ID: 1163337356

View in Genome Browser
Species Human (GRCh38)
Location 19:16682014-16682036
Sequence CATCTCCTCCAGAGGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163337346_1163337356 19 Left 1163337346 19:16681972-16681994 CCAGGAAGCTTTTAGTACTGAGC 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1163337356 19:16682014-16682036 CATCTCCTCCAGAGGATGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 271
1163337351_1163337356 -10 Left 1163337351 19:16682001-16682023 CCCAGGGGTATAGCATCTCCTCC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1163337356 19:16682014-16682036 CATCTCCTCCAGAGGATGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 271
1163337350_1163337356 -9 Left 1163337350 19:16682000-16682022 CCCCAGGGGTATAGCATCTCCTC 0: 1
1: 0
2: 2
3: 9
4: 200
Right 1163337356 19:16682014-16682036 CATCTCCTCCAGAGGATGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163337356 Original CRISPR CATCTCCTCCAGAGGATGGG TGG Intronic
900523932 1:3119383-3119405 CATTTCCTTGAGAGGATGCGGGG + Intronic
900925773 1:5705342-5705364 CCTCCCCTCCAGGGAATGGGTGG + Intergenic
900990503 1:6096228-6096250 CATCCCCCCCAGAGGATTGCAGG - Intronic
901018792 1:6245739-6245761 CAGCCCCTCCGGAGGATGGGCGG - Intergenic
901643971 1:10706825-10706847 CATCTCATCCAGATGATGAGAGG + Intronic
902324277 1:15688842-15688864 CATCTTCTCCAGGGGAGGGAAGG + Intronic
902324755 1:15692527-15692549 TATCTCCTCCTGAGCCTGGGTGG - Intronic
903112649 1:21149950-21149972 CTTCTACTGCAGAGAATGGGTGG + Intronic
903403721 1:23078973-23078995 CACATCCTGCAGAGGTTGGGTGG - Exonic
903441970 1:23394931-23394953 GAGCTCCTCCAGAGGGTGGAGGG - Intronic
904755569 1:32766805-32766827 CATCTAATCCTGGGGATGGGGGG - Intronic
907211205 1:52824262-52824284 CAGCTACTCCAGAGGCTGAGGGG - Exonic
907251891 1:53145201-53145223 TCTCTGCTCCAGAGGAGGGGTGG - Intergenic
907338457 1:53716109-53716131 CAGCTCCCACAGAGGAGGGGAGG + Intronic
907836086 1:58109818-58109840 GATCTCCTGCAGAGAAGGGGAGG + Intronic
909629376 1:77755582-77755604 CAGCTACTCCAGAGGCTGAGTGG + Intronic
910054305 1:83012780-83012802 CCTCTGCCCCAGAGGAGGGGAGG - Intergenic
910538698 1:88330069-88330091 CAGCTACTCAAGAGGCTGGGTGG - Intergenic
913292693 1:117289334-117289356 CAGCTACTCCAGAGGCTGAGGGG - Intergenic
914323089 1:146584252-146584274 CTGCTCCTCCTGAGGATGGGTGG - Intergenic
915853534 1:159354163-159354185 CATCTTCTCCAAAGGCTGGATGG + Intergenic
915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG + Exonic
916015980 1:160750287-160750309 CAGCACCTTCAGAGAATGGGTGG - Exonic
916606974 1:166352732-166352754 CATCTCATCCTGGGAATGGGAGG + Intergenic
917026211 1:170645308-170645330 CATCTCCTCTAGTAGATGGAAGG + Intergenic
917373143 1:174317547-174317569 CCTCTCCTCCAGTGGAAGGAAGG + Intronic
917721718 1:177792350-177792372 CATCTCCTGCAGTGAATTGGGGG - Intergenic
918790686 1:188823415-188823437 CAGCTACTCCAGAGGCTGAGGGG - Intergenic
919795005 1:201316365-201316387 CCTCTCCTCCAGAGGAGGGAAGG - Intronic
919940947 1:202285709-202285731 CATCTCCTCTGTAGGATGGATGG + Intronic
920234323 1:204493004-204493026 CAGCTCCTCCAGAGTCTGGCTGG - Intronic
920320790 1:205120811-205120833 CAACTCCTCCACAGGTTTGGGGG + Intronic
921634525 1:217476971-217476993 CATCTCCTCCAGAAGATGAAAGG - Intronic
923101222 1:230819133-230819155 CAGCTACTCCGGAGGCTGGGAGG + Intergenic
924387745 1:243514961-243514983 CATGGCCTGCAGGGGATGGGAGG - Intronic
1063120964 10:3105449-3105471 AATCTCCACCAGAGGAAGGCTGG + Exonic
1066157977 10:32698289-32698311 CTTCTCCTCCAAAGGATCGCAGG + Intronic
1067713837 10:48671814-48671836 GATCTGCACCAGAGGAAGGGAGG + Intergenic
1069933650 10:71900462-71900484 CCTCTCCTCAAGAGGAGGGAAGG + Intergenic
1070051962 10:72898171-72898193 CAGCTACTTCAGAGGCTGGGTGG + Intronic
1071216145 10:83404334-83404356 CATCTCCTTCACAGGGTGGCGGG + Intergenic
1071802267 10:89076840-89076862 CATCTCCTCATGGGGGTGGGGGG - Intergenic
1072680564 10:97503270-97503292 CTTCTCCTTCAGATGCTGGGTGG + Intronic
1072748784 10:97961204-97961226 CATCTTCTCCATAGGGTTGGGGG - Intronic
1073046901 10:100644730-100644752 CAACTCCTCCAGGGTCTGGGAGG + Intergenic
1073127527 10:101160988-101161010 CATCTCCACCAGATGATGAATGG + Intergenic
1073368445 10:102965001-102965023 CCTCCCCTCCAGAGGATGCAAGG + Intronic
1074014598 10:109521248-109521270 CAGCTCCTCCATATAATGGGTGG - Intergenic
1074686299 10:115965229-115965251 CTTGTCCGCCATAGGATGGGTGG + Intergenic
1076328322 10:129645576-129645598 CATCTCATCCAAAGGATGAAAGG - Intronic
1076705110 10:132297218-132297240 CATGTCCTGCAGAGGGTGTGGGG - Intronic
1076798574 10:132810429-132810451 CGTCTCCTTCAGAAGATGAGTGG - Exonic
1077411942 11:2407730-2407752 TCTCTCCTCCAGGGGTTGGGTGG + Intronic
1079111620 11:17608202-17608224 TGTCCCCTCCACAGGATGGGGGG + Intronic
1079497449 11:21061753-21061775 CTTCTCCTCCAGAGAACTGGAGG + Intronic
1081182919 11:40006240-40006262 CATCCCCTCCAGATTCTGGGGGG + Intergenic
1083261141 11:61523796-61523818 CTTCTCCAGCAGAGGATGGGCGG - Intronic
1084686270 11:70697779-70697801 CATCTCCTGCAGAGGTGGGAGGG - Intronic
1086161053 11:83722543-83722565 CCTCACCTCCAGAGGCGGGGTGG + Intronic
1089310593 11:117555857-117555879 CCTCTCCTGCAGAGTATGGAGGG + Intronic
1089323755 11:117643671-117643693 CATCTCCTGCAGGGGAGGAGTGG + Intronic
1089610352 11:119665260-119665282 CGTCTCCTCCCGAACATGGGCGG - Exonic
1090598304 11:128342975-128342997 CATCTCCTCCAGAACATGTGTGG - Intergenic
1096868127 12:54577277-54577299 CATCTTCGGCAGGGGATGGGGGG - Exonic
1097457478 12:59817498-59817520 CAGCTACTCTAGAGGCTGGGTGG - Intergenic
1100827597 12:98489542-98489564 CAGCTACTCCAGAGGCTGAGAGG - Intronic
1101336306 12:103799943-103799965 TTTCTCCTCCACAGGAGGGGTGG - Intronic
1101407719 12:104443363-104443385 CCTCTCCTCCAGAGGCTGTGGGG - Intergenic
1102688422 12:114742040-114742062 CATCTGCTCCAGGAAATGGGAGG + Intergenic
1104494217 12:129221524-129221546 AATTTCCTCCATAGGCTGGGTGG + Intronic
1104577858 12:129984347-129984369 CATCTCCCACAGAGCGTGGGGGG - Intergenic
1104704373 12:130932401-130932423 CCTCTCCCCCTGAGGCTGGGAGG + Intergenic
1104723639 12:131061154-131061176 CATCACCTTGAGAGGCTGGGCGG - Intronic
1105411615 13:20176170-20176192 CCCCACCTCCAGAGGATAGGAGG - Intergenic
1105650040 13:22367213-22367235 CAGCTCTTCCAGGGGATGGGGGG + Intergenic
1106394692 13:29368313-29368335 CACTTCCTGGAGAGGATGGGTGG - Intronic
1106509785 13:30402884-30402906 CATCCCATCCAGAAGGTGGGTGG + Intergenic
1110595960 13:77320716-77320738 CATCCCATCCAGAGGTTGTGAGG - Intronic
1113644246 13:111981171-111981193 CAGCTCCTCCTGAGGCTGTGGGG + Intergenic
1114257737 14:21017402-21017424 CATCTCTTCCAGGAGCTGGGGGG + Exonic
1115699059 14:35931201-35931223 CAGCTACTCCAGAGGCTGAGGGG - Intronic
1116870701 14:50066970-50066992 CAGCTCCCCAAGAGGAAGGGTGG + Intergenic
1117092972 14:52268575-52268597 CAGCTCCTCCAGGGGCTGAGGGG - Exonic
1117139929 14:52778899-52778921 CAGCTACTCCAGAGGCTGAGGGG + Intronic
1118844075 14:69533261-69533283 CAGATCCTCCAGGGGAAGGGTGG - Intergenic
1119358881 14:74031224-74031246 CAGCTACTCCGGAGGCTGGGTGG - Intronic
1121015945 14:90549223-90549245 CTTCTCCTCCAGAGGGAGTGAGG + Intronic
1122268848 14:100559285-100559307 CATCTTCTCCAGAGGGAGAGAGG - Intronic
1122578322 14:102755675-102755697 CCTCTCCTCCCGAGCATGGAGGG + Intergenic
1202853536 14_GL000225v1_random:36495-36517 CATCGCCACCAGAGAATGGCTGG + Intergenic
1202854631 14_GL000225v1_random:42937-42959 CATCGCCACCAGAGAATGGCTGG + Intergenic
1202862305 14_GL000225v1_random:90362-90384 CATCGCCACCAGAGAATGGCTGG - Intergenic
1124176316 15:27427825-27427847 AAGCCACTCCAGAGGATGGGAGG - Intronic
1124597216 15:31101425-31101447 CATCTCCTCTTGAGGCTGGCTGG - Intronic
1124722156 15:32119789-32119811 CATCTCAGCAAGAGGAAGGGAGG + Intronic
1125729218 15:41883351-41883373 CAGCTCCTCCAGCTGGTGGGAGG + Exonic
1125736385 15:41929295-41929317 CATATCCCCCAGAGGAAGGAGGG - Intronic
1126827323 15:52565158-52565180 CACCTACTCCAGAGGCTGAGGGG - Intronic
1127259600 15:57318506-57318528 CAGCTACTCAAGAGGCTGGGAGG + Intergenic
1129342235 15:74893529-74893551 CATCTTCTCCAGATGGTTGGAGG + Intronic
1129788193 15:78322960-78322982 CAACTCCTCCTGGGGATGGATGG - Intergenic
1131736564 15:95338854-95338876 CTTCTCCTCTAGACGTTGGGAGG - Intergenic
1132292857 15:100715392-100715414 CTTCTCCAGCAGAGGCTGGGAGG - Intergenic
1133641652 16:7722975-7722997 CATCTCCTCTTGAGTATGGGAGG - Intergenic
1134617306 16:15661557-15661579 CAGCTACTCGAGAGGATGAGGGG - Intronic
1134778459 16:16873390-16873412 CCTCTCCTGCAGAGGTGGGGCGG - Intergenic
1137527723 16:49250775-49250797 CATGTCCTGCTGTGGATGGGGGG + Intergenic
1138343801 16:56307804-56307826 CAGCTCCTCCATAGGAAGGATGG + Intronic
1138769941 16:59651353-59651375 CATAATCTCCAGAGGTTGGGAGG - Intergenic
1140010470 16:71126598-71126620 CTGCTCCTCCTGAGGATGGGTGG + Intronic
1140125284 16:72113058-72113080 CAGCTGCTCCTGAGGCTGGGGGG + Intronic
1141257220 16:82414027-82414049 CATCTCCACCGGAGGCTGTGAGG - Intergenic
1141423937 16:83933628-83933650 CTTCTGCTCCAGATGATGAGAGG - Intronic
1143359912 17:6361073-6361095 CATTTCCTCCAGAAGACAGGAGG + Intergenic
1143633069 17:8149791-8149813 CAGCTCCTCCAGGGTATAGGTGG + Exonic
1144462161 17:15467051-15467073 CATCACCCCCAGGGGATGGGGGG + Intronic
1145739368 17:27259709-27259731 GATCACCACCAGTGGATGGGAGG - Intergenic
1146717425 17:35098346-35098368 CAGCTCCTCGAGAGGCTGAGTGG - Intronic
1147535507 17:41318688-41318710 CACCTCCTCCAGATGAAGGTTGG + Intergenic
1148574717 17:48701935-48701957 CTGCTCCTACAGAGGAAGGGTGG + Intergenic
1148764658 17:50030196-50030218 CAGCTACTCCAGAGGCTGAGAGG - Intergenic
1150782237 17:68133525-68133547 CATCTCCTCTAGACCATGGCAGG - Intergenic
1151309684 17:73285649-73285671 CTCATCCTCCAGAGCATGGGAGG + Exonic
1151528709 17:74690063-74690085 CAGCTACTCCAGAGGCTGAGGGG - Intronic
1152075430 17:78156726-78156748 CAGCTACTCCAGAGGTTGAGGGG - Intronic
1152252861 17:79220815-79220837 CAGCTCCTGCAGAGGCGGGGCGG + Intronic
1152305649 17:79518920-79518942 CATTTCCTCCAAATGAAGGGAGG + Intergenic
1157022692 18:43805698-43805720 CCTCTCCTCAAGTGGATGGAAGG + Intergenic
1158902714 18:61981176-61981198 CAGCTACTCCAGAGGCTGAGCGG - Intergenic
1159684636 18:71402770-71402792 GACCTCCTACAGAGGAGGGGAGG + Intergenic
1160746675 19:714759-714781 CAGCTACTCAAGAGGCTGGGTGG - Intronic
1162130735 19:8524755-8524777 GCTCTCCTACAGAGGATAGGAGG - Intronic
1163261609 19:16194005-16194027 CAGCTACTCCAGAGGCTGAGAGG - Intergenic
1163337356 19:16682014-16682036 CATCTCCTCCAGAGGATGGGTGG + Intronic
1163489396 19:17607993-17608015 CAGCTACTCCAGAGGGTGAGGGG - Intronic
1163767530 19:19171814-19171836 CATCTCCTCCAGAGAAGAGAGGG + Intronic
1164752408 19:30666437-30666459 GATCCCCAGCAGAGGATGGGAGG - Intronic
1164818861 19:31228410-31228432 CAGCTACTCCAGAGGCTGAGGGG + Intergenic
1165103323 19:33453198-33453220 CAGCTACTCCAGAGGCTGAGGGG + Intronic
1165769088 19:38368009-38368031 CATCTCAGCCAGGGGTTGGGGGG - Intronic
1166937502 19:46343288-46343310 CATCACCTCCAGAGGGAGGAGGG - Exonic
1167680496 19:50917192-50917214 GATCTCCTCCAGAAGTGGGGAGG + Intergenic
925186704 2:1851918-1851940 CATCTGCTCCAGAGACTGTGGGG - Intronic
925814308 2:7732701-7732723 CATGCCCTCCAGTGGATGGTGGG + Intergenic
925992447 2:9264325-9264347 CATGTCTTCCAGAGACTGGGGGG + Intronic
926423674 2:12722083-12722105 CATCTCATCCAGATTATTGGTGG + Intronic
926592320 2:14752475-14752497 TCTGTCCTCCAGAGGAAGGGAGG - Intergenic
928163441 2:28950941-28950963 CAGCTACTCAAGAGGATGAGAGG - Intergenic
928315220 2:30239445-30239467 CATGTCCTCAAGAGTTTGGGAGG + Intronic
928372816 2:30753352-30753374 CTTCTGCTCCAGTGGCTGGGAGG + Intronic
929426738 2:41851679-41851701 GAGCTCCTCCTGGGGATGGGAGG - Intergenic
929623443 2:43381391-43381413 CTTCACCTCCTGAGGCTGGGTGG - Intronic
931453567 2:62388998-62389020 CAGGTACTCCAGAGGTTGGGAGG - Intergenic
932431777 2:71679940-71679962 TATCTCCTCCAGATAAGGGGGGG - Intronic
932621450 2:73266728-73266750 GCTCTCCTCCAGAGGGTGGGTGG - Intronic
936849438 2:116877789-116877811 CATGGACACCAGAGGATGGGTGG - Intergenic
936995538 2:118410029-118410051 CAGCTACTCCAGAGGCTGAGAGG + Intergenic
937961504 2:127463683-127463705 CATTTCCTTCAGTGGATAGGAGG - Intronic
938173942 2:129107140-129107162 TATCTCCTGCAGATGGTGGGGGG + Intergenic
938745382 2:134273115-134273137 CATTTCCCCCAGAAGGTGGGGGG + Intronic
941227618 2:162868283-162868305 CCTCTCCTCAAGAGGAAGGAAGG - Intergenic
941737862 2:168999713-168999735 GATATCCTCCAAAGGATGAGTGG - Intronic
942431955 2:175921269-175921291 CAGCTACTCCAGAGGCTGAGAGG - Intergenic
942926355 2:181437786-181437808 CTTCTCCTCCAGAGGCAGGCAGG + Intergenic
944580692 2:201130156-201130178 CAACTCTTCCTGAGGCTGGGTGG + Intronic
947463315 2:230321585-230321607 CATCTCCTCCAGACCATGGTTGG + Intergenic
947472207 2:230410591-230410613 CATCTCCGCCAGACAATGGTTGG + Intergenic
948656734 2:239480769-239480791 CCTCTCCTCCAGAGAACTGGGGG + Intergenic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1169499903 20:6148903-6148925 CATCTCCTCCAAACAATGGGGGG - Intergenic
1169508484 20:6239442-6239464 CAGCTACTCAAGAGGCTGGGAGG - Intergenic
1169681345 20:8217427-8217449 CATCTCTCCCTGAGGATGGAAGG + Intronic
1172034614 20:32002220-32002242 CTTCTCCTCCAGAGAAGGGAAGG - Exonic
1173555899 20:43965396-43965418 CATCTTCTCCAAAGGACTGGGGG + Intronic
1174570086 20:51495196-51495218 CAGCTACTCCAGAGGCTGAGGGG - Intronic
1174869792 20:54172452-54172474 CATTTTCTGCAGAGGATTGGGGG - Intronic
1175599445 20:60260861-60260883 CATCAGCTTCAGAGGATTGGAGG + Intergenic
1175721704 20:61291494-61291516 AGTCTCCTCCAGAGTAAGGGGGG + Intronic
1178480223 21:32973990-32974012 CAGCTCCTCAGGAGGCTGGGAGG + Intergenic
1179131162 21:38638634-38638656 CCTCCCTGCCAGAGGATGGGGGG + Intronic
1179465456 21:41568695-41568717 CACCTCCTCCAGACGAGGGCTGG + Intergenic
1179942337 21:44648320-44648342 CACCTCCTCAGGAGGCTGGGAGG + Intronic
1180746268 22:18091114-18091136 CAGCTACTCCAGAGGCTGAGGGG - Exonic
1181926441 22:26362881-26362903 GATCTCCTCCAGTGGGTGGACGG - Intronic
1182810519 22:33112185-33112207 GAACTAGTCCAGAGGATGGGTGG + Intergenic
1183184620 22:36284958-36284980 CATCCCTTCCACAGGTTGGGTGG - Intronic
1183716875 22:39538262-39538284 CATCTCATCCACAGCTTGGGGGG + Intergenic
1184383236 22:44159597-44159619 ACTCTCCTTCGGAGGATGGGAGG + Intronic
1184444190 22:44537731-44537753 CCACTCCTCCAGGGGATGTGGGG + Intergenic
1185048866 22:48543389-48543411 CATTTCCTCCAGAGAGTGGCCGG - Intronic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
950004903 3:9685375-9685397 CATCTCCTCCTGAGGCAGCGTGG + Intronic
952736057 3:36692592-36692614 CAGCTACTCCAGAGGCTGAGTGG + Intergenic
952778798 3:37072877-37072899 CTTCTCCTGCAGAGGAAGAGGGG + Exonic
952847466 3:37700460-37700482 CAACTACTCCGGAGGCTGGGAGG - Intronic
953607180 3:44419678-44419700 CATCAGCTCCACAGGGTGGGCGG - Intergenic
954257746 3:49418136-49418158 CATGGCCTCCAGGGGATAGGAGG - Intronic
954803192 3:53199289-53199311 CATGTCCTCCAGCAGGTGGGTGG + Intergenic
955936391 3:64106876-64106898 CAGATCCTCCAGAGGATGTAGGG - Intronic
957590113 3:82185881-82185903 CATTTCCACAAGAGGCTGGGTGG - Intergenic
958480897 3:94644049-94644071 CATTTCCTTCAGAGGATTTGTGG + Intergenic
958729842 3:97949865-97949887 CATCTCCCGCAGAGTAAGGGGGG + Exonic
959656491 3:108811292-108811314 CAGCTACTCCAGAGGCTGAGCGG - Intergenic
959806656 3:110562455-110562477 CCTTTCCTCAAGTGGATGGGAGG + Intergenic
960166706 3:114410846-114410868 CCTCTCCTCCAGAAAATGGGCGG - Intronic
961305283 3:125955265-125955287 CATATTCCCCAGAGGATGGCTGG + Intergenic
961765282 3:129205675-129205697 CATCTCCTCCTGAGGGTGTGTGG - Intergenic
966998558 3:185309394-185309416 CAGCTACTCCAGAGGCTGGGAGG + Intronic
968704570 4:2071976-2071998 CATTTACTCCAGGGGATGGCGGG + Exonic
968747294 4:2366731-2366753 CATCTCCTTCTGTGGGTGGGAGG - Intronic
969670709 4:8588581-8588603 CATCCCCTGCAGAGGTAGGGTGG + Intronic
975495501 4:75031483-75031505 CTTCTCCTCCATATGATGGGTGG - Intronic
975500451 4:75079283-75079305 CTTCTCCTCCAAAGGATCGCAGG - Intergenic
978749410 4:112230911-112230933 CACCTCGTCCAGTGGATAGGAGG - Intergenic
979039035 4:115763528-115763550 CAGCTCCTCTAGAGTAAGGGAGG + Intergenic
982224954 4:153156579-153156601 CATCTCTTGCAGGGGAGGGGAGG + Intronic
983932027 4:173463005-173463027 CATCTCCACTAGAGGAAGGCAGG + Intergenic
984447514 4:179855509-179855531 CAGGAACTCCAGAGGATGGGAGG - Intergenic
986922517 5:12704767-12704789 CTTCTCCCACAGAGGCTGGGAGG - Intergenic
987213371 5:15707676-15707698 AATGTCCTGCAGAGGATAGGAGG + Intronic
987496622 5:18653220-18653242 CATCTCCTCAAGAGGAAGAAAGG + Intergenic
988510259 5:31858720-31858742 CATCTCATAAAGAGGAAGGGAGG - Intronic
991528949 5:67594401-67594423 CATCCCCTCCAGTAGGTGGGAGG - Intergenic
992587081 5:78251921-78251943 CCTCTCCTCAAGTGGAAGGGAGG - Intronic
992887450 5:81172842-81172864 CACATCATCCAGAGGATGAGAGG - Intronic
997416083 5:133729815-133729837 CATCTTCTCCTCAGGATTGGGGG - Intergenic
997822170 5:137076014-137076036 CATCTCCTAGAGAGGATGACAGG - Intronic
998850263 5:146344962-146344984 CTCCTCCTCCCGAGGAGGGGCGG + Intergenic
999265984 5:150267150-150267172 CATATCCTCCAGGGTAGGGGAGG + Intronic
999309090 5:150540062-150540084 GATCTGCTCCAGGGGAGGGGAGG - Exonic
999344564 5:150804720-150804742 CAGCTACTCGAGAGGCTGGGAGG + Intergenic
1001182560 5:169534151-169534173 CATCTCATCCAAAGGAAGAGAGG - Intergenic
1001707398 5:173751352-173751374 CTGCTCCACCAGAGGATCGGGGG - Intergenic
1002865172 6:1115433-1115455 CCTCTCCTCCAGCAGATGAGAGG - Intergenic
1004176773 6:13347048-13347070 CCTCTCCTCCAGAGAAGGGATGG + Intergenic
1005369469 6:25115853-25115875 GATTACCTCCAGAGCATGGGTGG + Intergenic
1006416875 6:33909709-33909731 CATTTCATCCCGAGGGTGGGTGG + Intergenic
1007350781 6:41272074-41272096 CATCTCCCCACGAGGCTGGGTGG + Intronic
1007699885 6:43760244-43760266 CATCTTCTCTAGAGGATTTGTGG - Intergenic
1008393934 6:50985186-50985208 AATCAGCTCCAGAGGAGGGGGGG + Intergenic
1012438762 6:99242357-99242379 CATCTCCTCTAGAGAAGAGGAGG + Intergenic
1015573183 6:134643432-134643454 CATCTTCTTAAGAGGCTGGGTGG - Intergenic
1015637052 6:135287456-135287478 CGGCTCCTCCTGACGATGGGAGG + Intronic
1018881832 6:167890982-167891004 CAGCTTCTCCGGAGGAAGGGTGG - Exonic
1020260957 7:6530684-6530706 CATCTCGTCCTGAGTTTGGGGGG - Intronic
1021774687 7:24041033-24041055 CTCCTCCCCCAAAGGATGGGTGG - Intergenic
1023776286 7:43610551-43610573 CAGCTACTCCAGAGGCTGAGGGG + Intronic
1023882039 7:44326115-44326137 CATCTCTTCCTGAGGGTGTGAGG - Intronic
1026261146 7:68756541-68756563 CAGCTACTCCAGAGGCTGAGTGG - Intergenic
1028154926 7:87418876-87418898 CAGCTCCTCCCAAGGCTGGGAGG + Intronic
1030116496 7:106065691-106065713 CAATACCTCCAGGGGATGGGGGG + Intergenic
1032806454 7:135359770-135359792 GATCTACTCCAGAGGACTGGAGG + Intergenic
1033587683 7:142786604-142786626 CATGGCCTGCAGAGGATGGCAGG - Intergenic
1034882460 7:154772897-154772919 CATCATCTCCAGATCATGGGTGG - Exonic
1035248985 7:157584577-157584599 CATTTCCTCCAGAGCAGGTGCGG + Intronic
1035945111 8:3953975-3953997 CATCACCACCAGAGGAAGGAAGG - Intronic
1037567653 8:20130905-20130927 CCCATCCTCCAGAGGCTGGGAGG - Intergenic
1038494075 8:27989642-27989664 CCTCTCCTCCAGCCTATGGGAGG + Intronic
1038718588 8:30013224-30013246 CATCTACTCAGGAGGCTGGGTGG - Intergenic
1039398318 8:37246638-37246660 TCTCTCCTCCTGAGGCTGGGAGG - Intergenic
1047464011 8:125094966-125094988 CATCTCCTCCTGAGGAGCTGGGG + Intronic
1051213601 9:14772658-14772680 CCTCTCCTGAAGAGTATGGGTGG + Intronic
1051288126 9:15517070-15517092 CATCTACTCCACAGGTTGAGAGG - Intergenic
1052434056 9:28403331-28403353 CAGCTCCTCTACAGGATGGCAGG + Intronic
1052509722 9:29400269-29400291 CTTATCCTCCAGAGTATTGGTGG - Intergenic
1053134797 9:35643862-35643884 CAGCTACTCCAGAGGTTGGGAGG + Intronic
1055739596 9:79372141-79372163 CATCTCCTCAGGTTGATGGGTGG + Intergenic
1056495169 9:87148773-87148795 CATCTCCTCCTGGGGGTGTGGGG + Exonic
1056818477 9:89818916-89818938 CATCTACTCGAGAGGCTGGCAGG - Intergenic
1057567952 9:96181544-96181566 CATCTCCTGCAGAGGCTGCAGGG - Intergenic
1057785356 9:98083340-98083362 CATATCCTCCAGTTGCTGGGTGG + Intronic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1060727462 9:126015943-126015965 CCTCTTTTCCACAGGATGGGCGG - Intergenic
1061599554 9:131658510-131658532 CATTCCTTCCAGAGGAAGGGTGG + Intronic
1062038974 9:134395567-134395589 TTTCTCCTCCAGAGTCTGGGTGG + Intronic
1062197543 9:135282628-135282650 CATCTCCTCTCAAGGATGGAGGG + Intergenic
1062214946 9:135384135-135384157 CAGCTCCTCCAGAGGGGGGCTGG + Intergenic
1062397714 9:136359104-136359126 CATCTCCCCCAGCTGGTGGGAGG - Exonic
1062452624 9:136621913-136621935 CATCTGCTGCAGAGGAAGGAAGG - Intergenic
1188004710 X:25009267-25009289 CATCTTCTCCAGTGAATAGGGGG + Intronic
1188270893 X:28139417-28139439 CTCCTCCTGCAGAGGAAGGGAGG + Intergenic
1190260559 X:48794175-48794197 CATGGCCTCCAGAGGAGGGGTGG + Exonic
1191736201 X:64390767-64390789 CAGCTACTCGAGAGGCTGGGGGG - Intronic
1191766751 X:64706070-64706092 CATTTACTCCAGTGGAAGGGGGG - Intergenic
1191782850 X:64886907-64886929 CATCTCCTGCAGCTGAGGGGTGG - Intergenic
1195262157 X:103143251-103143273 CAGCTACTCCAGAGGCTGAGTGG - Intergenic
1197677570 X:129346876-129346898 CATCTCCTCAAGTGGAAGGAAGG - Intergenic
1198548708 X:137721851-137721873 CATCTCCACAAGAGGTTGGATGG + Intergenic
1198854960 X:141005848-141005870 CATCTCCTCAAGTGGAAGGAGGG - Intergenic
1198877052 X:141239295-141239317 CATCTCCTCAAGTGGAAGGAGGG + Intergenic
1198907732 X:141581521-141581543 CATCTCCTCAAGTGGAAGGAGGG + Intergenic
1198909059 X:141592903-141592925 CATCTCCTCAAGTGGAAGGAGGG - Intronic
1198918020 X:141695248-141695270 CATCTCCTCAAGTGGAAGGAGGG + Intronic
1201553231 Y:15240553-15240575 CACCTACTCCAGAGGCTGAGGGG + Intergenic