ID: 1163340369

View in Genome Browser
Species Human (GRCh38)
Location 19:16702459-16702481
Sequence TACAGGACTTTGGGAGCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163340369_1163340372 -8 Left 1163340369 19:16702459-16702481 CCGGTGGCTCCCAAAGTCCTGTA No data
Right 1163340372 19:16702474-16702496 GTCCTGTAATTCCAGCACTTTGG No data
1163340369_1163340379 6 Left 1163340369 19:16702459-16702481 CCGGTGGCTCCCAAAGTCCTGTA No data
Right 1163340379 19:16702488-16702510 GCACTTTGGGAGGCCTAGGTGGG 0: 1094
1: 69471
2: 246985
3: 247518
4: 149777
1163340369_1163340382 25 Left 1163340369 19:16702459-16702481 CCGGTGGCTCCCAAAGTCCTGTA No data
Right 1163340382 19:16702507-16702529 TGGGCAGATCACTTGAGGTCAGG 0: 4862
1: 21986
2: 51846
3: 93563
4: 122168
1163340369_1163340375 -4 Left 1163340369 19:16702459-16702481 CCGGTGGCTCCCAAAGTCCTGTA No data
Right 1163340375 19:16702478-16702500 TGTAATTCCAGCACTTTGGGAGG 0: 11596
1: 306145
2: 263594
3: 149163
4: 135954
1163340369_1163340373 -7 Left 1163340369 19:16702459-16702481 CCGGTGGCTCCCAAAGTCCTGTA No data
Right 1163340373 19:16702475-16702497 TCCTGTAATTCCAGCACTTTGGG 0: 276
1: 18705
2: 316422
3: 269419
4: 148438
1163340369_1163340381 20 Left 1163340369 19:16702459-16702481 CCGGTGGCTCCCAAAGTCCTGTA No data
Right 1163340381 19:16702502-16702524 CTAGGTGGGCAGATCACTTGAGG 0: 84
1: 4139
2: 18581
3: 45933
4: 80227
1163340369_1163340376 2 Left 1163340369 19:16702459-16702481 CCGGTGGCTCCCAAAGTCCTGTA No data
Right 1163340376 19:16702484-16702506 TCCAGCACTTTGGGAGGCCTAGG 0: 141
1: 11888
2: 217516
3: 265514
4: 174598
1163340369_1163340378 5 Left 1163340369 19:16702459-16702481 CCGGTGGCTCCCAAAGTCCTGTA No data
Right 1163340378 19:16702487-16702509 AGCACTTTGGGAGGCCTAGGTGG 0: 2128
1: 148322
2: 179901
3: 114523
4: 58215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163340369 Original CRISPR TACAGGACTTTGGGAGCCAC CGG (reversed) Intergenic
No off target data available for this crispr