ID: 1163342674

View in Genome Browser
Species Human (GRCh38)
Location 19:16719699-16719721
Sequence GTCTAGGAGGTGCAGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163342674_1163342679 4 Left 1163342674 19:16719699-16719721 CCAACCAACTGCACCTCCTAGAC No data
Right 1163342679 19:16719726-16719748 AGCAAATGGCATCTTTTACGAGG No data
1163342674_1163342677 -10 Left 1163342674 19:16719699-16719721 CCAACCAACTGCACCTCCTAGAC No data
Right 1163342677 19:16719712-16719734 CCTCCTAGACTGTCAGCAAATGG No data
1163342674_1163342680 20 Left 1163342674 19:16719699-16719721 CCAACCAACTGCACCTCCTAGAC No data
Right 1163342680 19:16719742-16719764 TACGAGGAGCCGTATCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163342674 Original CRISPR GTCTAGGAGGTGCAGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr