ID: 1163372407

View in Genome Browser
Species Human (GRCh38)
Location 19:16908815-16908837
Sequence ACTTGTGAGGGCCAGTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163372407_1163372424 22 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372424 19:16908860-16908882 GGTTGGACATCCCCATCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 111
1163372407_1163372425 23 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372425 19:16908861-16908883 GTTGGACATCCCCATCCCAGGGG 0: 1
1: 0
2: 0
3: 9
4: 119
1163372407_1163372423 21 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372423 19:16908859-16908881 AGGTTGGACATCCCCATCCCAGG 0: 1
1: 0
2: 1
3: 8
4: 123
1163372407_1163372415 -6 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372415 19:16908832-16908854 ACAAGTCCATTGCCTGGGGGTGG 0: 1
1: 0
2: 1
3: 16
4: 169
1163372407_1163372420 1 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372420 19:16908839-16908861 CATTGCCTGGGGGTGGGGGAAGG 0: 1
1: 5
2: 43
3: 292
4: 1574
1163372407_1163372421 5 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372421 19:16908843-16908865 GCCTGGGGGTGGGGGAAGGTTGG 0: 1
1: 3
2: 27
3: 316
4: 2078
1163372407_1163372413 -10 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372413 19:16908828-16908850 CCTCACAAGTCCATTGCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 129
1163372407_1163372418 -3 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372418 19:16908835-16908857 AGTCCATTGCCTGGGGGTGGGGG 0: 1
1: 2
2: 29
3: 209
4: 901
1163372407_1163372417 -4 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372417 19:16908834-16908856 AAGTCCATTGCCTGGGGGTGGGG 0: 1
1: 0
2: 7
3: 66
4: 466
1163372407_1163372414 -9 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372414 19:16908829-16908851 CTCACAAGTCCATTGCCTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 126
1163372407_1163372416 -5 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372416 19:16908833-16908855 CAAGTCCATTGCCTGGGGGTGGG 0: 1
1: 3
2: 33
3: 155
4: 579
1163372407_1163372426 27 Left 1163372407 19:16908815-16908837 CCCTAGGACTGGCCCTCACAAGT 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1163372426 19:16908865-16908887 GACATCCCCATCCCAGGGGCAGG 0: 1
1: 0
2: 3
3: 43
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163372407 Original CRISPR ACTTGTGAGGGCCAGTCCTA GGG (reversed) Intronic
900654462 1:3748216-3748238 ACTTGTAGGGTCCAGCCCTATGG + Intergenic
902302472 1:15511878-15511900 GCTGGGGAGGGCCAGTCCTAGGG - Intronic
904850597 1:33456305-33456327 ACTTGTGAGTGACAGCCCTCAGG - Intergenic
905115289 1:35633801-35633823 ACTTTTGAGGGCCTCTTCTATGG - Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
908012302 1:59791072-59791094 CCTTGGGTGGGCCAGTCCTCTGG - Intergenic
918355400 1:183703091-183703113 ACTTCTGAGGCCTAGTCCCAAGG - Intronic
924501718 1:244644518-244644540 ACTTGTGAGGGACAATCTCATGG - Intergenic
924545244 1:245020346-245020368 ACCTCTGAGGGGCAGTCCTGAGG + Intronic
1066100706 10:32115920-32115942 AGTTGTGAGGGCCAGTGCAGTGG - Intergenic
1073854493 10:107659065-107659087 ACATGTGATGGTCAGTCCAAGGG - Intergenic
1075050083 10:119177123-119177145 ACATGTGAGTGCCATTCCTTGGG - Exonic
1081435544 11:43023674-43023696 ACTTGCCAGGGCCTGTCATAAGG + Intergenic
1083923079 11:65790860-65790882 ACAGGTGAGGGCGAGTCCTTTGG + Intronic
1084784999 11:71437140-71437162 ACCTGTGACAGCCAGTCCTGTGG - Intronic
1085177592 11:74504378-74504400 ACTTGTGAGAGCTACTACTATGG - Intronic
1085271762 11:75273940-75273962 CCTTGTCAGGGCCTGTCCTCAGG - Intronic
1086890544 11:92253190-92253212 ACTTGTGAGGGTCCTGCCTAGGG - Intergenic
1088425180 11:109694077-109694099 ATCTGTGTGGGCCAGTCCTTGGG - Intergenic
1089057598 11:115599143-115599165 ACTTGTGAGGCCCTGTGATAAGG + Intergenic
1097634049 12:62100774-62100796 ACTTTTGAGTGCCAGTTATATGG + Intronic
1099315757 12:81080149-81080171 AACAGTGAGGGCCAGACCTAAGG + Intronic
1103445555 12:120992934-120992956 ACTTGTGTGTCCCAGTCCTTTGG + Intronic
1110901865 13:80834412-80834434 AGTTTTGTGGGCCAGGCCTAAGG - Intergenic
1114082558 14:19213943-19213965 TTTGGTGAGGACCAGTCCTAAGG + Intergenic
1118947182 14:70398968-70398990 ACTTGTGATGGCCAGGACTGGGG - Intronic
1119884672 14:78130221-78130243 GCTTGCCAGGGCCTGTCCTAGGG + Intergenic
1120101520 14:80450570-80450592 GTTTTTGAGGGCCAGGCCTAGGG + Intergenic
1122743049 14:103882796-103882818 ACCTGTGAGGACCAGCCCTGGGG + Intergenic
1129979119 15:79850281-79850303 ACATGTAAGAGCCAGTTCTAAGG - Intronic
1130241875 15:82201260-82201282 ATTTGGGAGGCCCAGTCCTTAGG + Intronic
1130454153 15:84088230-84088252 ATTTGTGAGGTGAAGTCCTACGG + Intergenic
1130458504 15:84139593-84139615 ATTTGGGAGGCCCAGTCCTTAGG - Intergenic
1144131526 17:12251290-12251312 CCTTGGGAGGGGCAGTCCCAAGG + Intergenic
1144614633 17:16757662-16757684 ACTTGAGTGGGCCAGTCCTCCGG + Intronic
1144898074 17:18558012-18558034 ACTTGAGTGGGCCAGTCCTCCGG - Intergenic
1145134297 17:20387702-20387724 ACTCGAGTGGGCCAGTCCTCCGG + Intergenic
1158666748 18:59439515-59439537 GCTTGTGAGGACCACTCATAAGG + Intronic
1163372407 19:16908815-16908837 ACTTGTGAGGGCCAGTCCTAGGG - Intronic
1166068957 19:40376804-40376826 CCCTGTGTGGGGCAGTCCTAGGG + Intronic
1166514708 19:43437740-43437762 CCTTGTAGGGGCCAGCCCTACGG - Intergenic
925728048 2:6893522-6893544 TCTTGTGAGGGCCATGCCAAAGG + Intronic
928430598 2:31215376-31215398 ACGTGAAATGGCCAGTCCTATGG - Intronic
936469478 2:112786057-112786079 TCTTGTGAGGGCTATTGCTAAGG + Intergenic
937254234 2:120543504-120543526 ATTTGTGAGGCCCAGTGCAACGG + Intergenic
938339499 2:130526272-130526294 ACCTGTGAGAGCCATTCCAATGG - Intronic
938350340 2:130594480-130594502 ACCTGTGAGAGCCATTCCAATGG + Intronic
947689913 2:232125707-232125729 ACTTGGGAGGGACAGTCTTCAGG - Intronic
948529150 2:238592755-238592777 ACTTGAGAGGGCCAGTCAGCTGG - Intergenic
1168902214 20:1374639-1374661 ACTTCTGAGAGTAAGTCCTATGG + Intronic
1169412450 20:5383137-5383159 GGTTGTGTGGGCCAGTCCTCAGG - Intergenic
1180498219 22:15908727-15908749 TTTGGTGAGGACCAGTCCTAAGG - Intergenic
1180730033 22:17974228-17974250 ACTGTTGAGGGCCAGGCCCAGGG - Intronic
1182073733 22:27480660-27480682 ACTGGAGAGGCCCAGTCCTGAGG + Intergenic
1183580537 22:38723438-38723460 ACATGTGAGTGCCATTCCTTGGG - Intronic
953402766 3:42640731-42640753 ACTTCTGATGGCCAGTACCATGG + Intronic
959252033 3:103961292-103961314 ACTTGTGATGGCCATACCCAAGG - Intergenic
961821578 3:129578096-129578118 AGTGGTGAGGGCCAGGCCAAGGG - Intronic
964487991 3:157205775-157205797 ACATGTGAGAGCCAGTCAGAGGG - Intergenic
965307144 3:167080518-167080540 CCTTGTGAGGGCCTGTTCTCTGG + Intergenic
966097852 3:176228042-176228064 GCTTTTGAGGGCCAGGCCCAGGG + Intergenic
966962699 3:184955674-184955696 ACGTGTAGGGTCCAGTCCTACGG - Intronic
966989150 3:185210977-185210999 ACTTGTCTAGACCAGTCCTAGGG + Intronic
969899747 4:10337884-10337906 ACTTGGAAGGGCCAGTCCTATGG - Intergenic
972249172 4:37281099-37281121 GCTTCTGAGGGACAGTCCAAGGG + Intronic
976590583 4:86845669-86845691 AATTGTGAGGGCCTGACCTGAGG + Intronic
978852694 4:113357277-113357299 TCTTGAGAGGGGCAGTCCTTTGG - Exonic
982181539 4:152752313-152752335 CCTTGTGAAGCCCAGACCTAGGG + Intronic
983934454 4:173491392-173491414 ACTGCTGAGTGCCAGTCATATGG + Intergenic
991472183 5:66980904-66980926 ACTTGTTACTGCCAGTCCTCAGG - Intronic
992758430 5:79930755-79930777 CCTTGTGAGGGGCAGGCCAAGGG - Intergenic
993106748 5:83608759-83608781 ACATGTGAGGGACTGTGCTAAGG + Intergenic
994288426 5:97997626-97997648 GCTTGTGAGATCCTGTCCTATGG - Intergenic
998723238 5:144977390-144977412 ACCTGTGAGGGGCAGGCCTGAGG + Intergenic
1000833130 5:166127951-166127973 CCTTGGGTGGGCCAGTCCTTGGG - Intergenic
1004252516 6:14033828-14033850 ACTGATGAGCTCCAGTCCTAAGG + Intergenic
1007936957 6:45740978-45741000 ACTTGTTAGGGCTAGACATAGGG + Intergenic
1014482484 6:121955035-121955057 GGTTTTGTGGGCCAGTCCTAGGG - Intergenic
1016407305 6:143744185-143744207 TCTTGGCTGGGCCAGTCCTAGGG - Intronic
1016876529 6:148870929-148870951 ACTTCTGAGGGACAGTGCTATGG + Intronic
1017231327 6:152077109-152077131 AGTTTTGTGGGCCAGTCCCAGGG + Intronic
1020490580 7:8778907-8778929 ACATCTGAGGGTAAGTCCTAAGG + Intergenic
1027233433 7:76284642-76284664 AGGTGTGAGGGCCTGGCCTACGG - Intronic
1029392981 7:100287849-100287871 AACAGTGAGGGCCAGTCCAAGGG + Intergenic
1030014448 7:105204644-105204666 ACATGTGAGTGCCATTCCTTGGG + Intronic
1036746226 8:11412088-11412110 ACCTGTGAGGGGCAGCCCCAGGG - Intronic
1036912447 8:12768427-12768449 ACTTGTGTGCCCCAGTCCTTTGG - Intergenic
1038179870 8:25217444-25217466 ACTGGTCAGGGCAAGTCCCAGGG - Intronic
1039474858 8:37834265-37834287 AGTTGTCAGGGGCAGTGCTAAGG + Intronic
1040873090 8:52120898-52120920 ACTTGTGAGGGCTAGAGGTAGGG + Intronic
1046261419 8:111773029-111773051 ACTTGGGAATGCCAGTTCTAGGG - Intergenic
1047498826 8:125427326-125427348 GCTGGTGAGGGCCAGCCCCAGGG + Intergenic
1055307020 9:74940704-74940726 ACATGTGTGGGACAGTCCCAAGG - Intergenic
1056937292 9:90925773-90925795 ACTGCTGAGGGCCAGTCACATGG + Intergenic
1057293286 9:93820538-93820560 ACCTCTGAGGGCCAGTCCTGGGG - Intergenic
1190282973 X:48943233-48943255 AGTTGTGAGGTCCTGTGCTAGGG - Intronic
1192947627 X:75983207-75983229 ACTTATGAGGGACAGTCCCACGG - Intergenic
1196567888 X:117230078-117230100 AGTTTTGTGGGCCAGGCCTAGGG - Intergenic