ID: 1163369082

View in Genome Browser
Species Human (GRCh38)
Location 19:16892133-16892155
Sequence CTCAGACACCAGTGCGTCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163369082_1163369094 14 Left 1163369082 19:16892133-16892155 CCCACGACGCACTGGTGTCTGAG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1163369094 19:16892170-16892192 GGGGCTGGGGCTGCATTCCCTGG 0: 1
1: 0
2: 9
3: 76
4: 553
1163369082_1163369089 -6 Left 1163369082 19:16892133-16892155 CCCACGACGCACTGGTGTCTGAG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1163369089 19:16892150-16892172 TCTGAGATGGGGCTGGAGCTGGG 0: 1
1: 1
2: 5
3: 67
4: 539
1163369082_1163369090 -5 Left 1163369082 19:16892133-16892155 CCCACGACGCACTGGTGTCTGAG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1163369090 19:16892151-16892173 CTGAGATGGGGCTGGAGCTGGGG 0: 1
1: 2
2: 20
3: 150
4: 985
1163369082_1163369093 1 Left 1163369082 19:16892133-16892155 CCCACGACGCACTGGTGTCTGAG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1163369093 19:16892157-16892179 TGGGGCTGGAGCTGGGGCTGGGG 0: 5
1: 175
2: 228
3: 657
4: 2803
1163369082_1163369092 0 Left 1163369082 19:16892133-16892155 CCCACGACGCACTGGTGTCTGAG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1163369092 19:16892156-16892178 ATGGGGCTGGAGCTGGGGCTGGG 0: 2
1: 16
2: 219
3: 419
4: 1583
1163369082_1163369091 -1 Left 1163369082 19:16892133-16892155 CCCACGACGCACTGGTGTCTGAG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1163369091 19:16892155-16892177 GATGGGGCTGGAGCTGGGGCTGG 0: 1
1: 10
2: 272
3: 559
4: 2178
1163369082_1163369088 -7 Left 1163369082 19:16892133-16892155 CCCACGACGCACTGGTGTCTGAG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1163369088 19:16892149-16892171 GTCTGAGATGGGGCTGGAGCTGG 0: 1
1: 0
2: 6
3: 71
4: 647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163369082 Original CRISPR CTCAGACACCAGTGCGTCGT GGG (reversed) Exonic
901240578 1:7690766-7690788 CTCAGACAACAGTGAGTGGGTGG + Intronic
905625136 1:39485016-39485038 CTCAGACACCAGTCCAGTGTTGG + Intronic
916118907 1:161511169-161511191 CTCTTACACCAGTGCCTGGTAGG + Intronic
1066437540 10:35407882-35407904 ATCAGACACCAGTGGAACGTGGG + Intronic
1068797523 10:61100382-61100404 CTCAGAGGCCAGTGGGTCTTAGG - Intergenic
1069535547 10:69250157-69250179 CTCATAGACCAGAGGGTCGTGGG - Intronic
1074463514 10:113661164-113661186 CTCAGACATCATTGCTTCCTAGG - Intronic
1076704116 10:132291926-132291948 CTCAGACACCAGTGGGGAGCGGG + Intronic
1081711091 11:45215889-45215911 CTCAGACACTATTGCATAGTGGG - Intronic
1085956291 11:81400176-81400198 TTCAGACACCAATGCCTAGTGGG - Intergenic
1090201658 11:124861961-124861983 CTCACACACCAGTGGGGGGTGGG + Intergenic
1096817939 12:54213421-54213443 CTGAGGCACCAGTGGGTCCTTGG + Intergenic
1102582444 12:113899149-113899171 CTCAGAGACCATCACGTCGTTGG + Intronic
1122414480 14:101542330-101542352 GTCAGACTCCAGGGCGTCGCTGG + Intergenic
1127781363 15:62319556-62319578 CCCAGACACCACTCAGTCGTTGG + Intergenic
1142523448 17:520916-520938 CTCAGACACCGGTGGGATGTGGG - Intronic
1147240288 17:39086321-39086343 CTCAGACACCAGGGGGTCACAGG - Intronic
1152048542 17:77955212-77955234 TTCAGGCACCAGTGTGTGGTAGG + Intergenic
1157743602 18:50115298-50115320 CTCAGACAGCAGTGAGCCCTTGG + Intronic
1163369082 19:16892133-16892155 CTCAGACACCAGTGCGTCGTGGG - Exonic
935839979 2:107098528-107098550 CTCAGACAGCAGTGGGTGATTGG - Intergenic
938904505 2:135825688-135825710 CTCAGACAGCTGTGTGCCGTTGG + Intronic
940627999 2:156200577-156200599 CTCAGACACCAGTGCTCTGTTGG - Intergenic
941879596 2:170467544-170467566 CTCAGACAGCAGTGCTTCTCAGG - Intronic
941934202 2:170970663-170970685 CTCAGACACCTGCGGGTGGTGGG - Intergenic
947314744 2:228843810-228843832 ATCACACACCAGGGCGTTGTGGG + Intergenic
948681066 2:239635003-239635025 CTCCCACACCTGTCCGTCGTTGG + Intergenic
1170955591 20:20976731-20976753 CTCAGACAATAGTGAGTGGTGGG - Intergenic
1171339687 20:24417764-24417786 CTCAGAAACCAGTTGGTGGTGGG - Intergenic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1176055615 20:63145373-63145395 CTCACACACCAGTGTCACGTTGG + Intergenic
1178001013 21:28162234-28162256 ATCAGACACCAGTGGAACGTGGG - Intergenic
1181534943 22:23536868-23536890 CTCAGAGACCGGTGCGGCGCGGG + Intergenic
1184733884 22:46386531-46386553 CCCAGCCACCAGGGCGGCGTGGG - Exonic
966947272 3:184785661-184785683 CTCAGACAGCACTGAGACGTGGG + Intergenic
973750938 4:54020861-54020883 ATCAGACACCAGTGAATTGTGGG - Intronic
985861809 5:2477320-2477342 CTCAGACACCTGTGGGGCGAGGG + Intergenic
990071207 5:51785307-51785329 ATCACACACCAGGGTGTCGTGGG - Intergenic
1001268386 5:170291749-170291771 CCCAGGCAACAGGGCGTCGTAGG + Intronic
1010003272 6:70969429-70969451 GTCAGAGACCAGTACATCGTTGG - Intergenic
1014637372 6:123864406-123864428 CTCAGACAACAGTACTTGGTAGG - Intronic
1019217619 6:170453871-170453893 CTCAGCCCCCAGTGCTGCGTGGG + Intergenic
1027158041 7:75782326-75782348 ATCAGACACCAATGCAACGTGGG - Intronic
1031468304 7:122140922-122140944 TACAGACACCAGTGCTTCTTGGG - Intronic
1042858726 8:73293681-73293703 CTAAGACACCTATGAGTCGTGGG - Exonic
1048476954 8:134752193-134752215 CTCAGACAGCAGTGTGGGGTGGG - Intergenic
1049435477 8:142584300-142584322 CTCAGACACCAGTGGGGTGGCGG - Intergenic
1057812792 9:98270598-98270620 ATCAGACACCAGTGGAACGTGGG + Intergenic
1059212077 9:112522806-112522828 CTCAGTCCCCAGTGGGTCCTTGG + Intronic
1060804505 9:126565980-126566002 CTCAGACACCAGTGCGGGTCAGG + Intergenic
1188430840 X:30104407-30104429 ATCAGACACCAGTGGAACGTGGG - Intergenic