ID: 1163359346

View in Genome Browser
Species Human (GRCh38)
Location 19:16836080-16836102
Sequence CGCCAAAGGCTGCCCGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163359346_1163359355 18 Left 1163359346 19:16836080-16836102 CCAGCCTCGGGCAGCCTTTGGCG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1163359355 19:16836121-16836143 GGGGGCCAGACTGTTCTTTATGG 0: 1
1: 0
2: 0
3: 6
4: 127
1163359346_1163359357 23 Left 1163359346 19:16836080-16836102 CCAGCCTCGGGCAGCCTTTGGCG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1163359357 19:16836126-16836148 CCAGACTGTTCTTTATGGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 95
1163359346_1163359354 0 Left 1163359346 19:16836080-16836102 CCAGCCTCGGGCAGCCTTTGGCG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1163359354 19:16836103-16836125 CAGGGTGTCTTCAGCTTTGGGGG 0: 1
1: 0
2: 2
3: 27
4: 240
1163359346_1163359353 -1 Left 1163359346 19:16836080-16836102 CCAGCCTCGGGCAGCCTTTGGCG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1163359353 19:16836102-16836124 GCAGGGTGTCTTCAGCTTTGGGG 0: 1
1: 0
2: 1
3: 21
4: 199
1163359346_1163359351 -3 Left 1163359346 19:16836080-16836102 CCAGCCTCGGGCAGCCTTTGGCG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1163359351 19:16836100-16836122 GCGCAGGGTGTCTTCAGCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 91
1163359346_1163359352 -2 Left 1163359346 19:16836080-16836102 CCAGCCTCGGGCAGCCTTTGGCG 0: 1
1: 0
2: 0
3: 12
4: 116
Right 1163359352 19:16836101-16836123 CGCAGGGTGTCTTCAGCTTTGGG 0: 1
1: 0
2: 1
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163359346 Original CRISPR CGCCAAAGGCTGCCCGAGGC TGG (reversed) Intronic
900254654 1:1691764-1691786 CGCCAAAGGCACCCCGTGGAGGG + Intronic
900263406 1:1745039-1745061 CGCCAAAGGCACCCCGTGGAGGG + Intronic
900996041 1:6124231-6124253 CGCCCAAGGCTGGCCAAGCCAGG + Intronic
901232472 1:7648889-7648911 CGCCAGAGGCTGCTATAGGCCGG - Intronic
901635008 1:10666456-10666478 CTGCAGAGGCTGGCCGAGGCTGG - Intronic
902516470 1:16992270-16992292 CGTCAAAGGCTCCCCGGAGCTGG - Exonic
902680745 1:18042221-18042243 CGCCAATGGGTCCCAGAGGCAGG + Intergenic
902839944 1:19068261-19068283 CCCGAGAGGCTGCCAGAGGCTGG + Intergenic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
903466211 1:23554315-23554337 CCCTAAAGCCTGCCCCAGGCTGG + Intergenic
907909648 1:58815072-58815094 CCCCAAAGGCAGCCCCAGGACGG + Intergenic
911964280 1:104346429-104346451 AGAGAAAGGCAGCCCGAGGCGGG - Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
922782441 1:228263896-228263918 CACCAAGGGCTGCCCCAGGCAGG - Intronic
1065521667 10:26579685-26579707 CACCAAAGCCAGCCCCAGGCAGG + Intergenic
1065527490 10:26637949-26637971 CACCAAAGCCAGCCCAAGGCAGG + Intergenic
1065559064 10:26944233-26944255 CACCAAAGCCAGCCCCAGGCAGG - Intergenic
1065559350 10:26946439-26946461 CACCAAAGCCAGCCCCAGGCAGG - Intergenic
1072938095 10:99732440-99732462 GGCCGAAGGCTCCCCGGGGCGGG + Intronic
1073131100 10:101189756-101189778 CCCCCAAGGCTGGCAGAGGCTGG + Intergenic
1076881238 10:133240185-133240207 CGCCAGAGGCTGCCCGCAGCAGG - Exonic
1077806641 11:5596697-5596719 GGCCAAAGGCTGGCGGAGGAGGG + Exonic
1081871149 11:46383055-46383077 GACCAAATGCTGCCCGTGGCTGG - Intronic
1095962587 12:47844728-47844750 CGCCACAGGCTGTCCTAGTCAGG + Exonic
1097803545 12:63940819-63940841 TGCCACATGCTGCCTGAGGCAGG - Intronic
1098750985 12:74292974-74292996 CGCCAGAGGCTGCCCACAGCAGG - Intergenic
1104001608 12:124863918-124863940 AGCCCAAGGCTGCCCGGGGGCGG - Intronic
1104239371 12:126972626-126972648 AGCCAAAGGCAGCCAGATGCAGG - Intergenic
1104929212 12:132329391-132329413 CGCAGAGGGCTGCCCGGGGCTGG + Intergenic
1107132512 13:36911601-36911623 GGCCAAAGGCTGCCTGGGGGGGG + Intronic
1108548911 13:51523408-51523430 CGCCAAAGGCTGGGGGAGGAAGG + Intergenic
1109217638 13:59608034-59608056 CACCAAAAACTGCCCTAGGCAGG + Intergenic
1111125406 13:83907406-83907428 GGCCAGAGGCTGCCCGCAGCAGG + Intergenic
1117963065 14:61181270-61181292 AGCTAAAGGCTGGCTGAGGCTGG + Intergenic
1118768989 14:68929222-68929244 AGACCAAGGCTGCCCCAGGCTGG - Intronic
1121972697 14:98373212-98373234 TGCCAGAGGCTACCAGAGGCTGG + Intergenic
1123041517 14:105492141-105492163 CTCCCAGGGCTACCCGAGGCTGG + Exonic
1129231527 15:74199633-74199655 GGCCAGAGGCTCCCCCAGGCAGG - Intronic
1133188316 16:4115946-4115968 CGTCAAAGGCGGCGCGCGGCCGG + Exonic
1133301164 16:4783758-4783780 GGCCGCAGGCTGCCGGAGGCAGG + Exonic
1134043233 16:11083764-11083786 CGCCACAGGCAGCAGGAGGCTGG - Intronic
1134207921 16:12252782-12252804 CACCAAAGGCTCCCCATGGCTGG - Intronic
1142159430 16:88549126-88549148 CGGCAGTGGCTGCACGAGGCAGG + Intergenic
1142215860 16:88829519-88829541 AGACAAAGGCTGCCCTGGGCAGG + Intronic
1143097867 17:4488108-4488130 CGCTCAAGGCTGCCCCAGCCTGG + Exonic
1143976164 17:10831535-10831557 TGCCAAGGGTTGCTCGAGGCTGG + Intronic
1144701602 17:17344246-17344268 AGCCACAGGCTGCCCAAGGAAGG - Intronic
1147931230 17:43982933-43982955 TGCCAAAGGCAGCTGGAGGCCGG + Intronic
1148786544 17:50148791-50148813 CTCCAGAGGCTGCCAGAGGCTGG - Intronic
1152409902 17:80117985-80118007 ATCCCACGGCTGCCCGAGGCCGG - Intergenic
1152600006 17:81257558-81257580 GGCCAGAGGCTGCAGGAGGCAGG - Intronic
1152904559 17:82963135-82963157 CCCCCAAGGCTGCCCGAGGATGG - Intronic
1155055339 18:22177190-22177212 CGCCCAAGGCAGGCCGAGCCAGG - Intronic
1160836251 19:1126084-1126106 CGCCCAAGCCTGCCTGAGCCCGG + Intronic
1160905501 19:1450017-1450039 AGCCAATGGCGGCCCGGGGCGGG - Intronic
1161054940 19:2186108-2186130 TGGCAAAGGCTGTCAGAGGCCGG + Intronic
1161558817 19:4959352-4959374 AGCCACAGGCTGCCTGGGGCAGG + Intronic
1161810992 19:6471332-6471354 CACCGAAGGCTGGCTGAGGCTGG + Intronic
1163055704 19:14716040-14716062 CGCCAGAGGATGCTGGAGGCTGG - Intronic
1163359346 19:16836080-16836102 CGCCAAAGGCTGCCCGAGGCTGG - Intronic
1163641020 19:18462024-18462046 CGCCACCTGCTGCCCAAGGCAGG + Intronic
927753559 2:25690757-25690779 AGGCAACGGCTGCCGGAGGCTGG + Intergenic
928309216 2:30195704-30195726 CCCTAGAGGCTGCCAGAGGCAGG - Intergenic
934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG + Intronic
939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG + Intergenic
941203956 2:162548292-162548314 TCCCTAAGGCTGCCAGAGGCAGG + Intronic
947625173 2:231614367-231614389 GAACAAAGGCGGCCCGAGGCCGG - Intergenic
948978313 2:241478331-241478353 GCCCTAAGGCTGCCCCAGGCAGG - Intronic
1169230882 20:3888473-3888495 TACCAAAGGCTGCCCAAGCCCGG - Intergenic
1171790045 20:29514897-29514919 CACCAAAGCCAGCCCCAGGCAGG + Intergenic
1172383584 20:34516633-34516655 CTCTAAAGCCTGACCGAGGCGGG + Intronic
1172973547 20:38890348-38890370 TGCACAAGGCTGCACGAGGCTGG + Intronic
1175266092 20:57704323-57704345 TGCCAGGGGCTCCCCGAGGCTGG - Intronic
1175733740 20:61371355-61371377 CACCAAGGGCTGCCCCAGGAAGG - Intronic
1175920547 20:62448734-62448756 AGCCAATGGCTGCCAGAGGAGGG - Intergenic
1176232429 20:64039132-64039154 CGCCCTCTGCTGCCCGAGGCTGG - Intronic
1179919986 21:44502833-44502855 CCCCAAGGGCTCACCGAGGCCGG - Intronic
1179920149 21:44503365-44503387 CGCCGAGGGCTCACCGAGGCCGG - Intronic
1179920254 21:44503699-44503721 CGCCGAGGGCTCACCGAGGCCGG - Intronic
1181235191 22:21444297-21444319 CGCCAAGTGCTGCCCCAGCCTGG - Intronic
1185126074 22:49011573-49011595 AGCCACAGGCTCCCCGGGGCCGG - Intergenic
1185137194 22:49079737-49079759 GGCCAGAGGCTCCCCTAGGCAGG + Intergenic
950109569 3:10410447-10410469 AGCCAAAGGGTGGCCGAGCCAGG - Intronic
951334693 3:21406382-21406404 TGCCAGAGGCTGCCCGCAGCAGG - Intergenic
951502357 3:23402962-23402984 GGCCAAAGGCTGCTTGAGGAGGG + Intronic
954378182 3:50205692-50205714 CACCACAGGCTTCCTGAGGCAGG + Intronic
954707383 3:52488372-52488394 CAGCAAAGGCGCCCCGAGGCTGG - Exonic
959018254 3:101160328-101160350 CGCCAAAGTTTGCCAGTGGCTGG + Intergenic
962320761 3:134388524-134388546 TGCCAGAGAGTGCCCGAGGCTGG - Intergenic
965679654 3:171236831-171236853 TGCCAAATGCAGCCCGAAGCTGG + Intronic
968450865 4:675334-675356 GGCCAAAGGGGGCCCGAGGGTGG - Intronic
968891423 4:3371272-3371294 AGCCAGAGGCGGCCCGCGGCAGG - Intronic
968984553 4:3868068-3868090 CTACAAAGGATACCCGAGGCTGG + Intergenic
989188472 5:38646924-38646946 GGCCCCAGGCTGCCCCAGGCAGG + Intergenic
991400269 5:66244464-66244486 CTCCAAAGGCTGCCAGGGGAAGG - Intergenic
997267051 5:132501080-132501102 AGCCACAGGCTGCCCCAGGAAGG + Intergenic
1001504546 5:172266930-172266952 CCCCAGAGGCTGCCTGAGGCAGG + Intronic
1002456297 5:179346797-179346819 CACCTAAGGGTGCCCGAGGCTGG + Intergenic
1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG + Intronic
1006860564 6:37169677-37169699 CATCAAAGGCCGCCCGAGGCCGG - Intergenic
1007082103 6:39114949-39114971 CTCTAAAGGCAGCCCCAGGCTGG - Exonic
1011215444 6:85000673-85000695 AGCCAATGACTGCCTGAGGCAGG + Intergenic
1014550959 6:122789402-122789424 CGCCACGGGCAGCCCGAGGCCGG - Exonic
1020107856 7:5430440-5430462 CGTCAAAGCCTGCCTGAAGCAGG - Intergenic
1022903610 7:34834598-34834620 CACCAAAGGCTGTCACAGGCGGG + Intronic
1027421212 7:78019661-78019683 GGCCAGGGGCGGCCCGAGGCCGG - Exonic
1029906941 7:104101962-104101984 CTCCACAGGCTGCCCTAGGGAGG - Intergenic
1029978140 7:104852970-104852992 TGCCACCGTCTGCCCGAGGCAGG + Intronic
1032011968 7:128352611-128352633 CCCCGAAGGGTTCCCGAGGCTGG + Exonic
1032791554 7:135246551-135246573 CGCCCAGGCCTGCCGGAGGCTGG - Exonic
1036210008 8:6834336-6834358 CGCTAAGGGCTGCCTGAGCCCGG - Intronic
1037880857 8:22572757-22572779 CCCCCAGGGCTGCTCGAGGCAGG - Intronic
1039079648 8:33722406-33722428 CGCCAGAGGCTGCCCATAGCAGG + Intergenic
1039824309 8:41160044-41160066 TACCAGAGGCTGCCAGAGGCTGG - Intergenic
1040307210 8:46218299-46218321 CCCCCAAGGCTGTCCCAGGCCGG - Intergenic
1040330906 8:46385322-46385344 CCCCCAAGGCTGCCCCGGGCTGG + Intergenic
1045111885 8:98944430-98944452 CTCCCCAGGCTGCCCCAGGCCGG - Exonic
1048949136 8:139478621-139478643 CACCAAAAGCTGCTCCAGGCAGG - Intergenic
1050151608 9:2622956-2622978 TTCCAAACGCCGCCCGAGGCGGG - Intronic
1053352833 9:37424732-37424754 GGCCTCAGGCTGCCCGGGGCTGG - Intronic
1056816320 9:89803787-89803809 CTCCAAAGGCTCCCTGTGGCTGG + Intergenic
1058815605 9:108680291-108680313 CACCCAAGGCAGCCCAAGGCAGG + Intergenic
1060945759 9:127568738-127568760 CGCCAACTGCTGGCCGGGGCGGG + Intronic
1061208483 9:129177525-129177547 CTCCAAGGGCTGCCCGCGGTGGG + Exonic
1061284427 9:129613998-129614020 CCCCAATGGCTGCCCCAGGATGG + Intronic
1062624546 9:137436845-137436867 TGCCACAGGCTGCCTGAGGGCGG - Intronic
1062661690 9:137638874-137638896 CCCCAGAGCCTGGCCGAGGCAGG + Intronic
1189839848 X:45063576-45063598 GGCCAAAGGCTGCCCAGGGCAGG - Exonic
1195687863 X:107602030-107602052 AGCCAGAGGCAGCCAGAGGCTGG + Exonic