ID: 1163349940

View in Genome Browser
Species Human (GRCh38)
Location 19:16770188-16770210
Sequence TAATCCCCACACATTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4736
Summary {0: 1, 1: 23, 2: 220, 3: 1034, 4: 3458}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163349934_1163349940 7 Left 1163349934 19:16770158-16770180 CCCAGCTATCATCTTGAATTGTA 0: 1
1: 11
2: 383
3: 8149
4: 11172
Right 1163349940 19:16770188-16770210 TAATCCCCACACATTGAGGGAGG 0: 1
1: 23
2: 220
3: 1034
4: 3458
1163349935_1163349940 6 Left 1163349935 19:16770159-16770181 CCAGCTATCATCTTGAATTGTAT 0: 1
1: 1
2: 24
3: 600
4: 9186
Right 1163349940 19:16770188-16770210 TAATCCCCACACATTGAGGGAGG 0: 1
1: 23
2: 220
3: 1034
4: 3458
1163349932_1163349940 11 Left 1163349932 19:16770154-16770176 CCCACCCAGCTATCATCTTGAAT 0: 1
1: 12
2: 442
3: 8944
4: 11590
Right 1163349940 19:16770188-16770210 TAATCCCCACACATTGAGGGAGG 0: 1
1: 23
2: 220
3: 1034
4: 3458
1163349931_1163349940 12 Left 1163349931 19:16770153-16770175 CCCCACCCAGCTATCATCTTGAA 0: 1
1: 11
2: 418
3: 8949
4: 12502
Right 1163349940 19:16770188-16770210 TAATCCCCACACATTGAGGGAGG 0: 1
1: 23
2: 220
3: 1034
4: 3458
1163349933_1163349940 10 Left 1163349933 19:16770155-16770177 CCACCCAGCTATCATCTTGAATT 0: 1
1: 12
2: 476
3: 8989
4: 11784
Right 1163349940 19:16770188-16770210 TAATCCCCACACATTGAGGGAGG 0: 1
1: 23
2: 220
3: 1034
4: 3458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163349940 Original CRISPR TAATCCCCACACATTGAGGG AGG Intronic
Too many off-targets to display for this crispr