ID: 1163345226

View in Genome Browser
Species Human (GRCh38)
Location 19:16737042-16737064
Sequence TTCTATAGACATAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163345226_1163345237 21 Left 1163345226 19:16737042-16737064 CCCTCCACTTTATGTCTATAGAA No data
Right 1163345237 19:16737086-16737108 TGGAAAAGGTGGAAACCCACAGG 0: 1
1: 0
2: 1
3: 25
4: 216
1163345226_1163345240 29 Left 1163345226 19:16737042-16737064 CCCTCCACTTTATGTCTATAGAA No data
Right 1163345240 19:16737094-16737116 GTGGAAACCCACAGGGTCTTGGG 0: 1
1: 0
2: 5
3: 15
4: 156
1163345226_1163345233 7 Left 1163345226 19:16737042-16737064 CCCTCCACTTTATGTCTATAGAA No data
Right 1163345233 19:16737072-16737094 ATCCTGGAAAGCCATGGAAAAGG 0: 1
1: 1
2: 2
3: 33
4: 312
1163345226_1163345239 28 Left 1163345226 19:16737042-16737064 CCCTCCACTTTATGTCTATAGAA No data
Right 1163345239 19:16737093-16737115 GGTGGAAACCCACAGGGTCTTGG 0: 1
1: 0
2: 3
3: 10
4: 173
1163345226_1163345238 22 Left 1163345226 19:16737042-16737064 CCCTCCACTTTATGTCTATAGAA No data
Right 1163345238 19:16737087-16737109 GGAAAAGGTGGAAACCCACAGGG 0: 1
1: 0
2: 3
3: 22
4: 262
1163345226_1163345232 1 Left 1163345226 19:16737042-16737064 CCCTCCACTTTATGTCTATAGAA No data
Right 1163345232 19:16737066-16737088 TTTGGGATCCTGGAAAGCCATGG 0: 1
1: 0
2: 2
3: 16
4: 229
1163345226_1163345235 10 Left 1163345226 19:16737042-16737064 CCCTCCACTTTATGTCTATAGAA No data
Right 1163345235 19:16737075-16737097 CTGGAAAGCCATGGAAAAGGTGG 0: 1
1: 0
2: 2
3: 37
4: 316
1163345226_1163345231 -9 Left 1163345226 19:16737042-16737064 CCCTCCACTTTATGTCTATAGAA No data
Right 1163345231 19:16737056-16737078 TCTATAGAACTTTGGGATCCTGG 0: 1
1: 0
2: 0
3: 10
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163345226 Original CRISPR TTCTATAGACATAAAGTGGA GGG (reversed) Intronic
No off target data available for this crispr