ID: 1163365194

View in Genome Browser
Species Human (GRCh38)
Location 19:16872110-16872132
Sequence GATTCTGGCAGAAACCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163365194_1163365198 5 Left 1163365194 19:16872110-16872132 CCTGCCTGGTTTCTGCCAGAATC 0: 1
1: 0
2: 0
3: 15
4: 217
Right 1163365198 19:16872138-16872160 TCATGGTGACCTCCATTTCCTGG 0: 1
1: 0
2: 2
3: 96
4: 1383
1163365194_1163365201 18 Left 1163365194 19:16872110-16872132 CCTGCCTGGTTTCTGCCAGAATC 0: 1
1: 0
2: 0
3: 15
4: 217
Right 1163365201 19:16872151-16872173 CATTTCCTGGTCACCAAGTAAGG 0: 1
1: 0
2: 1
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163365194 Original CRISPR GATTCTGGCAGAAACCAGGC AGG (reversed) Intronic
900705325 1:4076711-4076733 GATTCTGTCTGAATCCAGGGCGG - Intergenic
901171473 1:7261364-7261386 GATGCTGGTAGAGACCAGGATGG + Intronic
901561364 1:10074131-10074153 GATGCAGGCAGAACCTAGGCAGG + Intronic
902835701 1:19045357-19045379 GATCGGGCCAGAAACCAGGCTGG + Intergenic
903507204 1:23845979-23846001 GAATATGGGAGAAACCTGGCAGG + Intronic
904454396 1:30638692-30638714 AATAGTGGCAGAACCCAGGCTGG + Intergenic
905792391 1:40797153-40797175 GAAGCTGGCAGTTACCAGGCAGG + Intronic
905945368 1:41897244-41897266 GATTCTTGCTGAAGGCAGGCAGG + Intronic
909392124 1:75130919-75130941 GATTCTGGCAGAATTCTGGTTGG - Intronic
910480990 1:87658169-87658191 GATTCTGGCAGCAGCCTAGCAGG - Intergenic
912566852 1:110593459-110593481 GGTCCAGGCAGAGACCAGGCAGG - Intergenic
914878603 1:151530542-151530564 GAGTCTGGCAGCAGCCAAGCGGG + Exonic
917609118 1:176668300-176668322 GATCCTGGCAGAAATTAAGCAGG + Intronic
920363544 1:205435960-205435982 GATGAGGGCAGAAACCAGCCTGG + Intronic
1065898225 10:30183031-30183053 GAGTCAGAGAGAAACCAGGCTGG - Intergenic
1066027857 10:31382163-31382185 GACACTGGCAGAAACCAAGGTGG - Intronic
1068714462 10:60173054-60173076 GATTCTGGCAGAAACAAAAAAGG + Intronic
1069251633 10:66274031-66274053 GATTCTTGGAAAAGCCAGGCAGG + Intronic
1069746438 10:70717730-70717752 GCTTCTGGCTGCAACCTGGCTGG - Intronic
1069769828 10:70891175-70891197 GACTGTGGCAGCACCCAGGCAGG + Intergenic
1073215491 10:101833948-101833970 GATTCTGGGCGATACCAGGAGGG - Intronic
1073440718 10:103551085-103551107 GATCCCAGCAGAAGCCAGGCAGG - Intronic
1073981281 10:109156575-109156597 GATTCTTGCTGAAGGCAGGCTGG - Intergenic
1074197738 10:111204148-111204170 GATTCTGGCTCTAGCCAGGCTGG - Intergenic
1074950509 10:118329721-118329743 GATTCTGGGACACACCAAGCCGG - Intronic
1075159665 10:120012092-120012114 GATGCTGGCAGAAACGAGATTGG + Intergenic
1075839938 10:125492961-125492983 AATTCTGACAGATACCAGGAGGG + Intergenic
1077759015 11:5070122-5070144 GATGCTGGCACAAGACAGGCGGG - Intergenic
1078851362 11:15167179-15167201 CATTCTGGGAGAAGTCAGGCTGG + Intronic
1078906314 11:15691365-15691387 AATGCTGGCAGGAACCAGGAAGG - Intergenic
1079399183 11:20092105-20092127 GTTCCCTGCAGAAACCAGGCTGG - Intronic
1082177774 11:49081574-49081596 AGATCTGGCAGAAAGCAGGCTGG + Intergenic
1082582241 11:54886179-54886201 TATTTTGGCAGAATCCAGGAAGG + Intergenic
1083543791 11:63534285-63534307 GATTCTTGCTGAAGACAGGCCGG + Intergenic
1084040834 11:66541831-66541853 GGTGGTGGCAGAAGCCAGGCTGG + Intronic
1084331269 11:68432036-68432058 GATAGTGGCAGGAGCCAGGCTGG + Intronic
1084558718 11:69890682-69890704 GGTGCTGGCAGAAAGCAGGCAGG + Intergenic
1086687944 11:89754286-89754308 AGATCTGGCAGAAAGCAGGCTGG - Intergenic
1086717905 11:90085608-90085630 AGATCTGGCAGAAAGCAGGCTGG + Intergenic
1087689079 11:101298293-101298315 GATTATGGCAGATAGGAGGCAGG - Intergenic
1087912481 11:103769768-103769790 GATCCTGGCAAAAAGTAGGCAGG - Intergenic
1089398711 11:118152456-118152478 GAACCAGGCAGGAACCAGGCAGG + Intronic
1089463020 11:118663797-118663819 GCTTATGGCAGAAACCTGGGAGG + Intronic
1090375091 11:126282914-126282936 GAGTCATGCAGAAGCCAGGCTGG + Intergenic
1090641650 11:128734472-128734494 GATTGTGGCTGAAACCACGGTGG + Intronic
1091162765 11:133440096-133440118 GCTTTAAGCAGAAACCAGGCCGG + Intronic
1093051052 12:14505313-14505335 AATTCTGGAAGAAACCTGTCAGG - Intronic
1097629650 12:62044505-62044527 AATTCTGGCTTACACCAGGCAGG + Intronic
1098329675 12:69340118-69340140 GGTTCTGGTAGGAACTAGGCAGG - Intergenic
1103284405 12:119788205-119788227 GATTTAGGTAGAAAACAGGCTGG - Intronic
1110944406 13:81395082-81395104 GGTGCTGGCAAAAATCAGGCTGG + Intergenic
1112027629 13:95426221-95426243 GATTCTTGCTGAAGGCAGGCTGG + Intergenic
1113135553 13:107085126-107085148 GATCCTGCCAGCAACCAGGGAGG - Intergenic
1113603442 13:111587729-111587751 GATTCAGACAGAAACCAGATGGG + Intergenic
1113607463 13:111620672-111620694 GATGCAGGCAGAAGCCAGCCTGG - Intronic
1114212660 14:20628449-20628471 GATGCAGGCAGAAAAAAGGCAGG - Intergenic
1116265354 14:42681972-42681994 ATTTCTGGCAAAAACAAGGCAGG + Intergenic
1117766343 14:59087280-59087302 TACTCTGGTTGAAACCAGGCAGG + Intergenic
1118165449 14:63331773-63331795 GATTGTGGCAGACAGGAGGCAGG + Intergenic
1118884301 14:69853663-69853685 GCTTCTGGAAGAACCCAGGATGG - Intergenic
1121263279 14:92581950-92581972 GATTCTTGCTGAAGGCAGGCAGG + Intronic
1121314538 14:92953205-92953227 GATTCGGGCGGAAGCCAAGCAGG + Intronic
1122228681 14:100294156-100294178 GCTACTGGCAGAGACCAGGCAGG - Intronic
1123476603 15:20595757-20595779 GAGTCAGGCAGAAGCCACGCAGG - Intergenic
1123641408 15:22404607-22404629 GAGTCAGGCAGAAGCCACGCAGG + Intergenic
1123772274 15:23540484-23540506 GATTGTGGCAGAAAGCTGGAGGG - Intergenic
1124685160 15:31776377-31776399 GATTCTGGCAGCCACCATCCAGG - Intronic
1125475126 15:40042485-40042507 GATAATGGCAGAAATCAGGATGG - Intergenic
1127046753 15:55034058-55034080 GATTTTGGGACAAAACAGGCTGG - Intergenic
1128737620 15:70062107-70062129 GCTTCGGGCAGAAACTTGGCCGG - Intronic
1128748302 15:70130415-70130437 GATTCTGGCATCAAGCTGGCTGG + Intergenic
1129752472 15:78076036-78076058 GAGACTCACAGAAACCAGGCAGG + Intronic
1131031683 15:89191435-89191457 TGATCTGGCAGAAACCAGACAGG - Intronic
1131665593 15:94568166-94568188 GATGGTGGCTGGAACCAGGCTGG + Intergenic
1131836055 15:96392327-96392349 AATTCTAGGAGAAACCTGGCAGG + Intergenic
1136288165 16:29256156-29256178 GCATCAGGCAGAAGCCAGGCAGG + Intergenic
1137263958 16:46853451-46853473 GTTTCTGGCAGAAAATAGGCAGG - Intergenic
1137578498 16:49619798-49619820 GATCCTGGCAGAAAGGAGACAGG + Intronic
1138799066 16:60003472-60003494 GCATCCGGCAGAAACCAGTCAGG - Intergenic
1139098549 16:63735683-63735705 TATTCTTTCAAAAACCAGGCAGG + Intergenic
1140058590 16:71547417-71547439 GATGGTGGCAGGAACAAGGCAGG - Intronic
1141543060 16:84741667-84741689 GTTTTTGGCAGAAAAAAGGCAGG - Intronic
1141779687 16:86151250-86151272 GATTCTGCCAGAGATCAGGCCGG + Intergenic
1142093839 16:88228923-88228945 GCATCGGGCAGAAGCCAGGCGGG + Intergenic
1142668464 17:1475786-1475808 GATTCCAGCAGAAACCTGGGAGG + Intronic
1143171684 17:4933992-4934014 GCTTGTGGCAGACACCAGGATGG - Exonic
1147419316 17:40314305-40314327 GCTGCTGGCAGAAGCAAGGCTGG + Intronic
1148238850 17:45986678-45986700 GACCCTGGCAGAAACAGGGCAGG + Intronic
1148925471 17:51081112-51081134 GATTGTGGCACACACCAGGATGG - Intronic
1149702628 17:58668104-58668126 GATTCTTGCTGAAGACAGGCTGG - Intronic
1150614015 17:66755065-66755087 GATCCTGGCAGAAATCGGGAAGG - Intronic
1150733022 17:67712265-67712287 GTTCCTGGCAGAGCCCAGGCGGG - Intergenic
1152202695 17:78956346-78956368 GATTCTTGCTGAAGGCAGGCCGG + Intergenic
1152666989 17:81576829-81576851 GACTCTGGCAAGGACCAGGCAGG - Intronic
1154219222 18:12437471-12437493 GATAATGGCATAAACCTGGCAGG - Intergenic
1155173103 18:23281733-23281755 GGTTCTGGCAGAAACAACTCTGG - Intronic
1160064211 18:75560163-75560185 GATTCTGGGAGAAAAAAGTCAGG + Intergenic
1161196364 19:2988736-2988758 GATGCTGGGAGAACCCAGGTGGG + Intronic
1161619873 19:5292405-5292427 GCTTCCTGCAGAACCCAGGCTGG - Intronic
1163365194 19:16872110-16872132 GATTCTGGCAGAAACCAGGCAGG - Intronic
1163747444 19:19056781-19056803 GATTCTTGGACACACCAGGCTGG + Intronic
1166364350 19:42270926-42270948 GATCCTGGCAGGGAGCAGGCAGG - Intronic
1166872639 19:45880119-45880141 GCTTCTGGGACAAACCAAGCAGG + Intergenic
1167213281 19:48147378-48147400 GATTATGTAAGAAATCAGGCTGG + Intronic
1167288978 19:48614399-48614421 CATTTAGGCAGAAACCAGGCTGG - Intronic
1168583117 19:57571710-57571732 GCTTCCAGCAGAACCCAGGCTGG + Exonic
928280801 2:29944681-29944703 GAAACTGGCAGAAACCAGCTGGG + Intergenic
928602164 2:32914190-32914212 GATGGTAGCAGAAACCAGGAAGG - Intergenic
931629090 2:64283436-64283458 GATGGTGGCTGAAACCAGGCTGG + Intergenic
932125848 2:69145089-69145111 GAGTGTGGCAGCAAACAGGCTGG + Intronic
932270224 2:70402946-70402968 GATTATGGCAGACAGGAGGCAGG + Intergenic
937435311 2:121875379-121875401 CAATCTGGCTGAAAGCAGGCTGG - Intergenic
938650810 2:133381670-133381692 AATTCTGGCAGAACCCAAGTGGG + Intronic
941766588 2:169304022-169304044 CCTTCTGGCAAAAACCTGGCAGG - Intronic
941868953 2:170363562-170363584 GTTTTTGGCAGAAGCCAGACTGG + Intronic
942597697 2:177607966-177607988 GATTCTTGCTGAAAGCAGGCTGG + Intergenic
942628165 2:177925962-177925984 GACTGTGACAGAACCCAGGCTGG - Intronic
943752126 2:191520301-191520323 GAATGTGGGAGACACCAGGCCGG + Intergenic
946840534 2:223815336-223815358 AATGCTGGCAGAAACCAACCAGG + Intronic
947229719 2:227872618-227872640 GTTTCTGGCAAAAAACAGGCTGG - Intronic
947592742 2:231394876-231394898 GATTCTGGAAGTCACCTGGCTGG + Intergenic
948846579 2:240685712-240685734 GCCTCTGGCAGAGCCCAGGCCGG + Intergenic
948847282 2:240689022-240689044 GCCTCTGGCAGAGCCCAGGCCGG - Intergenic
948997596 2:241591271-241591293 TACAGTGGCAGAAACCAGGCCGG + Intronic
1168836520 20:881356-881378 GAACCTGGCACAAAGCAGGCAGG - Intronic
1171295611 20:24014313-24014335 GATTCTTGCTGAAAGCAGACAGG - Intergenic
1172182098 20:33009795-33009817 GTTTTTGGCAGAAATCTGGCTGG + Intronic
1175225301 20:57440951-57440973 GATTCCTGCAAAAACCTGGCAGG - Intergenic
1175286224 20:57838715-57838737 GAGTGTGGCAAAAACAAGGCCGG - Intergenic
1177828715 21:26112720-26112742 TATTCTGGGGGAAACCAGGAGGG - Intronic
1179413669 21:41181034-41181056 AATTCTGGCAGGAATCAGGGTGG - Intronic
1179455857 21:41499541-41499563 GATTCTTGCTGAAGACAGGCTGG - Intronic
1181017073 22:20076935-20076957 GATTCTTGCTGAAGACAGGCTGG + Intergenic
1181275400 22:21684856-21684878 GATTCTGGCAGCCACCATGAAGG + Exonic
1181559833 22:23693642-23693664 GTCTCTGGCAGGAACCAAGCTGG - Intronic
1181804023 22:25364462-25364484 GCATCTGGCAGAGCCCAGGCTGG - Intronic
1182646079 22:31810635-31810657 GAATCTGGCAGAAAACCTGCAGG - Exonic
1182812070 22:33125183-33125205 AAGACTGGCAGAAACCAGGAAGG - Intergenic
1183457852 22:37932501-37932523 GCTCCTGGCAGCAACCAGGCAGG + Intronic
950789523 3:15461398-15461420 TAGCCTGGCAGAAAACAGGCAGG - Intronic
950994435 3:17480282-17480304 GATGGTGGCAGAAAGCAGACAGG + Intronic
952758914 3:36896668-36896690 TGTTCTGTCAGAAGCCAGGCCGG - Intronic
955003163 3:54945784-54945806 GAATCAGGCAGGGACCAGGCAGG + Intronic
955215691 3:56983406-56983428 GAGTGTGACAGAGACCAGGCAGG - Intronic
956707015 3:72007864-72007886 GATTCTTGCTGAAGACAGGCTGG - Intergenic
956851741 3:73234355-73234377 GAGTATGTCAGAAGCCAGGCCGG + Intergenic
958181468 3:90065761-90065783 AATTCTGGCAGAAAACATGAGGG - Intergenic
960007485 3:112794841-112794863 GCTTCTGGCAGGAGCCAGGTAGG - Intronic
962171246 3:133103667-133103689 GATTCTGACAGAAACATGGAGGG - Intronic
962200652 3:133398875-133398897 GATTCATGCACACACCAGGCTGG + Intergenic
963816005 3:149831489-149831511 GAAACTGGCAGAAACAAGGGGGG - Intronic
964956966 3:162371255-162371277 AATGCAGGCAGAAACCATGCAGG - Intergenic
966072983 3:175902380-175902402 GAATCTGGATGAAATCAGGCTGG + Intergenic
967964851 3:194953016-194953038 GATGGTGGCTGAATCCAGGCTGG - Intergenic
969463165 4:7339548-7339570 GATGCAGGCAGAGACCAGGGTGG - Intronic
971643950 4:29171981-29172003 AATCATGGCAGAAAGCAGGCAGG + Intergenic
973080415 4:45984484-45984506 GATTAAGGCACAAACCAGACAGG + Intergenic
976288014 4:83388717-83388739 AATTCTAGCAGAGACCAGCCAGG + Intergenic
976436402 4:85023483-85023505 GATTCTTGCCGAAGGCAGGCTGG + Intergenic
980077580 4:128309905-128309927 GCTTCTGGCAGACAGCAGGAGGG - Intergenic
980105311 4:128582869-128582891 GGTTCTGCCTGAACCCAGGCAGG - Intergenic
981481513 4:145243587-145243609 GTTTCAAGCACAAACCAGGCAGG - Intergenic
982962181 4:161853809-161853831 GGTTCTGACAGAAAACAGACTGG + Intronic
985760823 5:1747682-1747704 GATTCCGGTAGACACCAGGAGGG - Intergenic
986215920 5:5719270-5719292 GATCCAGGGAAAAACCAGGCTGG - Intergenic
986442763 5:7796248-7796270 GACTCTGGGAGAGACCAGGGAGG + Intronic
986794323 5:11193904-11193926 GTTGCTGACAGAAGCCAGGCTGG - Intronic
988847747 5:35146110-35146132 GATTCTGGAAGTGACCAAGCAGG - Intronic
990514689 5:56520379-56520401 GAATGTGGCAGGAACCAGGCTGG - Intronic
992219774 5:74560305-74560327 GGTTCTGGCAGGAAACTGGCAGG + Intergenic
992965613 5:81996985-81997007 GATGCTGGCAGACACGAGACTGG - Intronic
996535509 5:124573116-124573138 GATTCTGCCTGACATCAGGCAGG + Intergenic
997553304 5:134772490-134772512 GAGTCTCGCAGTCACCAGGCTGG - Intronic
1002062846 5:176636536-176636558 GATTTTTGCAGAACCCAGGCGGG - Intronic
1002428407 5:179189036-179189058 GATTGTGGCAGAGCCCATGCTGG - Intronic
1002449702 5:179311665-179311687 GATTCTAGCTGAAGACAGGCTGG - Intronic
1002624208 5:180513412-180513434 GATTGTGCCAGACTCCAGGCTGG - Intronic
1003064635 6:2893500-2893522 AATTGATGCAGAAACCAGGCTGG - Exonic
1003490770 6:6619656-6619678 GCTTTTGGCAGAACACAGGCTGG - Intronic
1003854576 6:10260266-10260288 CACTCTTGCAGAAACAAGGCAGG - Intergenic
1005268735 6:24140713-24140735 TGTTCTGGCAGAGACGAGGCAGG - Intronic
1006565291 6:34950834-34950856 GATTCTTGCTAAAACCGGGCTGG + Intronic
1006580162 6:35072525-35072547 GACTCTGGAAGAAGCCAGCCTGG - Intronic
1009920726 6:70056702-70056724 GCTTCTGGCAGAAAGGAGGAAGG + Intronic
1010859194 6:80885137-80885159 ACTACTGGCAGAAAACAGGCAGG - Intergenic
1012224936 6:96693556-96693578 GATTATGGCAGACAGGAGGCAGG + Intergenic
1013579864 6:111523112-111523134 GAGTCTGGCTGTCACCAGGCTGG + Intergenic
1014875098 6:126648712-126648734 CTTTCTGGCAGAAACCTTGCAGG - Intergenic
1015217144 6:130763203-130763225 GATTCTGCCAGACCCCTGGCAGG - Intergenic
1015474747 6:133647873-133647895 GATTCCTACAGAAAGCAGGCCGG - Intergenic
1018745493 6:166758462-166758484 GCTTCTGGCAGAACCAAGGCAGG - Intronic
1021566859 7:22024659-22024681 GATGCTGGCAGAAGCCAGGTGGG + Intergenic
1024036581 7:45511890-45511912 GATTCTTGCAGAAGACAGCCAGG - Intergenic
1024889828 7:54187025-54187047 GATTCTTGCTGAAGACAGGCCGG + Intergenic
1025606135 7:63041292-63041314 GTTTCTGGCACAAAGAAGGCCGG - Intergenic
1029718420 7:102347148-102347170 GCTAATGGCAGACACCAGGCAGG - Intergenic
1029754196 7:102562107-102562129 GCTAATGGCAGACACCAGGCAGG + Intronic
1029772146 7:102661197-102661219 GCTAATGGCAGACACCAGGCAGG + Intronic
1032353186 7:131185000-131185022 CATGCTGGCAGAAACCCTGCTGG + Intronic
1035253814 7:157613692-157613714 GATTCTGGCACGTTCCAGGCAGG - Intronic
1035759749 8:2060999-2061021 GGTTCTGGCTGAAGGCAGGCTGG + Intronic
1037759782 8:21734126-21734148 GCTTCTTCCAGAAGCCAGGCCGG - Intronic
1039026945 8:33268706-33268728 GTTTCTGTCAGAGCCCAGGCAGG - Intergenic
1041395088 8:57381605-57381627 GCTTCTGGGAGTAACCAGCCAGG - Intergenic
1047050071 8:121101139-121101161 GATTCTGGAAGAAAGCAGAAAGG + Intergenic
1047181550 8:122593569-122593591 GTTTATGGAAGTAACCAGGCGGG - Intergenic
1047632130 8:126719644-126719666 GGTCCTGTCATAAACCAGGCTGG + Intergenic
1048171473 8:132110657-132110679 GATTTTGGCAGCAAACAGACTGG - Intronic
1048196886 8:132338759-132338781 GCTTCTGGCAGAAAATAGGCAGG + Intronic
1048556448 8:135482460-135482482 GTTTCTTCCAGAAACCAGTCTGG - Intronic
1048590320 8:135815314-135815336 GATTCCTGCAGAAAACATGCTGG + Intergenic
1050569650 9:6924388-6924410 GCTTCTGGTAGAGCCCAGGCAGG + Intronic
1052044756 9:23781548-23781570 AATTCTGTCACCAACCAGGCTGG + Intronic
1053231131 9:36410604-36410626 GAATCAGGCAGAACCGAGGCAGG + Intronic
1055798086 9:79997992-79998014 GTTTGTGGCAGAAACAAGACTGG + Intergenic
1056295722 9:85191126-85191148 GACTCTGCCATAAACCTGGCTGG + Intergenic
1056650895 9:88461146-88461168 GATTCAGGCAGAAATGAGGGCGG - Intronic
1056740397 9:89249582-89249604 GGTTCTTGCAGAAGACAGGCTGG + Intergenic
1056885769 9:90442287-90442309 GATTCTTGCTGAAGACAGGCTGG - Intergenic
1057647938 9:96894436-96894458 GATTCTTGCTGAAAACAGGCTGG - Intergenic
1057848017 9:98540344-98540366 GATTTTGGCAGAAGCCCTGCAGG + Intronic
1059326221 9:113505407-113505429 GCTTCTGGCAGTGACCGGGCAGG + Intronic
1059958303 9:119541243-119541265 GGATCTGGCAGAATACAGGCAGG + Intergenic
1185785030 X:2883635-2883657 AATTTTTCCAGAAACCAGGCTGG + Intergenic
1187316225 X:18197645-18197667 GAGAATTGCAGAAACCAGGCTGG - Intronic
1187367388 X:18676113-18676135 GCCTCTGGAAGAAACCAGGTGGG + Intronic
1187719566 X:22137152-22137174 GATTCTGACTGAGACCTGGCAGG + Intronic
1192884411 X:75321554-75321576 CAGTCTGGAGGAAACCAGGCAGG + Intergenic
1193783923 X:85735644-85735666 TAATCTGCCAGAAACAAGGCAGG - Intergenic
1194882583 X:99272188-99272210 GATTATGGCAGATGGCAGGCAGG - Intergenic
1197662385 X:129188222-129188244 AAGTCGGGCAGAAACCAGTCAGG + Intergenic
1200844217 Y:7814863-7814885 CATGTGGGCAGAAACCAGGCAGG + Intergenic
1200900269 Y:8424497-8424519 TATGCTGGCAAAAACTAGGCAGG + Intergenic