ID: 1163366882

View in Genome Browser
Species Human (GRCh38)
Location 19:16880422-16880444
Sequence GGACCCATGAGAGCAAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163366875_1163366882 -1 Left 1163366875 19:16880400-16880422 CCTGCCACCAGGTCAGTGGGCTG 0: 1
1: 0
2: 1
3: 24
4: 227
Right 1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 189
1163366871_1163366882 11 Left 1163366871 19:16880388-16880410 CCTTGCTGACTTCCTGCCACCAG 0: 1
1: 0
2: 3
3: 28
4: 321
Right 1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 189
1163366878_1163366882 -8 Left 1163366878 19:16880407-16880429 CCAGGTCAGTGGGCTGGACCCAT 0: 1
1: 0
2: 0
3: 24
4: 485
Right 1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 189
1163366877_1163366882 -5 Left 1163366877 19:16880404-16880426 CCACCAGGTCAGTGGGCTGGACC 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 189
1163366870_1163366882 21 Left 1163366870 19:16880378-16880400 CCTGTGAGAGCCTTGCTGACTTC 0: 1
1: 0
2: 0
3: 20
4: 181
Right 1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163366882 Original CRISPR GGACCCATGAGAGCAAGGGG TGG Intergenic
902554132 1:17236961-17236983 GGAGCCAAGTGAGCAAGGAGGGG + Intronic
902657478 1:17879273-17879295 GGTCCCAAGAGTGCTAGGGGAGG - Intergenic
905345138 1:37306137-37306159 GGAGCCAGGAGACCAAGGGCCGG + Intergenic
905581356 1:39084632-39084654 GGTCTCACGTGAGCAAGGGGTGG - Intronic
907441960 1:54484403-54484425 GGACACATAGGAGGAAGGGGAGG + Intergenic
908064828 1:60391600-60391622 GTACCCACGAGACCAAGGAGTGG - Intergenic
908924950 1:69242737-69242759 GAGCTCAAGAGAGCAAGGGGTGG - Intergenic
913450398 1:118988970-118988992 GGCGCCTTGAGAGCAAGGGGCGG + Intronic
916057931 1:161080832-161080854 AGTCCCATGAGAGCAGGGAGTGG - Intronic
916271331 1:162945410-162945432 GGACAGATGAGGGGAAGGGGTGG + Intergenic
920179432 1:204123296-204123318 GGACCCAACAGACCAAGGGAGGG - Intronic
920210636 1:204325837-204325859 GGGCCCAGGCGAACAAGGGGTGG + Intronic
920971238 1:210745289-210745311 GGGAGCATGAGAGCAAGGGAAGG + Intronic
923675895 1:236080613-236080635 GGGCTCCTGAGAGCAAGTGGCGG - Intergenic
1063691400 10:8290733-8290755 GGAACCATGGGAGCAAGTGAGGG + Intergenic
1067839996 10:49668076-49668098 GGAGCCAGGAGAGAAAAGGGAGG + Intergenic
1069920438 10:71812602-71812624 GCACCCATGTGAGCCAGAGGCGG + Exonic
1069920641 10:71813457-71813479 GGACCAAAGACAGCAATGGGTGG + Intronic
1070610670 10:77930203-77930225 GGAAACATGAGAGGAAAGGGAGG - Intergenic
1070753418 10:78977078-78977100 GAACCCATGAGGGAAATGGGAGG - Intergenic
1075021087 10:118952967-118952989 GGGGCCAAGAGAGCAAGGGCTGG - Intergenic
1076495339 10:130893396-130893418 GCACCCACAAGAGCATGGGGAGG + Intergenic
1077544174 11:3161948-3161970 AGACCCCTGTGAGCAAGGAGGGG + Intronic
1077555269 11:3222921-3222943 GGACACTGGAGAGCAGGGGGAGG + Intergenic
1079814484 11:25038953-25038975 GGATACTTGAGAGCAATGGGTGG + Intronic
1080302770 11:30802850-30802872 GGTCCCATGAGAAAATGGGGAGG + Intergenic
1083902368 11:65649874-65649896 GGACCCAGGAGAGCAGGGGAGGG + Intronic
1084695769 11:70754721-70754743 GGACCCATAAGAGTTAGTGGCGG + Intronic
1085672168 11:78477346-78477368 GGAGCTTTGAGAGGAAGGGGTGG - Intronic
1086634542 11:89065629-89065651 AGACCCAGGAGGGCAAGTGGTGG - Intronic
1087044548 11:93833915-93833937 GGACTGATGAGGCCAAGGGGAGG - Intronic
1089150686 11:116361521-116361543 GGGCCCAGGAGAGAAAGAGGTGG + Intergenic
1089702845 11:120255674-120255696 GGACCCTGGAGAGCTGGGGGTGG + Intronic
1092058133 12:5523855-5523877 GGACCCATAAGAGGGAGGGATGG + Intergenic
1092203228 12:6600166-6600188 GAACCCATGAGAAGAAGGGTGGG - Intronic
1095134720 12:38585993-38586015 GGACCCCTGAAAGAAAGTGGAGG - Intergenic
1097037629 12:56134165-56134187 TGACTCAGGAGAGCAAGGTGAGG + Exonic
1101041286 12:100758405-100758427 GGAGCCAGCAAAGCAAGGGGAGG + Intronic
1101469583 12:104984133-104984155 GAACCCATGAGGGCAGGGGCTGG - Intergenic
1102412599 12:112733069-112733091 AGACACATGAGTGCCAGGGGAGG - Intronic
1104943479 12:132405428-132405450 GAACCCAGGAGAGCCAGGGCTGG - Intergenic
1105540115 13:21308904-21308926 GAACCCATCAAAGCAAGAGGTGG - Intergenic
1105690922 13:22838390-22838412 GGGCCCATGACAACCAGGGGAGG + Intergenic
1106062713 13:26310385-26310407 GGACCAATGGGGGCGAGGGGTGG + Intronic
1106226502 13:27790626-27790648 GGGCCCAGGGGTGCAAGGGGCGG - Intergenic
1107065970 13:36214600-36214622 GGAGCCATTAGTGCAGGGGGCGG - Exonic
1107814616 13:44233104-44233126 GGACCCTGGAGAGCTAGAGGAGG + Intergenic
1114651090 14:24284933-24284955 GGGCCCATGAGTAGAAGGGGAGG - Intergenic
1114973149 14:28059566-28059588 GGAAGCAAGAGAGAAAGGGGAGG - Intergenic
1118616142 14:67575699-67575721 GGACCGATGACAGGATGGGGAGG - Intronic
1118822988 14:69357181-69357203 GGAGCTATGGGAGCAAGGAGAGG + Intergenic
1119272827 14:73324828-73324850 GTACCAAAGAGAGAAAGGGGAGG - Intronic
1121405389 14:93716533-93716555 GGATGCATGAGAGCAAGTGATGG - Intergenic
1121518955 14:94572521-94572543 GGGTACATGAGAGCAAGAGGAGG - Intronic
1122232792 14:100315310-100315332 TGATCCAGGAGAGCAAGGAGGGG - Intergenic
1123938423 15:25205164-25205186 GGTCCCATCAGGGCAATGGGTGG - Intergenic
1126766620 15:52017120-52017142 GGACACGTGAGACAAAGGGGAGG - Intronic
1128078130 15:64841256-64841278 AGACCCCTGAGAGCCAGGGGCGG + Intergenic
1128790212 15:70427698-70427720 GGACCCACATCAGCAAGGGGTGG - Intergenic
1129161674 15:73751370-73751392 GGACACAGGAGAGGAGGGGGAGG + Exonic
1130178116 15:81596094-81596116 GTACCCCTGAGAGCAAGGCCAGG - Intergenic
1130297451 15:82657126-82657148 GGAAGCAGGAGAGCAAGGTGTGG - Intergenic
1131153287 15:90060033-90060055 GGACCCAACAGAGCAAGAGCGGG - Intronic
1132237129 15:100230480-100230502 GGTGCAAGGAGAGCAAGGGGTGG + Intronic
1132989375 16:2785187-2785209 GGACCTCTGAGAGGAAGGCGTGG + Intronic
1137543036 16:49377797-49377819 GGCCTCATGACAGCACGGGGAGG + Exonic
1139284126 16:65795748-65795770 GGAGAGAGGAGAGCAAGGGGTGG - Intergenic
1139634121 16:68247693-68247715 GGTGCCATGAGAGGCAGGGGCGG - Intronic
1140240933 16:73199516-73199538 GTAGCCAAGAGAGCAATGGGTGG - Intergenic
1140383360 16:74511006-74511028 GCATCCATGGAAGCAAGGGGTGG + Intronic
1140475315 16:75236964-75236986 GGACCCTTGACAGCCATGGGGGG + Exonic
1142021117 16:87783299-87783321 GGACCCATGGGGGTAAAGGGAGG - Intergenic
1142883976 17:2901409-2901431 GGACCCATGAGAGGAGGGGCTGG - Intronic
1143034253 17:3985456-3985478 GGAGCGATGAGCGCAAGGGAGGG - Intergenic
1148497185 17:48059962-48059984 GGACCTGTGAGAGGAAGGGAAGG + Exonic
1150850080 17:68696037-68696059 GGAGGCAGGAGAGCAATGGGTGG - Intergenic
1151032596 17:70758475-70758497 GGATCCATCAGAGCCATGGGTGG + Intergenic
1151358450 17:73573900-73573922 GGGCCCCTGAGAGCAAGGCCCGG - Intronic
1151611824 17:75181832-75181854 TGACCCATGACAACAAAGGGGGG - Intergenic
1151727177 17:75891971-75891993 GGACCCAGGACAGCAGGGGGAGG + Intronic
1157556851 18:48618532-48618554 GAGCCCATCAGAGGAAGGGGAGG + Intronic
1157846475 18:51008259-51008281 GCTCACATGATAGCAAGGGGAGG - Intronic
1160370503 18:78368876-78368898 GGAGCCATCAGAGCCAGGAGAGG + Intergenic
1160554816 18:79718167-79718189 GGACCCAAGACTGCAAGCGGGGG - Intronic
1161026625 19:2040089-2040111 GGACCCCTGAGTCCAGGGGGCGG - Intronic
1161212055 19:3071979-3072001 AGATCCATGAGAGTAAGGAGCGG + Intergenic
1162144795 19:8607058-8607080 GGGTGCAGGAGAGCAAGGGGAGG + Intronic
1162341116 19:10092011-10092033 GGTCCCATGAGAGTCTGGGGAGG - Intronic
1162527600 19:11215568-11215590 TGACCCATGAGGGCACTGGGTGG + Intronic
1162555011 19:11381328-11381350 GGACCAATAAGAGTAGGGGGAGG + Intronic
1163366882 19:16880422-16880444 GGACCCATGAGAGCAAGGGGTGG + Intergenic
1164679289 19:30123180-30123202 GGACTCATGAGAGCCTGGAGAGG - Intergenic
1166069408 19:40378350-40378372 GGACCCAGCAGAGCTGGGGGAGG + Exonic
1166305078 19:41932806-41932828 GGAGCCAGGAGAGCACGGGGAGG + Intergenic
1168130556 19:54316009-54316031 GAACCCCTGAGAGTAAGGAGGGG - Intergenic
1168152513 19:54456518-54456540 GGACCCATGGGAGAAGGAGGAGG + Intronic
925487982 2:4357462-4357484 TGACCCATTAAAGAAAGGGGCGG + Intergenic
926082871 2:10002996-10003018 GGAGCCGTGAGAGCAGGGAGTGG - Intergenic
927196489 2:20551271-20551293 GGGCCCAGAAGAGAAAGGGGAGG + Intergenic
927501853 2:23588413-23588435 GGGCCCAGGCGGGCAAGGGGAGG - Intronic
929798853 2:45082557-45082579 CCACCCTTAAGAGCAAGGGGAGG + Intergenic
932715005 2:74094412-74094434 GGAGCCTTGAGGGCCAGGGGAGG + Intronic
935239800 2:101168575-101168597 GGACACACTAGTGCAAGGGGTGG - Intronic
935259329 2:101341615-101341637 AGACCCAAGAAAGGAAGGGGCGG + Intergenic
938490110 2:131756765-131756787 AGGCCCATGAGAGGAAGGTGAGG + Intronic
940392089 2:153144040-153144062 TGACCCATGAGAGCTAGAGGTGG - Intergenic
942346794 2:175011786-175011808 GGACTCATGAGAGGAAGAAGTGG + Intergenic
942519701 2:176790777-176790799 GGATCCAGGAGAGGAAGGTGTGG - Intergenic
944968248 2:204961041-204961063 GGAGTCCTGAGAACAAGGGGCGG + Intronic
945406171 2:209451511-209451533 AGAGCCATGGGAGCAAGGGGAGG - Intronic
945448000 2:209960840-209960862 GGAGCCTTCAGAGAAAGGGGAGG + Intronic
946166814 2:217869511-217869533 ACACCCATCAGAGCCAGGGGTGG + Intronic
946530810 2:220568369-220568391 AGAGCCATGGGAGCAAGGCGAGG - Intergenic
947618922 2:231576317-231576339 GGAGTCGTGAGAGCAAGGGGAGG - Intergenic
948075800 2:235164343-235164365 GGATCCATGAGAGACAGGAGGGG + Intergenic
948369960 2:237482606-237482628 GGAGCCCAGAGAGCAAGCGGAGG + Intergenic
948462010 2:238134338-238134360 GGTCCCAGGAGAGCCTGGGGTGG + Intergenic
948547530 2:238743359-238743381 GGCCCCAAGAGAGCAAGCGCTGG - Intergenic
1172696103 20:36824044-36824066 GGTCCTAGGAGAGCAAGGGTGGG + Intronic
1174295240 20:49540875-49540897 GGATCCAGGAGCTCAAGGGGAGG - Intronic
1174595418 20:51679591-51679613 AGAACCTTGAGAGCAAGGAGGGG - Intronic
1175479307 20:59300419-59300441 GCACCCAGGACAGCGAGGGGCGG - Exonic
1175692445 20:61075402-61075424 TGGCCCATGCAAGCAAGGGGTGG - Intergenic
1176991964 21:15507838-15507860 GCACACATGAGAGCAAGGGAGGG - Intergenic
1178561220 21:33641749-33641771 TGACCAATGGGAGCAGGGGGCGG - Exonic
1178809722 21:35870437-35870459 GGAACCATGAGAGAAAGTGCTGG - Intronic
1179415538 21:41195403-41195425 GGACCCATTAGGGGAAGGGTTGG + Intronic
1180130277 21:45822611-45822633 AGGGCCAGGAGAGCAAGGGGCGG + Intronic
1180963520 22:19773652-19773674 GGACCCAGGAGAGCAGGTGGAGG - Intronic
1181162439 22:20966489-20966511 GGGTGCCTGAGAGCAAGGGGTGG - Intronic
1181974255 22:26717625-26717647 GGGCCCATGAGTGCAAGGACAGG + Intergenic
1183821176 22:40346857-40346879 GGCCCCAGGAAAGCAAGGGCAGG + Intronic
1184247697 22:43244113-43244135 AGACCCAGGAGAGAAAGGCGAGG - Intronic
1184517465 22:44971526-44971548 GTACCCGGGAGAGCAAAGGGTGG - Intronic
1185108292 22:48886487-48886509 GGCTCCAGGAGAGCAAGGGCTGG - Intergenic
1185301198 22:50081994-50082016 AGACCCAGGACAGCACGGGGCGG + Intronic
950635117 3:14308703-14308725 GGACACATGTAAGCAGGGGGTGG + Intergenic
951842261 3:27047046-27047068 TTACCCATGTTAGCAAGGGGAGG - Intergenic
954205274 3:49054256-49054278 AGGCCCAGGAGAGCTAGGGGAGG + Intronic
958955963 3:100466364-100466386 TGACCCCTGAGAGCAACAGGGGG - Intergenic
959459558 3:106608486-106608508 TGACACATGAGAGAAAGAGGTGG + Intergenic
959913143 3:111787707-111787729 GGACACATGGGAGATAGGGGAGG + Intronic
961441268 3:126954690-126954712 GGCCCCATGAGGGCAGGGTGGGG + Intronic
961524965 3:127490805-127490827 GGGCCCATGAGAGGAAGGCAAGG - Intergenic
965336888 3:167437486-167437508 GGAACCATGACAATAAGGGGAGG + Intergenic
969284070 4:6191458-6191480 GTCCCCATGAGGACAAGGGGTGG - Intronic
971167540 4:24199424-24199446 AGAACTATGGGAGCAAGGGGAGG + Intergenic
976398676 4:84583576-84583598 GGACACTTGAGAGCAAGGGTGGG + Intronic
977541983 4:98329497-98329519 GGACCCATTAGGGCAAGGTGTGG + Intronic
983632109 4:169859963-169859985 GGACCCAGGAGGGCCAGGAGAGG + Intergenic
985577479 5:680224-680246 GCACGCATGAGAGCACGGTGGGG + Intronic
985592411 5:772320-772342 GCACGCATGAGAGCACGGTGGGG + Intergenic
986163599 5:5252833-5252855 GGACCCTTGAGAGAAGGTGGTGG - Intronic
987046768 5:14116062-14116084 AGAACCAGGAGAGCCAGGGGTGG + Intergenic
996119156 5:119651624-119651646 GGACCTAAGAAAGCAATGGGAGG + Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
998367472 5:141640395-141640417 AGACACCTGAGAGAAAGGGGAGG - Exonic
998710382 5:144818109-144818131 GGACCCAGGAGAGCAAGTTGTGG + Intergenic
999272157 5:150302837-150302859 GGACCCCAGAGGGGAAGGGGAGG + Exonic
1000100488 5:158011742-158011764 GCTCCCATTAGTGCAAGGGGTGG + Intergenic
1001562559 5:172678910-172678932 GGACCTAAGAGAGAAAGGGGAGG + Intronic
1001584469 5:172824022-172824044 GGAGCCGAGTGAGCAAGGGGAGG + Intergenic
1002101891 5:176861880-176861902 GGTCCCCTGAGAGGATGGGGTGG - Intronic
1002515705 5:179756882-179756904 GGGTGCATGAGAGCAAGGTGTGG + Intronic
1003529769 6:6927963-6927985 GGACCCATGGAAGGACGGGGTGG + Intergenic
1006068371 6:31478694-31478716 GGACCCAGGAGAGGAGGAGGAGG + Intergenic
1007006744 6:38371164-38371186 AGACCCATTAAAGCAATGGGGGG - Intronic
1007385922 6:41520078-41520100 GGACCCATGAGCTCAGGGGAGGG + Intergenic
1007692436 6:43711415-43711437 GGACCGAGGAGAGTAGGGGGTGG + Intergenic
1007693809 6:43719266-43719288 GGACCCTGGAGAAGAAGGGGTGG - Intergenic
1010942375 6:81933987-81934009 GGACCCAGGAGAGCTTGGAGAGG + Intergenic
1015813744 6:137186485-137186507 TGACCCCTGAGAGCAATGGGGGG + Intergenic
1017180349 6:151546225-151546247 GCACCCATGAGAGCATCAGGTGG - Intronic
1017717357 6:157222255-157222277 GGTCCTAGGAGGGCAAGGGGAGG - Intergenic
1018519942 6:164636882-164636904 GGAGCCAAGAAAGCAATGGGGGG + Intergenic
1024887364 7:54159901-54159923 TGACCCATGGGAACAAGAGGAGG + Intergenic
1025020254 7:55474891-55474913 GGAGCCAGGGCAGCAAGGGGTGG + Intronic
1027515450 7:79136925-79136947 GGACCCCTGGGACCAATGGGAGG - Intronic
1029411335 7:100413312-100413334 GGAGCTCAGAGAGCAAGGGGAGG - Intronic
1029455188 7:100666543-100666565 GGACCCTCGAGAGCAAGTGGCGG - Intergenic
1032525059 7:132573742-132573764 GGACAGATGAGAGCCCGGGGAGG + Intronic
1034637947 7:152582123-152582145 GGACCTATAAGAGCATGTGGGGG - Intergenic
1034776565 7:153832926-153832948 GCTTCCATGAGTGCAAGGGGAGG - Intergenic
1036648344 8:10625856-10625878 GTACCGATCAGAGCCAGGGGAGG + Intronic
1040919359 8:52599483-52599505 TGACCCCTGAGAGCAACGTGAGG - Intergenic
1043937306 8:86156261-86156283 GAACCCTTGAGAGCAATGGATGG - Intergenic
1044794927 8:95886896-95886918 GGCCCCAGGAGAGGAAGGAGTGG - Intergenic
1048599308 8:135902198-135902220 GGAGCCTTGAGAACAAGTGGGGG - Intergenic
1048856484 8:138690719-138690741 GGATACATGGGAGTAAGGGGAGG - Intronic
1049046395 8:140155320-140155342 GGACCCATGAGTGGAAGCTGCGG + Intronic
1049388841 8:142357905-142357927 GGCTCCATGAGAGGAGGGGGCGG + Intronic
1049661127 8:143820185-143820207 GGACCCAAGCGAGCAAGGGAAGG - Intronic
1049981252 9:905667-905689 GGACCCGTGAGGGGAAGAGGAGG + Intronic
1051717573 9:20001030-20001052 GGGCCCATTAGAGCAATGGATGG - Intergenic
1052850799 9:33377332-33377354 GGAGGCAGGAGAGCAAGGAGAGG - Intergenic
1054350548 9:64014887-64014909 GGGCCCATGAGGGGAAGGTGAGG - Intergenic
1054904890 9:70406103-70406125 AGTCCCAGGAGAGCAAGTGGGGG + Intronic
1057616965 9:96600342-96600364 GGACAGATGAGGGCAAGGAGGGG + Intronic
1061291975 9:129655548-129655570 GGACCCAGCAGAGCAAGGACAGG - Intergenic
1062577232 9:137214428-137214450 GGACCGAGGAGGGCAAGGTGAGG + Intronic
1185962277 X:4557589-4557611 GGACTCAGGAGAGAAAGGGTGGG + Intergenic
1187888057 X:23907616-23907638 GGCCCCAAGAGAGCGCGGGGAGG + Intronic
1192167022 X:68832740-68832762 TGCCCCATGAGCGCAAGGTGGGG + Intronic
1192496802 X:71621640-71621662 GGACACATGAGAGAAAGGCAGGG + Intergenic
1196739483 X:119011982-119012004 GGAGCCATGCGAGCAAAGGGAGG + Intronic
1197955431 X:131941781-131941803 AGAACCATGAGAGAAAGGAGGGG - Intergenic
1198406253 X:136315564-136315586 ATACCTATGAGAGCAAGGTGAGG - Intronic
1199980405 X:152917498-152917520 GGACCCTGGAGAGCAGGGTGGGG + Intronic
1201667832 Y:16478938-16478960 AGACCAATGAGATCAATGGGTGG - Intergenic