ID: 1163371442

View in Genome Browser
Species Human (GRCh38)
Location 19:16903463-16903485
Sequence GAACCCTCTGGGGGTCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163371435_1163371442 5 Left 1163371435 19:16903435-16903457 CCTGCAGTCTGGCATGCTGCTGA 0: 1
1: 0
2: 0
3: 19
4: 203
Right 1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG 0: 1
1: 0
2: 3
3: 38
4: 253
1163371434_1163371442 10 Left 1163371434 19:16903430-16903452 CCTGTCCTGCAGTCTGGCATGCT 0: 1
1: 0
2: 1
3: 13
4: 215
Right 1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG 0: 1
1: 0
2: 3
3: 38
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163371442 Original CRISPR GAACCCTCTGGGGGTCCCTG GGG Intronic
900383159 1:2395393-2395415 GCACCCTCTGTGGATCCCTCAGG - Intronic
900466808 1:2829783-2829805 GATCCCTCCCGGGGTCTCTGAGG + Intergenic
903215146 1:21839591-21839613 CCACCCTCTGCGGGTCCCTGAGG - Intronic
904892928 1:33792906-33792928 GAAACTTCTGCAGGTCCCTGGGG - Intronic
909825302 1:80119952-80119974 GGACACTCTGGGGGATCCTGAGG - Intergenic
912480717 1:109980521-109980543 CCACCCTCTGGGGGTCCCTAAGG + Intergenic
915635263 1:157181884-157181906 GAAGGCCCTGGGTGTCCCTGTGG + Intergenic
915650532 1:157307328-157307350 GAAAACTCTGGGTGTCCCTGTGG - Intergenic
915660860 1:157403838-157403860 GAAGACTCTGGGTGTCCCTGTGG + Intergenic
917928887 1:179810393-179810415 GAACTCTCTTGGAGACCCTGGGG - Intronic
920058169 1:203207761-203207783 GGATCCTCTGGAGATCCCTGGGG + Intergenic
921222088 1:212980518-212980540 GGACACCCTGGGGGTCCCAGAGG + Intronic
923049560 1:230381328-230381350 CTACTCTCTGGGTGTCCCTGGGG + Intronic
923715693 1:236423105-236423127 GAAATCTCTGGGGGTCCTAGTGG + Intronic
1065521740 10:26580044-26580066 GATGCCTCTGGGGGTACCTTGGG - Intergenic
1066802554 10:39207150-39207172 GGCGCCTTTGGGGGTCCCTGGGG + Intergenic
1067444549 10:46332648-46332670 AAAGCCTGTGAGGGTCCCTGTGG - Intergenic
1069854803 10:71434216-71434238 GAACCAGCTGAGGGTCACTGGGG - Intronic
1069863664 10:71486885-71486907 CGACCCTCTGGGGAGCCCTGGGG + Intronic
1072057677 10:91776476-91776498 GAACCCTCTGGGATATCCTGTGG - Intergenic
1072660758 10:97362150-97362172 AAACCCTCTGGGGGTCTCAGTGG + Intronic
1072693481 10:97586689-97586711 GAAGAGTCTGGGGGTCTCTGTGG - Intronic
1073177340 10:101564616-101564638 GACCCCTCTCAGGCTCCCTGGGG + Intergenic
1073184172 10:101605655-101605677 GAACACTCTGCGGGTCCCCTGGG - Intronic
1075603704 10:123789275-123789297 GCCCCCTCTGAGGGGCCCTGTGG - Intronic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076237848 10:128879641-128879663 GGACACTCTAGGGGTCCATGGGG + Intergenic
1076738591 10:132469508-132469530 GAAACCTCTGCAGGTCCCAGAGG + Intergenic
1076853406 10:133103887-133103909 CCATCCTCTGGGGTTCCCTGGGG + Intronic
1077114013 11:874983-875005 GAGCCCTGTGGGGGCTCCTGAGG - Intronic
1077298176 11:1835655-1835677 GAACCCGCTGTGGCTCCCTCGGG - Intronic
1077392142 11:2305035-2305057 GACCACTCTGGGGGTCCCTGAGG + Intronic
1078084583 11:8225962-8225984 TAGCCCTGTGGGAGTCCCTGGGG - Intronic
1081701019 11:45152902-45152924 AAACCCTCTGAGGCTCCCTGTGG - Intronic
1082618057 11:55386444-55386466 CAACCTCCTGTGGGTCCCTGGGG - Intergenic
1083229774 11:61309136-61309158 GAATCCTCTGGTTGCCCCTGTGG + Intronic
1084219490 11:67668365-67668387 GACCCCACTGGGGTTCCCTTGGG - Intronic
1084224959 11:67710361-67710383 GAAGCCTCTAGTGGTCCCTGGGG - Intergenic
1084262778 11:67990204-67990226 GAAGCCTCTAGTGGTCCCTGGGG - Intergenic
1084345746 11:68547315-68547337 AAACCCTCTGCGAGTCCCAGGGG - Intronic
1084544922 11:69810451-69810473 GCACCATCTCGTGGTCCCTGTGG + Exonic
1084810612 11:71608901-71608923 GAAGCCTCTAGTGGTCCCTGGGG + Intergenic
1087102357 11:94378090-94378112 AATCCATCTGGGGATCCCTGTGG + Exonic
1088834904 11:113569249-113569271 GGACACTCTGTGGGTCCTTGGGG - Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1091918051 12:4283221-4283243 GGAGCCTCTGGGGGTCCCGCTGG - Intronic
1094176679 12:27548316-27548338 GAACCTTCCAGGGGGCCCTGGGG + Intronic
1095914366 12:47461234-47461256 GAACCCTCTGAAGGTCCCCAGGG - Intergenic
1096786904 12:54022032-54022054 TAAACCTCTGGGTGTCCCTGTGG + Intronic
1096865718 12:54561513-54561535 GTCCCCTCTTGGGGGCCCTGGGG + Intronic
1101223999 12:102669173-102669195 GCACCCTCAGGAGCTCCCTGAGG - Intergenic
1103571263 12:121846677-121846699 GAACTCTCTGGGGGTGGGTGTGG + Intronic
1105437881 13:20392232-20392254 GGCCCCTCTGCGGGTCGCTGGGG - Intergenic
1105893613 13:24699696-24699718 GGACCCAATGGGGGTGCCTGCGG + Intronic
1113065973 13:106374765-106374787 GACCCCTCTGGTTGTCACTGTGG + Intergenic
1113902859 13:113806275-113806297 GGTGCGTCTGGGGGTCCCTGGGG + Intronic
1114189371 14:20429226-20429248 GAGCCCTATGGGGGTACCTCGGG - Exonic
1115411805 14:33083789-33083811 AGAGCCTCTGGGGGTCCCAGTGG - Intronic
1118224623 14:63887449-63887471 ACACCCTCTGTGGGTCCCTGGGG + Intronic
1121051161 14:90819826-90819848 GAACCCTCTGGGCTTCACCGTGG + Intergenic
1121424579 14:93840478-93840500 GAACTCTCAGGGGGCGCCTGCGG - Intergenic
1121517317 14:94561256-94561278 GAACCCTCTTGGGGTTCCCCAGG + Exonic
1122790147 14:104180948-104180970 CCGCCCTCTGAGGGTCCCTGGGG + Intergenic
1122815878 14:104313776-104313798 GAGCACCCTGAGGGTCCCTGAGG + Intergenic
1124124495 15:26926580-26926602 GGACCCTCTGAAGATCCCTGAGG + Intronic
1124234910 15:27981777-27981799 GGACCCTCTGAGGATCTCTGTGG + Intronic
1124483977 15:30100115-30100137 GAACCCTTGAAGGGTCCCTGGGG + Intergenic
1124519603 15:30397109-30397131 GAACCCTTGAAGGGTCCCTGGGG - Intergenic
1124539050 15:30569112-30569134 GAACCCTTGAAGGGTCCCTGGGG + Intergenic
1124616351 15:31245113-31245135 CAACTCTCTGGGGCTCCCTAGGG + Intergenic
1124759600 15:32438460-32438482 GAACCCTTGAAGGGTCCCTGGGG - Intergenic
1127377571 15:58398993-58399015 AGGCCCTCTGGGGGACCCTGAGG + Intronic
1128086256 15:64888652-64888674 GGAGACTCTGGGGCTCCCTGAGG - Intronic
1129239926 15:74245149-74245171 CACTCCTCTGGGGCTCCCTGAGG + Intronic
1129459451 15:75693195-75693217 GAACCACCTGGAGGTGCCTGTGG - Exonic
1129726779 15:77905527-77905549 GACCCCTCTGGAGGTACTTGGGG - Intergenic
1129954020 15:79617152-79617174 GAAGCCTCTGTGAGTCTCTGGGG + Intergenic
1130486450 15:84400949-84400971 GACCCCTCTGGAGGTACTTGGGG + Intergenic
1130580798 15:85135361-85135383 CAGCCCTCTGGGGGTCACTCTGG - Intronic
1130808418 15:87351527-87351549 GAACAGTCTGGGGGTCATTGTGG - Intergenic
1131671643 15:94626145-94626167 GAAGCCTCTGGGTGGCCCTGAGG + Intergenic
1132259359 15:100408637-100408659 GATCCCTCTGGATTTCCCTGCGG + Intronic
1132678475 16:1130355-1130377 GCAGCCTCTGGGGGTCTCTGAGG - Intergenic
1132980555 16:2736831-2736853 GGACACTATGGGGGCCCCTGAGG - Intergenic
1132995277 16:2819435-2819457 AACCCCTCTGGGGGTTCCTCTGG + Intronic
1133284060 16:4682533-4682555 GAAACCGCTGGTGGTTCCTGGGG - Intronic
1134056017 16:11170349-11170371 GAACCCACGTGGGCTCCCTGGGG - Intronic
1136277070 16:29185137-29185159 GAACCCTCAGGGGCCGCCTGGGG + Intergenic
1138352289 16:56352413-56352435 GAAGCTTCTAGGGGTCCCTGGGG + Intronic
1140442525 16:74998945-74998967 TAACCCTTTCGCGGTCCCTGCGG - Intronic
1140775719 16:78247420-78247442 GATGCCTCTGGGGATCCCAGAGG + Intronic
1141393583 16:83684946-83684968 GAACCCTGTGTGGGGCCGTGTGG - Intronic
1141459320 16:84168123-84168145 GTACCTTCTGGGGGCCCCAGGGG + Intronic
1141476237 16:84275298-84275320 GAGCCTTCTGGGGTGCCCTGGGG - Intergenic
1141552201 16:84813546-84813568 CACCTCTCTGGGGGACCCTGAGG - Intergenic
1141649832 16:85386953-85386975 GAAGGTTCTGGGGCTCCCTGGGG + Intergenic
1142081446 16:88151182-88151204 GAACCCTCAGGGGCCGCCTGGGG + Intergenic
1142149594 16:88506745-88506767 GGACCCTCTGAGGGGCGCTGGGG + Intronic
1142624406 17:1182743-1182765 GAAATCTCTGCGGGTCCATGGGG + Intronic
1142631495 17:1229186-1229208 GAGCCGCCTGGGGGTCCCCGAGG + Intergenic
1143882410 17:10039833-10039855 GCACCCTCTGGGGCTCCCAGAGG + Intronic
1144572494 17:16408192-16408214 GTGGCCTCTGGGGCTCCCTGGGG + Intergenic
1144673838 17:17148289-17148311 TAGACCTCTGGGGGTCCCTGAGG + Intronic
1145011021 17:19367971-19367993 GAGCACTCTGGGGGGCCCTGAGG + Intronic
1146398836 17:32488024-32488046 GACCCGTTTGGGCGTCCCTGCGG - Exonic
1146695350 17:34904928-34904950 GGACTCTCTGGAGGCCCCTGGGG - Intergenic
1147600107 17:41740081-41740103 GAACCCTCCAGGGGCACCTGTGG + Intergenic
1147652550 17:42070845-42070867 GTACCCGCTGAGTGTCCCTGAGG + Intergenic
1148103767 17:45108490-45108512 GAAGCCTAGGGGAGTCCCTGTGG + Exonic
1148441974 17:47716161-47716183 GTACCCTGTGAGGGTCCCTGGGG + Intergenic
1150601099 17:66651756-66651778 GGACACTCTGGGTGCCCCTGAGG - Intronic
1151722995 17:75868792-75868814 GAAGCCCCTGGTGGTCCTTGTGG - Intergenic
1152014912 17:77744277-77744299 GGGCCCTCATGGGGTCCCTGGGG + Intergenic
1152100103 17:78296356-78296378 CCTCCCTCTGGGGGTCCCTCTGG + Intergenic
1152444971 17:80337205-80337227 GAACCCTCTGGGGGTGACGCTGG - Intronic
1152806102 17:82357112-82357134 GAGCCCTCTGAGGGCCCCTGTGG - Intergenic
1155022859 18:21912527-21912549 GCAGCCTGTGGGGGTCACTGTGG + Intergenic
1157588629 18:48820991-48821013 CAGCTCTCTGGGAGTCCCTGGGG + Intronic
1158580976 18:58682541-58682563 GAACCCTCTGGGTTTTGCTGGGG - Intronic
1160657188 19:279583-279605 GGACCCTCTGGGGATGGCTGTGG + Intergenic
1161009088 19:1951502-1951524 GTGTCCTCTGGGGCTCCCTGAGG + Intronic
1162914959 19:13869642-13869664 GAGCCCTGTGGGGGTCTCCGTGG - Intronic
1162937361 19:13987821-13987843 GAACTCTCTGGGGCTCACTTTGG - Intronic
1163153214 19:15427017-15427039 CACCCATCTGAGGGTCCCTGGGG - Exonic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1163664703 19:18597907-18597929 GATCCTTCTGGGGGCCCCTGAGG + Intronic
1164594490 19:29524864-29524886 GAATCCTCTGGCGGTGCCTCCGG + Intergenic
1164729493 19:30491780-30491802 GACTCCTCTGTGGGTCCCTTGGG + Intronic
1165105769 19:33468979-33469001 GAACCCACTTGTGGTCCCTCAGG + Intronic
1166097452 19:40549814-40549836 GAACCCTCTGGGGCACAATGGGG - Intronic
1166294140 19:41880790-41880812 GTTCCCTCTGGGGGTGGCTGGGG + Intronic
1166326891 19:42056550-42056572 GAACCCTCTCGCCCTCCCTGAGG - Intronic
1168249883 19:55135865-55135887 AAGCCCTCTGGGGGGCGCTGTGG - Intronic
1168647387 19:58068587-58068609 GAACTCTCTGAGGGTGTCTGAGG - Exonic
925757358 2:7146735-7146757 GCACCCTTGGTGGGTCCCTGTGG - Intergenic
926597134 2:14803347-14803369 GAAGCCTCTGCTGGTCTCTGGGG + Intergenic
929310822 2:40422068-40422090 GAGCCCGCTGAGGGTCCCAGTGG - Intronic
929866565 2:45722462-45722484 GGAACCTCTGGAGGTTCCTGCGG - Intronic
932429114 2:71663392-71663414 CAACCCTCTGGGGGTCTCACAGG + Intronic
933354460 2:81195771-81195793 GATCCCTCCAGGGGCCCCTGTGG - Intergenic
934766010 2:96880394-96880416 GAACAGGCTGGGGGTGCCTGGGG + Intronic
935352614 2:102166566-102166588 GAAAGCTCTGGGGCTCCCTCTGG + Intronic
936706351 2:115079476-115079498 GAACACTCTGGGAGGCCCAGAGG + Intronic
937000430 2:118460920-118460942 GGAGCCTCTGGGGGTGCCTGTGG - Intergenic
937756275 2:125542580-125542602 GAAAACTCTGGGGGGTCCTGTGG + Intergenic
943524324 2:188997366-188997388 GTAGGCCCTGGGGGTCCCTGAGG - Exonic
945814830 2:214591551-214591573 GAGCCCTCTGGAGGTCACTTGGG + Intergenic
947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG + Intronic
1168906390 20:1407388-1407410 GCTCCCTCTGGGGGTCCTAGGGG - Intergenic
1169687652 20:8293706-8293728 AGACCCTTTGAGGGTCCCTGAGG - Intronic
1169946531 20:10995118-10995140 TAACCCTCTGGGGGACCAAGAGG - Intergenic
1170162220 20:13325118-13325140 GCACCCTCTGGTGGTCACTTAGG - Intergenic
1170572242 20:17638959-17638981 AAACCCTCTGAGGGTCCCAGAGG + Intronic
1172226913 20:33311254-33311276 ACACCCTCTGGGGCTTCCTGGGG + Intergenic
1172891664 20:38270356-38270378 GAACCCACTGGAGGTCCAGGAGG + Intronic
1173807829 20:45937518-45937540 GGACCCTGTGGGGGTCCATCCGG + Exonic
1174393278 20:50231353-50231375 GAACCATCTGGGGCTTTCTGGGG - Intergenic
1175540441 20:59744490-59744512 GTTGCCTCGGGGGGTCCCTGGGG + Intronic
1175914007 20:62417303-62417325 CGATCCTCTGGGCGTCCCTGTGG + Exonic
1176091666 20:63321085-63321107 GGACTCACTGGGGGTCCTTGAGG - Exonic
1176110370 20:63408122-63408144 GATCCCTCAGGGGTTCCTTGTGG - Intronic
1176146987 20:63569851-63569873 GAACCCTCCTGGGGCCCCTGTGG + Intronic
1176682135 21:9824971-9824993 GGAGCCTCAGGGGGTGCCTGGGG - Intergenic
1176682414 21:9826380-9826402 GGAGCCTCAGGGGGTGCCTGGGG - Intergenic
1176682692 21:9827799-9827821 GGAGCCTCAGGGGGTGCCTGGGG - Intergenic
1176682972 21:9829196-9829218 GGAGCCTCAGGGGGTGCCTGGGG - Intergenic
1176683252 21:9830606-9830628 GGAGCCTCAGGGGGTGCCTGGGG - Intergenic
1176683531 21:9832015-9832037 GGAGCCTCAGGGGGTGCCTGGGG - Intergenic
1176683811 21:9833418-9833440 GGAGCCTCAGGGGGTGCCTGGGG - Intergenic
1176684088 21:9834827-9834849 GGAGCCTCAGGGGGTGCCTGGGG - Intergenic
1176684368 21:9836228-9836250 GGAGCCTCAGGGGGTGCCTGGGG - Intergenic
1178384067 21:32135161-32135183 TAATCCTCTGGGGGTGACTGTGG - Intergenic
1178552526 21:33552748-33552770 GGACCCTCTGGTGGTTCCTCAGG - Exonic
1178859758 21:36278971-36278993 GAGCCCACTGGGTGACCCTGGGG + Intronic
1178935661 21:36859475-36859497 GGACCCTGTGGGGGTCCCAGTGG - Intronic
1179784014 21:43719572-43719594 GAGCGCTCTGCGGGCCCCTGCGG + Intronic
1180676799 22:17592008-17592030 TAACCCTCTGGGGGTCCCCTGGG - Intergenic
1180876136 22:19176082-19176104 GGACACTCTGGCGGTGCCTGGGG + Exonic
1181496961 22:23292710-23292732 AAACCTTCAGGGGCTCCCTGAGG + Intronic
1181597588 22:23926714-23926736 CACCCCTCTGGGGCTACCTGAGG + Intergenic
1183828147 22:40404465-40404487 CAACACCCTGTGGGTCCCTGTGG - Intronic
1184088449 22:42279946-42279968 GTGCCCTCTGGGGGCCTCTGGGG + Intronic
949616114 3:5755642-5755664 AAACCCTCTGGGACTCCCTTTGG + Intergenic
949829433 3:8198107-8198129 TAATCCCCTGGGGGTCCCTGAGG - Intergenic
950156875 3:10728006-10728028 GAAGACCCTGGGGGTCCCAGAGG + Intergenic
950300406 3:11872434-11872456 GAACCCTGTGGGGCACCCTTTGG + Intergenic
950460580 3:13119982-13120004 GAGCTCTCTCTGGGTCCCTGTGG - Intergenic
953069973 3:39509844-39509866 GACCCTGCTGGGGGTCCCTGGGG - Intronic
953180038 3:40586297-40586319 GAACTCCCTGGGAGACCCTGGGG + Intergenic
953907524 3:46875803-46875825 AAACCCTTTGGGGCTCCCTGAGG - Intronic
954160320 3:48716997-48717019 GAAATCTCCCGGGGTCCCTGTGG - Intronic
954582518 3:51710729-51710751 GCACCCTCTGCTGGTCCCTGTGG - Intronic
954975435 3:54689568-54689590 GAACACACTGGGGGTGGCTGAGG - Intronic
955072557 3:55584147-55584169 CTTCCCTGTGGGGGTCCCTGAGG - Intronic
956222989 3:66923736-66923758 GCAGGCTCTTGGGGTCCCTGAGG + Intergenic
957078215 3:75618146-75618168 GAAGCCTCTAGTGGGCCCTGGGG - Intergenic
960942276 3:122942921-122942943 GTACTCTCTGGGGGAACCTGTGG - Intronic
962264411 3:133935100-133935122 GGACCGTCTGGGGGTGGCTGGGG - Intronic
962418146 3:135202408-135202430 GTACCCTATGGGGGCCGCTGAGG - Intronic
967085379 3:186090659-186090681 GCACTCTCTGGAGGACCCTGGGG - Intronic
968045718 3:195623082-195623104 GGACACTATGGGGGTCACTGCGG - Intergenic
968064431 3:195750847-195750869 GGACACTATGGGGGTCACTGCGG - Intronic
968308938 3:197667005-197667027 GGACACTATGGGGGTCACTGCGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968666747 4:1826592-1826614 GTCACCTCTGGGGTTCCCTGAGG + Intronic
969021288 4:4142119-4142141 GAAGCCTCTAGTGGTCCCTGGGG - Intergenic
969302101 4:6303137-6303159 GAACCCTGTGGGGGCGGCTGTGG + Exonic
969732577 4:8965297-8965319 GAAGCCTCTAGTGGTCCCTGGGG + Intergenic
969792157 4:9499380-9499402 GAAGCCTCTAGTGGGCCCTGGGG + Intergenic
972284766 4:37637570-37637592 GAAGGCTCTGGGGGACCCCGGGG - Intronic
972726235 4:41748382-41748404 GACTGCTCTGGTGGTCCCTGAGG + Exonic
978476457 4:109136735-109136757 GCACCAGCTGGGGGTCACTGAGG - Intronic
982314545 4:154018856-154018878 GCACCCTCTGGTGGTCTGTGGGG + Intergenic
984934913 4:184881709-184881731 GAAGCCGTTGGGGGTACCTGGGG + Intergenic
985512545 5:320882-320904 GTACCCTCAGGGGATCCCTGGGG - Intronic
986380541 5:7181042-7181064 TAGCCCTCTGGAGGACCCTGAGG - Intergenic
987760488 5:22156004-22156026 GTACCCCTTGGGGTTCCCTGAGG + Intronic
989565176 5:42894477-42894499 GGACCCTCTTGCCGTCCCTGCGG + Intergenic
990712778 5:58604157-58604179 GAACCATCTGTGGGTCTCTCAGG + Intronic
991895264 5:71389447-71389469 GTACCCCTTGGGGTTCCCTGAGG + Intergenic
993272286 5:85811456-85811478 GGACCAGCTGGGGTTCCCTGTGG + Intergenic
996619157 5:125479055-125479077 GATCCCTCTTGGGATCCCAGGGG - Intergenic
999400934 5:151263747-151263769 GAGCACTCTTGGGGTCCATGGGG + Intronic
1000282462 5:159793911-159793933 GAAGCCTGTGGGGGCACCTGCGG - Intergenic
1001510181 5:172315047-172315069 GAAACTTCTAGGGGTCCATGAGG + Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002415268 5:179117195-179117217 GAACCCCCTGTGTTTCCCTGAGG - Intronic
1002426958 5:179182156-179182178 GAGCCCTCTGTGTGCCCCTGTGG + Intronic
1002575251 5:180170633-180170655 GAACCTTCCGGAGGTCCCTGTGG + Intronic
1003679304 6:8236284-8236306 GAGCCCACTGAGGGTCCCAGGGG - Intergenic
1007764210 6:44151496-44151518 GAATCTTCTGGGTGTTCCTGGGG + Intronic
1010792288 6:80078411-80078433 AAACTCTCTGGGGCTCCCTCTGG - Intergenic
1013807297 6:114010348-114010370 GGACACTCTGGGGGATCCTGTGG - Intronic
1014142889 6:117964636-117964658 GAGCACTCTGGAGGACCCTGAGG + Intronic
1014717787 6:124886372-124886394 GAACCTTCTGGACCTCCCTGAGG - Intergenic
1017812605 6:157994873-157994895 GAACCCCCTGGGACTCCCTGGGG - Intronic
1018704093 6:166450403-166450425 GGTCCCTGTGGTGGTCCCTGTGG - Intronic
1018704189 6:166450673-166450695 GGTCCCTGTGGTGGTCCCTGTGG - Intronic
1018924221 6:168195158-168195180 CAACCCTCAGGAGGTCACTGAGG - Intergenic
1019412973 7:914574-914596 GGAGGCTCGGGGGGTCCCTGAGG + Intronic
1019767626 7:2863353-2863375 ATACCTTCTGGGGGTCTCTGAGG - Intergenic
1019920376 7:4159344-4159366 AAACCCTCTGCTGGTCCCTGAGG - Intronic
1020308707 7:6854148-6854170 GAAGCCTCTAGTGGTCCCTGGGG - Intergenic
1021585136 7:22199620-22199642 GAGCCCTTTGTGGCTCCCTGGGG - Intronic
1021795098 7:24246571-24246593 ACACCCTCTGGGTGTCTCTGAGG - Intergenic
1022902365 7:34823835-34823857 GAGCCCTCTGGGGGTCACTGTGG - Intronic
1024054022 7:45648186-45648208 CACCCATCTGGGTGTCCCTGGGG - Intronic
1026141964 7:67714128-67714150 GGACCCTGTGAGGTTCCCTGGGG + Intergenic
1026153483 7:67807892-67807914 GACCCCTTTGGGGATCCATGAGG + Intergenic
1031012263 7:116536675-116536697 AAGCCCTCTGTGGGTCGCTGTGG - Intronic
1032579956 7:133095286-133095308 GATTGCTCTGTGGGTCCCTGAGG - Intergenic
1034461603 7:151200663-151200685 GAAATCCCTGGGGGGCCCTGGGG - Intronic
1034902399 7:154915599-154915621 GAACCCCCTTGGGTTCTCTGGGG - Intergenic
1034969489 7:155410249-155410271 GCACCCTTTGGGACTCCCTGAGG + Intergenic
1034978506 7:155461320-155461342 CAACCCCCTGGCGTTCCCTGTGG - Intronic
1035630378 8:1103077-1103099 TAACTTTCTGGGGGTCTCTGAGG + Intergenic
1035723709 8:1812234-1812256 GAACCCTCTGAGGGTCCAGCTGG - Intergenic
1037672743 8:21029209-21029231 GAACCTTATGGTGGTCCCTGTGG + Intergenic
1037843570 8:22262952-22262974 GGACCCTCCTGGGGCCCCTGGGG + Intergenic
1038700974 8:29849012-29849034 GAACCCTGGGGGGAGCCCTGGGG - Intergenic
1039606361 8:38884059-38884081 GCTCCCTCGGGGGGTGCCTGGGG + Intergenic
1039796872 8:40923278-40923300 ATACCCTCTGGGTGACCCTGAGG + Intergenic
1044825806 8:96195700-96195722 GAACCATCTTTGGCTCCCTGAGG + Intergenic
1046762160 8:118032346-118032368 GAATCCCCTGGGGGACTCTGTGG - Intronic
1048294686 8:133205691-133205713 GAAACCTCAGAGGGTCCCAGGGG + Intronic
1048460905 8:134620868-134620890 GAAACCCCTGGGGCTCCCTTCGG - Intronic
1048995186 8:139789725-139789747 GAAGCCTGTGTGGGTCCCAGGGG + Intronic
1049306984 8:141909236-141909258 TCACCCCCTGGGGGGCCCTGTGG - Intergenic
1049324425 8:142014651-142014673 GAAGCATCTGGACGTCCCTGCGG - Intergenic
1049343208 8:142124812-142124834 GAAACCCCTGGGGTCCCCTGAGG + Intergenic
1049422378 8:142522743-142522765 GAAGTCTCTGGGGGGCCATGTGG - Intronic
1049636965 8:143694320-143694342 GGACCCTCTGGTGGTGGCTGAGG - Exonic
1049700449 8:144008963-144008985 TAACATTCTGGGGGACCCTGGGG + Intronic
1049820415 8:144629945-144629967 GGACACTGTGGGGGGCCCTGGGG + Intergenic
1051867158 9:21695763-21695785 CAACCCTCTCCGGATCCCTGGGG + Intergenic
1053475975 9:38382258-38382280 CCACCCTCTGGTGGCCCCTGAGG - Intergenic
1056510009 9:87295627-87295649 CAATCATCTGGAGGTCCCTGGGG - Intergenic
1060734141 9:126055603-126055625 GGCCCCTCTGGAGGTGCCTGCGG + Intergenic
1061238161 9:129353925-129353947 GAACACACTTGGGGGCCCTGGGG - Intergenic
1061436209 9:130563791-130563813 GAAACTTCTGTTGGTCCCTGTGG + Intergenic
1062528252 9:136987242-136987264 GCAGCCTCTGGGGGTGGCTGTGG + Intergenic
1062565574 9:137162585-137162607 GAAGCTTCTGGGGGCGCCTGTGG - Exonic
1185479437 X:435107-435129 GATCCGTGTGGGGGTTCCTGGGG + Intergenic
1186852427 X:13593507-13593529 TAACCCCCTAGAGGTCCCTGTGG - Intronic
1191899173 X:66023185-66023207 GGACTCTCTGGGGATCCTTGGGG - Intronic
1192112947 X:68383722-68383744 GAGCTCTCTGGGGATCCCTAGGG - Intronic
1194958007 X:100203575-100203597 GAACCCTCAGAGGGCACCTGAGG + Intergenic
1195136518 X:101912199-101912221 GAACTCTCTGAGGGTGTCTGAGG - Intronic
1195278947 X:103310832-103310854 GGACCCGGAGGGGGTCCCTGGGG - Exonic
1198214956 X:134546727-134546749 GATCGATCTGGGGGTACCTGCGG + Intergenic
1198963141 X:142203704-142203726 GGACCCTGTGGAGGACCCTGTGG + Exonic
1200054189 X:153450188-153450210 GCAGCCTCTGAGGGTCCATGGGG - Intronic
1201276134 Y:12300436-12300458 GAACCAATTGGGGTTCCCTGTGG + Intergenic
1202368980 Y:24184791-24184813 GACCCCTCTGGAGGTACTTGAGG + Intergenic
1202501805 Y:25485326-25485348 GACCCCTCTGGAGGTACTTGAGG - Intergenic