ID: 1163361071

View in Genome Browser
Species Human (GRCh38)
Location 19:16846774-16846796
Sequence ACGGGACCTGCCCATGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163361056_1163361071 20 Left 1163361056 19:16846731-16846753 CCCTCTGTTCGTGGACACTGCTG 0: 1
1: 0
2: 0
3: 17
4: 282
Right 1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1163361054_1163361071 22 Left 1163361054 19:16846729-16846751 CCCCCTCTGTTCGTGGACACTGC 0: 1
1: 0
2: 0
3: 14
4: 111
Right 1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1163361055_1163361071 21 Left 1163361055 19:16846730-16846752 CCCCTCTGTTCGTGGACACTGCT 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1163361052_1163361071 27 Left 1163361052 19:16846724-16846746 CCCTGCCCCCTCTGTTCGTGGAC 0: 1
1: 0
2: 0
3: 3
4: 148
Right 1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1163361065_1163361071 -8 Left 1163361065 19:16846759-16846781 CCACCATACTCCTGGACGGGACC 0: 1
1: 0
2: 2
3: 7
4: 76
Right 1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1163361057_1163361071 19 Left 1163361057 19:16846732-16846754 CCTCTGTTCGTGGACACTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1163361063_1163361071 -6 Left 1163361063 19:16846757-16846779 CCCCACCATACTCCTGGACGGGA 0: 1
1: 0
2: 1
3: 20
4: 563
Right 1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1163361064_1163361071 -7 Left 1163361064 19:16846758-16846780 CCCACCATACTCCTGGACGGGAC 0: 1
1: 0
2: 1
3: 17
4: 478
Right 1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1163361053_1163361071 26 Left 1163361053 19:16846725-16846747 CCTGCCCCCTCTGTTCGTGGACA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1163361050_1163361071 30 Left 1163361050 19:16846721-16846743 CCTCCCTGCCCCCTCTGTTCGTG 0: 1
1: 0
2: 1
3: 18
4: 325
Right 1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163361071 Original CRISPR ACGGGACCTGCCCATGGCCG GGG Intronic
902385288 1:16072722-16072744 AGGGGACCTGCCCTTGCCTGGGG - Intronic
903004595 1:20290462-20290484 AGAGGACCTGCCCATGACCACGG + Intergenic
903777099 1:25800223-25800245 CCGGGCCCGGCCCATGGCTGCGG - Exonic
912709283 1:111938215-111938237 AAGTGACCTGCCTCTGGCCGAGG + Intronic
914665578 1:149829716-149829738 CCAAGACCTGCCCATGGCCCTGG - Intergenic
914670187 1:149864078-149864100 CCAAGACCTGCCCATGGCCCTGG + Intronic
920800570 1:209183623-209183645 AGTGGAGCTGCCCAAGGCCGTGG + Intergenic
923725725 1:236503596-236503618 ACTAGAACTGCCCATGGTCGTGG + Intergenic
1065073175 10:22048926-22048948 ACTGGACTGGCCCATGGCCCTGG - Intergenic
1066649647 10:37642457-37642479 TCTGGACCTGCCCAGGGCCTGGG - Intergenic
1069615994 10:69806428-69806450 AGGGGACCAGCCCATGACGGGGG + Intronic
1071649814 10:87383698-87383720 AGGGGCACTGCCCATGGCCAGGG - Intergenic
1073448695 10:103596517-103596539 TTGGGACCTGCCCATTGCCAAGG + Exonic
1077053046 11:576233-576255 CCTGGACCAGCCCATGGTCGCGG + Intergenic
1078210346 11:9265195-9265217 AGGGGACCGGGCCAGGGCCGGGG - Exonic
1084561658 11:69909036-69909058 AAGAGACCTGCCCAGGGCTGAGG - Intergenic
1084677502 11:70644546-70644568 GCTGGTCCTGCCCTTGGCCGGGG - Intronic
1089497021 11:118913116-118913138 AGGGGGCCTTCCCATGGCCCTGG + Intronic
1089507206 11:118971892-118971914 CCGGGACCTGGCCATGGAGGCGG - Exonic
1090373796 11:126275143-126275165 ACGGGAACTGCCCTGGGCCGTGG + Intronic
1094410260 12:30160699-30160721 AAGGTACCTGTCCATGGCCCAGG - Intergenic
1098491960 12:71092619-71092641 CCTGGACCTGCCCAGGGCCTGGG - Intronic
1099467960 12:83010094-83010116 CTGGGACCTGTCCATGGCCTGGG + Intronic
1102151961 12:110694747-110694769 ACGGGATCTGCACAAGGCCTGGG + Intronic
1104040657 12:125128234-125128256 CCGGAACCTGGGCATGGCCGTGG + Exonic
1104665281 12:130643278-130643300 ACAGGACCTGCCAATGGGAGTGG - Intronic
1104757094 12:131276100-131276122 AAGGGACCTGCCCGTGTCTGGGG + Intergenic
1105713291 13:23034040-23034062 CCAGGACCTGCTCATGGCCACGG + Intergenic
1106038755 13:26069679-26069701 CCGTGGCCTGCCCGTGGCCGTGG + Intergenic
1111670126 13:91319981-91320003 CCGGGAGCTTCCCATGGCCAAGG + Intergenic
1113507263 13:110825835-110825857 ACTGGACCTGCACTTGACCGTGG - Intergenic
1113962400 13:114133065-114133087 GGGGGACCTGCCCATGCCGGAGG - Intergenic
1121124789 14:91399131-91399153 ATGAGAACTGCCCATGGCCAAGG - Intronic
1202894236 14_KI270722v1_random:188892-188914 ACTGGACCGGTCCATGGCCTGGG - Intergenic
1130342509 15:83011479-83011501 ACGGGACCTGCTACTGGCCTTGG + Exonic
1139853379 16:69963476-69963498 TCTGGAAGTGCCCATGGCCGTGG - Intronic
1139882348 16:70186385-70186407 TCTGGAAGTGCCCATGGCCGTGG - Intronic
1140370161 16:74409119-74409141 TCTGGAAGTGCCCATGGCCGTGG + Intronic
1140700275 16:77575089-77575111 AGGGGACCTGCCAAGGGCTGTGG + Intergenic
1144435826 17:15239635-15239657 AGGAGAGCTGGCCATGGCCGGGG + Intronic
1146499620 17:33353258-33353280 ACTGAACATGCCCATTGCCGTGG + Intronic
1151890752 17:76949283-76949305 AGGGGCCCTCCCCATGGCCCTGG + Exonic
1152146942 17:78574068-78574090 ACGGTTGCTGCCCATGGCCTGGG - Intronic
1152584038 17:81181264-81181286 TAGGGACGTGCCCATGGCCAAGG - Intergenic
1152744757 17:82033571-82033593 ACAGGGCCTGGCCATGGCCCGGG + Exonic
1156977185 18:43237443-43237465 TCTGGACCTACCCATGGCCTGGG - Intergenic
1160765342 19:805159-805181 GCTGGACCAGACCATGGCCGCGG + Exonic
1163361071 19:16846774-16846796 ACGGGACCTGCCCATGGCCGGGG + Intronic
1165100451 19:33435756-33435778 ACGGCCTCTGCCCATGGCCCTGG - Intronic
1165645501 19:37432073-37432095 TCTGGACCTGCCCGTGGCTGGGG + Intronic
1165861608 19:38912053-38912075 GCGGGACCTGCCAGGGGCCGGGG - Intronic
1167119843 19:47510236-47510258 ACAGGGCCTGCCCAGGGCCTTGG - Intronic
1168324219 19:55529972-55529994 CTGGGACCGGCCCCTGGCCGAGG - Exonic
926163997 2:10506759-10506781 TTGGGCCCTGCCCATGGCCAGGG + Intergenic
927215105 2:20663982-20664004 GCAGGACCTGCCCATGACCCAGG - Intergenic
928177710 2:29046394-29046416 ATGGGACCTTCCCAAGGCAGGGG - Intronic
929456903 2:42072651-42072673 TCTGGAACTGCCCATGGCTGTGG - Intergenic
932605478 2:73162955-73162977 ACGGCTCCTGCCCATGGCCAAGG - Intergenic
935926029 2:108069691-108069713 AGAGGACCTGCCCATGGACCAGG + Intergenic
936259474 2:110946770-110946792 AGGGGACCTTCTCATGGCGGTGG + Intronic
936940321 2:117878078-117878100 TCTGGACCTGCCCATGGCCTAGG - Intergenic
937318929 2:120949124-120949146 ACAGGACCTGCCCTTGTCCAGGG + Intronic
938731739 2:134152183-134152205 ATGGGACCTGCCCACCGCCATGG + Intronic
942834440 2:180277069-180277091 TCTGGACCTGCCCAGGGCCTAGG - Intergenic
944751920 2:202717900-202717922 TCTGGACCTGCCCAGGGCCTGGG - Intronic
947999655 2:234557419-234557441 ACTGGACCTGCCCAGGGTGGAGG - Intergenic
1170567483 20:17615306-17615328 CCGGGACCTGCCCTTGGCACTGG - Intronic
1172436350 20:34931387-34931409 AGGGGACCAGGCCATCGCCGAGG - Exonic
1173873754 20:46357230-46357252 AGGGGACCAACCCAAGGCCGGGG - Intronic
1173981050 20:47224494-47224516 GCGGGACCGGCTCATCGCCGAGG - Exonic
1175417502 20:58811466-58811488 AGGCCACCTGCCCATGGCCCGGG + Intergenic
1176148193 20:63574616-63574638 GCAGGACCTGCCCGTGGCCCTGG + Intergenic
1176285423 21:5016681-5016703 AGGGGACCAGCCCCCGGCCGGGG + Intergenic
1179871758 21:44246794-44246816 AGGGGACCAGCCCCCGGCCGGGG - Intronic
1180962473 22:19768154-19768176 ACGGGAAGTGCACGTGGCCGAGG + Intronic
1181457711 22:23069216-23069238 CCTGGACCTGACCATGGCAGAGG - Intronic
1181529883 22:23511447-23511469 AGGGGACCTGCAGAGGGCCGGGG - Intergenic
1182733000 22:32510352-32510374 ACTAGCTCTGCCCATGGCCGTGG + Intergenic
1185284976 22:49996075-49996097 ACAGGACATGCCCAGGGCCGTGG - Exonic
949235621 3:1805682-1805704 TCTGGACCTGCCCAGGGCCTGGG - Intergenic
950129202 3:10530387-10530409 CCGGGACCTGCACCTGGCAGAGG + Intronic
952652550 3:35743889-35743911 ACAGTACCGGCCCATGGCCCCGG + Exonic
954334909 3:49910597-49910619 ACGGTGCCTGCCCCTGGCGGCGG - Exonic
954575008 3:51671161-51671183 GCGGGACATGGCCGTGGCCGTGG - Intronic
954709060 3:52496017-52496039 AGGGGACCTGCCCGGGGCTGTGG - Intronic
956476194 3:69622280-69622302 CCTGGACCTGCCCAGGGCCTGGG + Intergenic
966401009 3:179546870-179546892 TCTGGACCTGCCCAGGGCCCAGG + Intergenic
966911412 3:184562228-184562250 GCGGGCTCTGGCCATGGCCGTGG - Exonic
967819869 3:193830790-193830812 CCAGGGCCTGCCCATGGCCCTGG + Intergenic
968865815 4:3210580-3210602 ACAGGACCTGCCCACGGGTGAGG - Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969321803 4:6417150-6417172 ACGGGTCCAGCCCCTGGGCGGGG + Intronic
976163789 4:82231739-82231761 ACGGGACCTGCCTAGGACCTTGG + Intergenic
976444181 4:85111016-85111038 TCTGGACCTGCCCAGGGCCTGGG + Intergenic
978809806 4:112837622-112837644 AGTGGAGCTGCCCATGGCCTTGG + Intronic
982932762 4:161429260-161429282 TCTGGACCTGCCCAGGGCTGGGG + Intronic
994028639 5:95114707-95114729 TCTGGACCTGCCCAGGGCCTGGG + Intronic
996044989 5:118861978-118862000 ACGGTACCGGTCCATGGCCTGGG - Intronic
997424141 5:133791749-133791771 AGGGGAGCTGCCCTTGGCGGAGG - Intergenic
999701702 5:154234276-154234298 ACCAGACCTGCCCATGGTGGTGG + Intronic
999768273 5:154756369-154756391 CAGGGACCTGCCCCTGCCCGAGG + Intronic
1002411070 5:179076905-179076927 ACTGGAGCTGTCAATGGCCGGGG - Intronic
1002580913 5:180209055-180209077 CCGGGAGCTGCCCATGGGCCGGG - Intronic
1006452670 6:34114140-34114162 AGGGGACCTGCCCAGGGCCAGGG - Intronic
1006921418 6:37630100-37630122 ATGGGACCTGCCCTTGGACAGGG + Intergenic
1013428481 6:110035505-110035527 ACGGCACCTGCCCGGGGCCTTGG + Intergenic
1016590091 6:145735110-145735132 GCGGGGCCTGCCCGAGGCCGAGG + Intronic
1017877553 6:158536939-158536961 GCGGGACCAGGCCAAGGCCGGGG - Intronic
1019029236 6:168995836-168995858 ACGGGACCTGCCTATGGCACGGG + Intergenic
1023884885 7:44347677-44347699 AAAGGACCTTCCCATGGCTGTGG + Intergenic
1027051673 7:75025016-75025038 TCGGCATCTGCCCCTGGCCGTGG - Intergenic
1029472328 7:100762379-100762401 ACGGAACCTTCCCAGGGCCCCGG - Intronic
1029688218 7:102163472-102163494 ACGGGACCTGGCCAGGCCTGTGG + Intronic
1031396866 7:121284742-121284764 AGGGGAGCTGCCCAAGGCTGGGG - Intronic
1035753973 8:2017501-2017523 TCTGGACCTGCCCAGGGCTGGGG - Intergenic
1037295709 8:17397618-17397640 TCTGGACCTGCCCAGGGCCTGGG + Intronic
1039518589 8:38152960-38152982 ACTGGAACTGCCCCTGGCCCAGG + Intergenic
1044728627 8:95213084-95213106 AGGGCACCTGACCATGGCCTTGG + Intergenic
1047629297 8:126689565-126689587 ACGGCATCTGCCTATGGCCGAGG + Intergenic
1048525842 8:135201756-135201778 AAGGGACCTGCCCCTGGCCAGGG + Intergenic
1049208956 8:141376548-141376570 AGGGTGGCTGCCCATGGCCGGGG + Intergenic
1049290084 8:141797255-141797277 CTGGGACCTGCCCATGGGCGAGG + Intergenic
1049340128 8:142107728-142107750 ACGGGCCCTGCTGCTGGCCGGGG + Intergenic
1049685503 8:143937695-143937717 ACGGGAGCTCCCCAAGACCGTGG - Intronic
1049705332 8:144039580-144039602 GCGGGACGTCCCCATGGCTGGGG + Intronic
1049812877 8:144583439-144583461 ACGGGGTCTGCCCACGGCCCGGG + Intronic
1053307878 9:36996669-36996691 CCAGGACCTGCCCATGTCAGAGG + Intronic
1053598364 9:39585873-39585895 ACAGGAGCTGGGCATGGCCGAGG + Intergenic
1053856397 9:42342882-42342904 ACAGGAGCTGGGCATGGCCGAGG + Intergenic
1057288989 9:93788397-93788419 TCTGGACCTGCCCAAGGCCTTGG - Intergenic
1058820969 9:108728892-108728914 TCTGGACCTGCCCAGGGCCAGGG + Intergenic
1060154327 9:121308738-121308760 ACGGGACTTGCCCAAGGTGGTGG - Intronic
1060779517 9:126401110-126401132 ACAGGATGTGCCCATGGCCTGGG - Intronic
1061250484 9:129423427-129423449 AGGGGACCTGCAGAGGGCCGGGG + Intergenic
1061832488 9:133304585-133304607 AGGGGATCTGCCCCTGGCCATGG - Intergenic
1062066217 9:134527786-134527808 ACGGGGCCTGCCCATGGGAGAGG - Intergenic
1062472286 9:136711968-136711990 ACGGAACCTGCCTATGGAGGCGG + Intergenic
1062547594 9:137070610-137070632 ACGGGCTCGGCCAATGGCCGCGG - Intergenic
1186926165 X:14335543-14335565 AGGGGAGCTGCCCAAGGCCATGG - Intergenic
1187314894 X:18183906-18183928 TCTGGACCTGCCCAAGGCTGGGG + Intronic
1187574821 X:20542809-20542831 AGGGGAGCTGCCCAAGGCTGTGG + Intergenic
1190758685 X:53422454-53422476 CCGGGACGTGCGCAGGGCCGCGG + Intronic
1192060268 X:67817210-67817232 CCTGGACCTGCCCAGGGCCTGGG + Intergenic
1196564563 X:117189541-117189563 TCTGGACCTGCCCAGGGCCTGGG + Intergenic
1198151219 X:133912275-133912297 ACGGGACCTTCCCATAGGCGGGG - Intronic
1198578593 X:138037584-138037606 TCTGGACCTGCCCATGGCTTGGG + Intergenic
1199277701 X:145965120-145965142 TCTGGACCTGCCCAGGGCCTGGG + Intergenic
1202232806 Y:22672545-22672567 ACATGCCCTGCCCATGGCTGAGG - Intergenic
1202310350 Y:23523613-23523635 ACATGCCCTGCCCATGGCTGAGG + Intergenic
1202560452 Y:26146981-26147003 ACATGCCCTGCCCATGGCTGAGG - Intergenic