ID: 1163365092

View in Genome Browser
Species Human (GRCh38)
Location 19:16871401-16871423
Sequence GAGCCGGGCCGGGGTGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2219
Summary {0: 2, 1: 2, 2: 25, 3: 253, 4: 1937}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163365081_1163365092 14 Left 1163365081 19:16871364-16871386 CCATGGACAAGCTGGTGCAGAAC 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1163365092 19:16871401-16871423 GAGCCGGGCCGGGGTGGGGCCGG 0: 2
1: 2
2: 25
3: 253
4: 1937
1163365079_1163365092 29 Left 1163365079 19:16871349-16871371 CCTACGTGGGCTTCACCATGGAC 0: 1
1: 0
2: 0
3: 11
4: 97
Right 1163365092 19:16871401-16871423 GAGCCGGGCCGGGGTGGGGCCGG 0: 2
1: 2
2: 25
3: 253
4: 1937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163365092 Original CRISPR GAGCCGGGCCGGGGTGGGGC CGG Intronic