ID: 1163344594

View in Genome Browser
Species Human (GRCh38)
Location 19:16732426-16732448
Sequence CCTGAAGCCCAGTACGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163344594_1163344608 25 Left 1163344594 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1163344608 19:16732474-16732496 TGGGGGATGGGCATGGAGGTTGG 0: 1
1: 1
2: 16
3: 117
4: 1071
1163344594_1163344599 -8 Left 1163344594 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1163344599 19:16732441-16732463 GCTTCAGGAGGAGTATAAGAGGG 0: 1
1: 0
2: 2
3: 10
4: 154
1163344594_1163344602 7 Left 1163344594 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1163344602 19:16732456-16732478 TAAGAGGGCTTTGCGATATGGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1163344594_1163344600 5 Left 1163344594 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1163344600 19:16732454-16732476 TATAAGAGGGCTTTGCGATATGG 0: 1
1: 0
2: 0
3: 6
4: 56
1163344594_1163344601 6 Left 1163344594 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1163344601 19:16732455-16732477 ATAAGAGGGCTTTGCGATATGGG 0: 1
1: 0
2: 1
3: 6
4: 68
1163344594_1163344603 8 Left 1163344594 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1163344603 19:16732457-16732479 AAGAGGGCTTTGCGATATGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1163344594_1163344605 13 Left 1163344594 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1163344605 19:16732462-16732484 GGCTTTGCGATATGGGGGATGGG 0: 1
1: 0
2: 0
3: 4
4: 79
1163344594_1163344606 18 Left 1163344594 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1163344606 19:16732467-16732489 TGCGATATGGGGGATGGGCATGG 0: 1
1: 0
2: 0
3: 20
4: 230
1163344594_1163344598 -9 Left 1163344594 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1163344598 19:16732440-16732462 GGCTTCAGGAGGAGTATAAGAGG 0: 1
1: 0
2: 1
3: 13
4: 131
1163344594_1163344607 21 Left 1163344594 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1163344607 19:16732470-16732492 GATATGGGGGATGGGCATGGAGG 0: 1
1: 0
2: 17
3: 175
4: 1370
1163344594_1163344604 12 Left 1163344594 19:16732426-16732448 CCCTCTTCGTACTGGGCTTCAGG 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1163344604 19:16732461-16732483 GGGCTTTGCGATATGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163344594 Original CRISPR CCTGAAGCCCAGTACGAAGA GGG (reversed) Intronic
900426789 1:2584162-2584184 CCTGGACCCCAGAACGAAGGAGG + Intergenic
900955291 1:5882993-5883015 TCTGAAGCCCAGGAAGAACAGGG + Intronic
901498493 1:9636741-9636763 CCTGAAGCCGGGTAGGAGGAGGG - Intergenic
901863406 1:12088897-12088919 GCTGAAGCCCAGGATGAAGAGGG - Intronic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903835463 1:26200750-26200772 CCTGAAGCCAAGCAGGAAAAGGG + Intronic
905171952 1:36114851-36114873 CCTCCAGCCCAGAACCAAGAAGG - Intronic
908219927 1:61994883-61994905 CCTAAAGCCCAATGAGAAGATGG - Intronic
908260791 1:62338136-62338158 CCTGTGGCCCAGCACGAAAAGGG - Intergenic
912764394 1:112395981-112396003 CCTGAAGCCCAGGACCCAGGAGG + Intergenic
921023619 1:211258954-211258976 CCTGCAGCCCGGTCCGCAGAGGG + Intronic
922956875 1:229610402-229610424 CCTGAAGCCCAATAAAATGAAGG + Intronic
923095316 1:230770780-230770802 TCTCAAGCCCAGTACTTAGAAGG + Intronic
924607991 1:245551699-245551721 CCGGAAGCCCAGAAGGAAGTTGG + Intronic
1064772498 10:18738008-18738030 CCTGAAGCCCAGTGCTGAGTTGG + Intergenic
1070700721 10:78599874-78599896 ACTGAAGCCCAGGATGAAAAAGG + Intergenic
1070998557 10:80808506-80808528 ACTGAAGCCAAGTACTAAAAGGG - Intergenic
1071920306 10:90342353-90342375 CCTGATGCCCAGGACTAAGGAGG + Intergenic
1072258212 10:93641266-93641288 CCTGAAGGCCTATAGGAAGAAGG - Intronic
1072825262 10:98599415-98599437 CCTGAAGCCCAGGACCACTAGGG + Intronic
1073290653 10:102411706-102411728 CCTGAAGCCCTGTCCTCAGAGGG - Exonic
1081790166 11:45776858-45776880 CCTCAAGCCCAGTACCAGGTGGG - Intergenic
1083367047 11:62147677-62147699 CCTGAAGCCACCCACGAAGATGG - Intronic
1086281522 11:85195064-85195086 TCTGAAGCCCAGGAAGAACAAGG + Intronic
1088431587 11:109765062-109765084 CCTGAAGCCCAGAACATACATGG - Intergenic
1090332880 11:125945012-125945034 CCTGAACCCCAGTGAGAAGGGGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1095959375 12:47824485-47824507 CCTCAAGCCCAAGACAAAGAAGG + Intronic
1096103934 12:48985832-48985854 CCTGAGGCCCAGGAGGAAGTGGG + Intergenic
1100990061 12:100242301-100242323 CCTGAAGACCATTACTATGAGGG + Intronic
1101556302 12:105813139-105813161 CCTGAAGCCTGTTACGAAGCTGG + Intergenic
1101640050 12:106581320-106581342 GCTGAGGCCCAGAACGATGAAGG + Intronic
1101795562 12:107969982-107970004 CCTGAAGCCCTCTACTAGGAAGG - Intergenic
1102629769 12:114267715-114267737 CCTGAAGCTCACTTCCAAGAGGG - Intergenic
1105284577 13:18993821-18993843 CCTGAAGGCCAGAAGTAAGAAGG + Intergenic
1105770922 13:23611047-23611069 CCTGAAGCCCAGGCTAAAGATGG + Intronic
1107067315 13:36228672-36228694 CCTGTAGCCTAGTACTCAGAAGG - Intronic
1110428820 13:75399813-75399835 TCTGCACCCCAGTATGAAGAAGG + Intronic
1112086574 13:96038545-96038567 GCAGAAGCCCAGTACAAACATGG - Intronic
1113142576 13:107170778-107170800 CATAAAGCCCTGTAGGAAGAAGG + Exonic
1123677372 15:22724092-22724114 CCTGAAGAGCTGTACGTAGATGG + Intergenic
1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG + Intronic
1126962938 15:54018210-54018232 CCCAAAGCCCAGTAAGCAGATGG - Intronic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128388040 15:67164621-67164643 CCTGAAGAGCAGTACAAAGTTGG + Intronic
1129258716 15:74350450-74350472 ACTGAGGCCCAGTGAGAAGAAGG - Intronic
1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG + Intergenic
1134041676 16:11073492-11073514 CCTGATGCCCAGTATGTAAAAGG + Intronic
1142781834 17:2187112-2187134 CCTTCAGCACAGTACCAAGATGG + Intronic
1143318552 17:6052425-6052447 CCTGAAGCGCAGGATGAGGAGGG + Intronic
1144773761 17:17773666-17773688 CCTGATGCCCAGCACACAGAGGG + Intronic
1145715460 17:27015576-27015598 CCTGAAGCTCAGTAAGATAATGG - Intergenic
1147542282 17:41370339-41370361 CCTGCAGCCCCATAGGAAGAGGG - Intronic
1149268615 17:54953666-54953688 CAGGAAGCCCAGGAAGAAGATGG - Intronic
1157169590 18:45390272-45390294 CATGAAGCCCAGTGACAAGATGG - Intronic
1157596239 18:48865551-48865573 CCTGGAACACAGTACGATGATGG + Intergenic
1163344594 19:16732426-16732448 CCTGAAGCCCAGTACGAAGAGGG - Intronic
1163708500 19:18831862-18831884 CCTGGTGCCCAGCAGGAAGACGG - Intergenic
1164146787 19:22517563-22517585 CCTGAAGCCCTCCAGGAAGAGGG - Intronic
1164576394 19:29407797-29407819 ACTGAGGCCCAGTGAGAAGAAGG + Intergenic
1166256176 19:41606444-41606466 CCTGAAGGGCAGTGTGAAGAAGG + Intronic
1168510739 19:56971620-56971642 CCAGACGCCCAGTAGGAAGGCGG + Intergenic
925025247 2:602101-602123 CCTCAAGCCCTGGAGGAAGAAGG - Intergenic
925578438 2:5384819-5384841 CATGAGGCCCAGAACGCAGATGG + Intergenic
925898081 2:8488531-8488553 CCTGAAGCCCAGTAGGCATCGGG - Intergenic
928913175 2:36443388-36443410 CCCAAAGCCAAGTACGAAGGAGG - Intronic
934538426 2:95155928-95155950 CCTGAAGCTCAGAGAGAAGAGGG + Intronic
934923908 2:98367908-98367930 CCTAAAGCCCAGTAGGAATGTGG - Intronic
935861834 2:107339578-107339600 CCTGATGTCCTGTAAGAAGAAGG + Intergenic
941683343 2:168422454-168422476 TTTGAACCCCAGTAGGAAGAGGG + Intergenic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947455530 2:230250535-230250557 CCTGATGCCCAGTATGAGAAAGG + Intronic
947456041 2:230254997-230255019 CCTGATACCCAGTATGAAAAAGG + Intronic
1170188245 20:13616978-13617000 CCTGAAGAGCTGTACGCAGATGG - Intronic
1172910341 20:38404321-38404343 CCTGGATCCCAGAATGAAGAGGG - Intergenic
1174079185 20:47958865-47958887 CCTGTAGCCCAGTATGAACAGGG - Intergenic
1174379354 20:50146744-50146766 CGTGAAGCCCAGGAAGGAGAAGG + Intronic
1175869297 20:62200573-62200595 CCTGGAGCCCACTGCGAAGGCGG - Intronic
1181652998 22:24271161-24271183 CCCGAAGCCCAGAACGAGGACGG - Intronic
1184024306 22:41843341-41843363 CCTGGAGCCCAGTACAAAACAGG - Intronic
1184034656 22:41912749-41912771 CCTGAAGCCCAGAAAGGAGAAGG + Intronic
955280102 3:57586562-57586584 CCTGTATCCGAGTACGAAGTGGG - Intronic
962939623 3:140114063-140114085 CCTGAACTCCAGCAAGAAGATGG - Intronic
967182900 3:186922070-186922092 CCTTGAGCCCTGTACAAAGAGGG + Intergenic
969044312 4:4325650-4325672 ACTGAAGACCAGTGAGAAGAGGG - Intergenic
971360286 4:25932222-25932244 CCTGACAGCCAGTACAAAGAGGG - Intergenic
976002360 4:80387554-80387576 CCTGAACCCCAGTAGGCAGGAGG - Intronic
979052831 4:115955770-115955792 CCTGAAGCCATGTTAGAAGATGG + Intergenic
997953895 5:138263649-138263671 CCTGGATCCCAGAATGAAGAAGG + Intronic
999637742 5:153640294-153640316 CCTGATGCCCAGTTGGAAGATGG - Intronic
1003790254 6:9538443-9538465 CCTGAAGCCCAGTAAATTGAAGG - Intergenic
1013758834 6:113492673-113492695 CCTGAAGCACAGTCATAAGAAGG - Intergenic
1015944659 6:138487678-138487700 GTGGAAGCCAAGTACGAAGATGG + Intronic
1016132746 6:140497291-140497313 CCAGAATCCCAGTTAGAAGACGG + Intergenic
1017152367 6:151291957-151291979 TCTGAAGCCCACTAGGCAGAGGG - Intronic
1025582342 7:62736339-62736361 TCTGAAGCCCAGGAAGAACAAGG + Intergenic
1029254090 7:99257306-99257328 GCTGAAGCCCAGTACGTCAAAGG - Intergenic
1029927697 7:104334990-104335012 ACTGATGCCCAGTAAGAAGTGGG - Intronic
1030879073 7:114853633-114853655 CCTGCACCCCACTACGAACAAGG - Intergenic
1031743731 7:125468189-125468211 CCAGCAGCCCAGTCTGAAGATGG + Intergenic
1033146266 7:138872819-138872841 CCTTAAGCCCAGGAGGTAGAGGG + Intronic
1035725016 8:1818856-1818878 CCTGAGGCACTGTCCGAAGATGG - Intergenic
1046597277 8:116274975-116274997 CCTGAAGACATGTACAAAGAAGG + Intergenic
1049788272 8:144461707-144461729 CCTGAAGAACAGTAAGGAGAGGG - Intronic
1055788198 9:79893594-79893616 CCTGAGGTCCAGTACAAAAATGG - Intergenic
1056301896 9:85250292-85250314 CCTGAAGCCCTGTGAGTAGAGGG - Intergenic
1056619340 9:88197815-88197837 CCTGAAAGCCAGAAAGAAGAAGG - Intergenic
1057336018 9:94155911-94155933 CCTAAAGCCCAGCACCAAGCTGG - Intergenic
1059091388 9:111362448-111362470 ACTGAAGCATAGTAGGAAGAAGG + Intronic
1062636381 9:137493751-137493773 CCTGCAGGCCAGGACAAAGATGG + Intronic
1185483090 X:462929-462951 CCGCAAGCCCAGGACGAACAAGG - Intergenic
1186641647 X:11461926-11461948 CCTGAAGCCCAGGGCTAGGAGGG + Intronic
1195745189 X:108110285-108110307 CCTTAAGCCCAGAAAGAGGAGGG + Intronic
1200794992 Y:7332857-7332879 GCTGAAGCCCAGGACGCTGAGGG - Intergenic