ID: 1163347067

View in Genome Browser
Species Human (GRCh38)
Location 19:16749997-16750019
Sequence GGGGCAGTTGAGAGGCAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 498}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163347067_1163347080 14 Left 1163347067 19:16749997-16750019 CCTGGCTGCCTCTCAACTGCCCC 0: 1
1: 0
2: 2
3: 40
4: 498
Right 1163347080 19:16750034-16750056 CATCCTCTCAGCTTGCTCGGGGG 0: 1
1: 0
2: 6
3: 9
4: 112
1163347067_1163347082 20 Left 1163347067 19:16749997-16750019 CCTGGCTGCCTCTCAACTGCCCC 0: 1
1: 0
2: 2
3: 40
4: 498
Right 1163347082 19:16750040-16750062 CTCAGCTTGCTCGGGGGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 131
1163347067_1163347084 22 Left 1163347067 19:16749997-16750019 CCTGGCTGCCTCTCAACTGCCCC 0: 1
1: 0
2: 2
3: 40
4: 498
Right 1163347084 19:16750042-16750064 CAGCTTGCTCGGGGGCACTGGGG 0: 1
1: 0
2: 0
3: 14
4: 146
1163347067_1163347085 23 Left 1163347067 19:16749997-16750019 CCTGGCTGCCTCTCAACTGCCCC 0: 1
1: 0
2: 2
3: 40
4: 498
Right 1163347085 19:16750043-16750065 AGCTTGCTCGGGGGCACTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 112
1163347067_1163347077 11 Left 1163347067 19:16749997-16750019 CCTGGCTGCCTCTCAACTGCCCC 0: 1
1: 0
2: 2
3: 40
4: 498
Right 1163347077 19:16750031-16750053 CCTCATCCTCTCAGCTTGCTCGG 0: 1
1: 0
2: 16
3: 1054
4: 23494
1163347067_1163347079 13 Left 1163347067 19:16749997-16750019 CCTGGCTGCCTCTCAACTGCCCC 0: 1
1: 0
2: 2
3: 40
4: 498
Right 1163347079 19:16750033-16750055 TCATCCTCTCAGCTTGCTCGGGG 0: 1
1: 0
2: 0
3: 12
4: 125
1163347067_1163347083 21 Left 1163347067 19:16749997-16750019 CCTGGCTGCCTCTCAACTGCCCC 0: 1
1: 0
2: 2
3: 40
4: 498
Right 1163347083 19:16750041-16750063 TCAGCTTGCTCGGGGGCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 111
1163347067_1163347086 29 Left 1163347067 19:16749997-16750019 CCTGGCTGCCTCTCAACTGCCCC 0: 1
1: 0
2: 2
3: 40
4: 498
Right 1163347086 19:16750049-16750071 CTCGGGGGCACTGGGGGTTTTGG 0: 1
1: 0
2: 0
3: 18
4: 232
1163347067_1163347078 12 Left 1163347067 19:16749997-16750019 CCTGGCTGCCTCTCAACTGCCCC 0: 1
1: 0
2: 2
3: 40
4: 498
Right 1163347078 19:16750032-16750054 CTCATCCTCTCAGCTTGCTCGGG 0: 1
1: 0
2: 0
3: 33
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163347067 Original CRISPR GGGGCAGTTGAGAGGCAGCC AGG (reversed) Exonic