ID: 1163343161

View in Genome Browser
Species Human (GRCh38)
Location 19:16722963-16722985
Sequence TGCTGGCCATACAACTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163343161 Original CRISPR TGCTGGCCATACAACTTCAC TGG Intronic
901366297 1:8752128-8752150 TCCTGTCCCTACCACTTCACTGG - Intronic
906888963 1:49686259-49686281 TGCTGGCAAAAGAACTTCAGTGG - Intronic
906972811 1:50534681-50534703 TGATTGATATACAACTTCACGGG + Intronic
907459351 1:54596127-54596149 GGCTGGCCACTCAGCTTCACTGG + Intronic
910167158 1:84339607-84339629 TGCTGGCCACAGAGTTTCACTGG + Intronic
910189482 1:84581052-84581074 TGCTGGGGATAAAACTGCACCGG - Intergenic
916392155 1:164342502-164342524 TGCTGGCAAAATCACTTCACTGG - Intergenic
920876488 1:209841060-209841082 TGCTGGCCATTCACATTCAGTGG + Intronic
921781011 1:219163617-219163639 TGATCACAATACAACTTCACTGG + Intergenic
922469433 1:225866812-225866834 TGCTGGCCACACAACCTCTGTGG - Intronic
1063285958 10:4688707-4688729 TGCTGGGAATACAACATCCCTGG + Intergenic
1075161072 10:120024982-120025004 TCATGGCCATAAAACTTCCCTGG - Intergenic
1076375762 10:129983673-129983695 TTCTGTCCAGAAAACTTCACAGG - Intergenic
1080244945 11:30169271-30169293 TGCAGGCCATACAATCTAACAGG - Intergenic
1080713364 11:34772170-34772192 TGCTGGCCAAAGTGCTTCACTGG + Intergenic
1084384321 11:68833160-68833182 TGCTGCCCAAAGAACTTCAAGGG + Intronic
1086133468 11:83423435-83423457 TGCTGGCTATATCCCTTCACTGG + Intergenic
1086866431 11:91985521-91985543 TGCTGGACATCCATCTTCAGGGG + Intergenic
1088526305 11:110759770-110759792 TGCTGGCTATACTACTGCATAGG + Intergenic
1088714513 11:112537102-112537124 TTATGGCCATACAACTCCCCCGG + Intergenic
1089651244 11:119914827-119914849 CCCTGGCCATTCAACTTCTCTGG - Intergenic
1098103420 12:67043151-67043173 TGATGGCCATAGAACTGCAAGGG - Intergenic
1098403150 12:70095150-70095172 TGCTGGACAGGCAGCTTCACGGG - Intergenic
1100791708 12:98137322-98137344 TGCTATCCATACAACTCCACTGG - Intergenic
1102056030 12:109897284-109897306 TGCTGGCCAGACATCCTCACCGG - Intergenic
1104077929 12:125406956-125406978 TGCTGTCCATACGACTCCACTGG - Intronic
1105515962 13:21090968-21090990 TGCTGGCTGTACAACCTAACTGG - Intergenic
1107230550 13:38104580-38104602 TGCTGGCAAAAGTACTTCACTGG - Intergenic
1107389198 13:39945552-39945574 TGCTGGCCAAAGCACTTCGCTGG - Intergenic
1113167816 13:107462786-107462808 TGCTGTCTATAGAATTTCACTGG + Intronic
1116282608 14:42928325-42928347 TGCTGGCCAAAGTGCTTCACTGG + Intergenic
1120909090 14:89649281-89649303 TGCTGGGCACACAACCCCACAGG + Intergenic
1122520821 14:102342276-102342298 TGCTTGCCATAGACCTTCTCTGG - Exonic
1127759502 15:62124295-62124317 TGCAAGCCATTCAACTTCTCTGG - Intergenic
1130606509 15:85322037-85322059 GCCTGGCCCTACGACTTCACCGG - Intergenic
1131137277 15:89947280-89947302 TCATGGCCATAAAACTTCCCTGG + Intergenic
1131419908 15:92296568-92296590 TGCTGGCTAAACAGCTTCTCAGG + Intergenic
1132244847 15:100286393-100286415 TGCTGGCCACAGTACTTCATAGG - Intronic
1132427088 15:101726733-101726755 GGCTGGCAATACACCTTCACAGG + Intergenic
1135309382 16:21393372-21393394 TGCTAGAAATGCAACTTCACAGG - Intergenic
1136148959 16:28333685-28333707 TGCTAGAAATGCAACTTCACAGG - Intergenic
1137223075 16:46474621-46474643 TGATGGCTATACAACTTTCCTGG - Intergenic
1141010420 16:80391826-80391848 TGCTGGGCATTCAGCTTCAGAGG - Intergenic
1148454076 17:47801546-47801568 TGCTGGCCTTACCCCTTCACCGG - Intergenic
1149627207 17:58088341-58088363 TGCTCAACATACAACTTCTCTGG - Intronic
1152235563 17:79136554-79136576 TGCTGGCCACTCAACTTTCCAGG + Intronic
1156642524 18:39119618-39119640 TCCTGGGAATATAACTTCACTGG + Intergenic
1163343161 19:16722963-16722985 TGCTGGCCATACAACTTCACTGG + Intronic
1164285938 19:23817791-23817813 TGCTGACCTTGCAGCTTCACTGG + Intronic
1165521287 19:36316249-36316271 TGCTGGAAATACAGATTCACAGG - Intergenic
1165622776 19:37262341-37262363 TGCTGGAAATACAGATTCACAGG + Intergenic
1165634471 19:37328971-37328993 TGCTGGAAATACAGATTCACAGG + Intronic
1167567197 19:50264153-50264175 TGTTGTCCACAGAACTTCACTGG - Intronic
933607355 2:84397330-84397352 TTCTGGCTACACAACTTCACTGG - Intergenic
935711528 2:105903137-105903159 TACTAGCCATACAAACTCACTGG + Intergenic
937492744 2:122386921-122386943 TGATGGCCACACACCTTCCCTGG - Intergenic
938066973 2:128286547-128286569 TGCAGGCCATCCAAATGCACGGG + Intronic
940991812 2:160104917-160104939 TCCTGGCCATAGGACTGCACTGG - Intronic
948834190 2:240616875-240616897 TACTGGCCATGCCTCTTCACAGG - Intronic
1168940011 20:1701537-1701559 TGATGGCCATACATCTCCCCAGG + Intergenic
1172172123 20:32943641-32943663 GGCTGGCCATACCATTTCCCTGG + Intronic
1174222342 20:48966760-48966782 TGCTGGCATTACAACTTAATGGG - Intronic
1174781241 20:53390929-53390951 TGCTAGCCATACAGCTTCTTTGG + Intronic
1176080465 20:63270104-63270126 TGCAGGTCCCACAACTTCACAGG + Intronic
1179254315 21:39701887-39701909 AGCTGGCCACACAGCATCACTGG + Intergenic
1183406241 22:37632007-37632029 TGCTGGTCATACACAGTCACGGG - Exonic
949594739 3:5531909-5531931 TGCTGGCCAAAGCACATCACTGG + Intergenic
951574593 3:24100884-24100906 TGCTGGCCAGTCAGCTTCATGGG - Intergenic
952759469 3:36901300-36901322 TCATGGCCATAAAACTTCCCTGG - Intronic
953625071 3:44563951-44563973 TGCTGGTCCTACCACTACACTGG + Intronic
954210622 3:49094896-49094918 TGGTGGCCTTCCAAGTTCACGGG - Intergenic
954961357 3:54567858-54567880 TGTTTTCCATACAACATCACTGG - Intronic
955006226 3:54971206-54971228 TGTGGACCATACAACTTCACAGG - Intronic
955393670 3:58539341-58539363 TGCTGTCCATACAACACCACTGG - Intergenic
955413292 3:58669891-58669913 TCCAGGTCACACAACTTCACAGG - Intergenic
955538269 3:59947764-59947786 TGCTGGCCAAAGCACTTCACTGG + Intronic
957883408 3:86251492-86251514 TGTTTGCCATACATCTTCTCTGG - Intergenic
960118897 3:113926943-113926965 TGCTGGCCAAAGCAATTCACTGG + Intronic
961807353 3:129498992-129499014 AGCTGGGCATACCACTTCAGAGG + Intronic
965270538 3:166612601-166612623 TGCTGTCCTGACTACTTCACTGG + Intergenic
968754659 4:2409109-2409131 TGATGGCCATGCAACTCCACGGG - Intronic
971283916 4:25268677-25268699 TGCTTGCCATAAAACCTGACAGG + Intronic
994895130 5:105693363-105693385 TCATGGCCATAAAACTTCCCTGG - Intergenic
998887954 5:146714303-146714325 TGGTGGCCATAAAACTTGATCGG + Intronic
1008514073 6:52303112-52303134 AGCTGGCCACACATCTTCAAAGG - Intergenic
1014758235 6:125325915-125325937 TGCTGACCATAGCACTGCACAGG - Intergenic
1018365167 6:163112517-163112539 TACTGGCCATATAAGTTCCCTGG - Intronic
1022524514 7:31028594-31028616 TCCTGGCCACACACCTTCAGTGG + Intergenic
1029912799 7:104173177-104173199 TGCTGGGCAAACATCCTCACAGG - Intronic
1032520240 7:132538289-132538311 TGCTGATCATATAACTTCATGGG - Intronic
1032768934 7:135028594-135028616 TGAGGGCTACACAACTTCACTGG - Intronic
1034093679 7:148387007-148387029 TCATGGCCATAAAACTTCCCTGG + Intronic
1036728676 8:11242841-11242863 TGCTTGCCATACAAGTACCCTGG + Intergenic
1039395062 8:37218612-37218634 TGCTGGCCATCCAATATCTCTGG + Intergenic
1039677873 8:39690173-39690195 TGCTGGCAATACCACTCCATAGG + Intronic
1041030149 8:53728542-53728564 TGCTCGCATTACAATTTCACTGG + Intronic
1041277525 8:56178111-56178133 TCCTTCCCATAGAACTTCACTGG - Intronic
1041642282 8:60216231-60216253 TGCTGCTCATAGAATTTCACAGG - Intronic
1042386304 8:68178855-68178877 TGATTGCAATACAACTTCACTGG - Intronic
1043131800 8:76472099-76472121 TGCTGGCCACAACACTTCAATGG + Intergenic
1044640805 8:94379428-94379450 TGTTGTCCATAAAACTCCACTGG + Intronic
1044696727 8:94930652-94930674 TGCTGCTCATACAACTTTTCTGG - Exonic
1045427362 8:102080489-102080511 AGCTGGTCATAGAACTTCAGGGG + Intronic
1046321195 8:112578547-112578569 TGCTGGACATATAAGATCACCGG + Intronic
1046899072 8:119504466-119504488 TGCTGGGCATGCAACTATACTGG - Intergenic
1047245276 8:123137515-123137537 TGCTGTCTGTACAACTCCACTGG - Intronic
1048852537 8:138658565-138658587 TGCTGTCTGCACAACTTCACTGG + Intronic
1050664279 9:7917771-7917793 TGCTGGCAAGCAAACTTCACTGG - Intergenic
1055010979 9:71564946-71564968 TGCTGGCCTAACAACTTTGCTGG - Intergenic
1056040794 9:82664561-82664583 TTCTGGCAAGACTACTTCACAGG - Intergenic
1056418313 9:86399230-86399252 TTCTGGCTATACACCTTCAATGG - Intergenic
1057157861 9:92859901-92859923 TGCTGTCCATATGACTCCACTGG - Intronic
1058916260 9:109568719-109568741 TGCTGGCAAAAGCACTTCACTGG - Intergenic
1061398244 9:130354977-130354999 TGCTGGCCACACAGCTGTACAGG - Intronic
1187607739 X:20905176-20905198 TGCTGGCCAAACTGCTTCACTGG + Intergenic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1189503984 X:41592901-41592923 TTCTATCCATACAACTTCATAGG + Intronic
1190580632 X:51890262-51890284 CACTGGCCATACAACTCCATTGG + Intronic
1194605622 X:95974861-95974883 AGCAGGGGATACAACTTCACAGG + Intergenic
1197997668 X:132395966-132395988 TGCTGGCCATACAAAAACACAGG - Intronic
1198947315 X:142029078-142029100 TGCAGGCTATACAACTGTACAGG - Intergenic
1199786943 X:151114334-151114356 TGCTGGCCAAAGTACTTCACTGG + Intergenic
1200665128 Y:6012720-6012742 TGATGGCCAAAGAGCTTCACTGG + Intergenic