883-26565905 AAAAGCCTGGAGGAGGAAGAGGG + Intronic
1040414536 8:47184429-47184451 GAGAGCCTGGAGAGGGCAGAAGG - Intergenic
1041191411 8:55359164-55359186 AAAAGCACGGAGAAGGCAGAAGG + Intronic
1041421663 8:57673445-57673467 AACACCCTGGAGAAGGAGGATGG + Intergenic
1042857407 8:73281608-73281630 ACCAGACTGGAGAAGTAGGAAGG + Intergenic
1043369650 8:79575737-79575759 AACAGCCTGGGAAAGTGAGATGG - Intergenic
1043841208 8:85106949-85106971 AACCGCCTTCAGAAGTCAGTCGG + Intergenic
1045317581 8:101056713-101056735 AACATCCTGGAAAAGTAATATGG - Intergenic
1046371249 8:113309797-113309819 AACAGCATGGAGAAGACTGAGGG - Intronic
1046684555 8:117210608-117210630 TACAGCCTGAAGAGGTAAGAAGG + Intergenic
1047603447 8:126450527-126450549 AGCAGGCTGGAGAAGTCACATGG - Intergenic
1048208288 8:132433117-132433139 AACCTCCTGGAGAATTCAGGAGG - Intronic
1049025901 8:139988666-139988688 AGCAGCGTGGTGAAGGCAGAGGG + Intronic
1049939030 9:527184-527206 AACGGCCTGGAAACTTCAGAAGG - Intronic
1050292553 9:4170728-4170750 AACATACAGGAAAAGTCAGATGG - Intronic
1050639768 9:7654797-7654819 GACAGCCTGGATAAGTCAGAAGG - Intergenic
1052035411 9:23674852-23674874 AAGAGCCTGGAGAAGTTAAGTGG - Intergenic
1053780188 9:41599286-41599308 AACAGCTTGGAGCACTCAGAAGG + Intergenic
1054168130 9:61809443-61809465 AACAGCTTGGAGCACTCAGAAGG + Intergenic
1054669400 9:67771375-67771397 AACAGCTTGGAGCACTCAGAAGG - Intergenic
1054777284 9:69134291-69134313 TACAGTCTGGAGGAGGCAGATGG + Intronic
1055455309 9:76466497-76466519 ACCAGCCTGGACAACACAGATGG - Intronic
1055780884 9:79820368-79820390 TAGAGCCTTGAGAAGACAGAGGG - Intergenic
1056254370 9:84783656-84783678 AAGAGCATGGAGAAGAGAGAGGG + Intronic
1061153029 9:128839853-128839875 AACAGCCTGGGCAACACAGAGGG + Intronic
1187526703 X:20061031-20061053 AACAGGCTAGAGAAGTAAAATGG + Intronic
1188374610 X:29412684-29412706 ATCAGCCTGGAGAAGTGTAAGGG + Intronic
1190878965 X:54479317-54479339 TACAGCTGGGAGAAGTGAGAGGG - Intronic
1191867741 X:65719178-65719200 GACAGCCTAGTGAAGTCAAAAGG + Intronic
1192082076 X:68058095-68058117 AACAGCCTATAAAAGTCAGCTGG - Intronic
1192835741 X:74797581-74797603 AACAGTCTTCTGAAGTCAGAAGG + Intronic
1195043694 X:101037068-101037090 GACAGGCTGGAGAGGGCAGAAGG + Exonic
1196131971 X:112166569-112166591 AACTGCCTGGAAAAAACAGAAGG + Intergenic
1196512185 X:116524542-116524564 AACACCAGGGAGAACTCAGATGG - Intergenic
1197071927 X:122309547-122309569 AACTACCTGGACAAGTCAGCTGG - Intergenic
1198636187 X:138703362-138703384 AACAGCCTGGAGAAAATGGAAGG + Intronic
1198870735 X:141175618-141175640 AGCAGCCTGGAGATGACAGCGGG + Intergenic
1199831586 X:151554104-151554126 AACAGACTGGAGAAATCAAATGG + Intergenic
1200572849 Y:4853988-4854010 AACAGTTTGGAGAGCTCAGAAGG - Intergenic
1202379894 Y:24267582-24267604 TGCAGCTTGGAGAATTCAGATGG - Intergenic
1202490888 Y:25402539-25402561 TGCAGCTTGGAGAATTCAGATGG + Intergenic