ID: 1163366882

View in Genome Browser
Species Human (GRCh38)
Location 19:16880422-16880444
Sequence GGACCCATGAGAGCAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163366878_1163366882 -8 Left 1163366878 19:16880407-16880429 CCAGGTCAGTGGGCTGGACCCAT 0: 1
1: 0
2: 0
3: 24
4: 485
Right 1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 189
1163366875_1163366882 -1 Left 1163366875 19:16880400-16880422 CCTGCCACCAGGTCAGTGGGCTG 0: 1
1: 0
2: 1
3: 24
4: 227
Right 1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 189
1163366877_1163366882 -5 Left 1163366877 19:16880404-16880426 CCACCAGGTCAGTGGGCTGGACC 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 189
1163366870_1163366882 21 Left 1163366870 19:16880378-16880400 CCTGTGAGAGCCTTGCTGACTTC 0: 1
1: 0
2: 0
3: 20
4: 181
Right 1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 189
1163366871_1163366882 11 Left 1163366871 19:16880388-16880410 CCTTGCTGACTTCCTGCCACCAG 0: 1
1: 0
2: 3
3: 28
4: 321
Right 1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163366882 Original CRISPR GGACCCATGAGAGCAAGGGG TGG Intergenic