ID: 1163374935

View in Genome Browser
Species Human (GRCh38)
Location 19:16924249-16924271
Sequence AAGTGGGTTTGGGGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 534}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163374923_1163374935 25 Left 1163374923 19:16924201-16924223 CCACCCGGTTTGTGGCATTTTGT 0: 1
1: 22
2: 234
3: 1299
4: 3379
Right 1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG 0: 1
1: 0
2: 3
3: 56
4: 534
1163374925_1163374935 21 Left 1163374925 19:16924205-16924227 CCGGTTTGTGGCATTTTGTTGTG 0: 3
1: 18
2: 177
3: 971
4: 2800
Right 1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG 0: 1
1: 0
2: 3
3: 56
4: 534
1163374924_1163374935 22 Left 1163374924 19:16924204-16924226 CCCGGTTTGTGGCATTTTGTTGT 0: 2
1: 4
2: 59
3: 517
4: 2468
Right 1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG 0: 1
1: 0
2: 3
3: 56
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163374935 Original CRISPR AAGTGGGTTTGGGGGGAAGA TGG Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901403981 1:9033825-9033847 AAGGGGGTTGGGGAGGAGGAAGG - Intergenic
901421314 1:9153095-9153117 ATGTGGGTGTGGGGGCATGAAGG + Intergenic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
902240967 1:15089137-15089159 AAGAGGGTTTGGGGAGAGAAAGG - Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
903071188 1:20727669-20727691 ATGTGTGTTTGGGGGGAATTTGG - Intronic
903573956 1:24326333-24326355 AAGAGGGGTGGAGGGGAAGAGGG - Intronic
903573985 1:24326413-24326435 AAGAGGGGTGGAGGGGAAGAGGG - Intronic
903929450 1:26854008-26854030 ACCTGGGTTTGGGGAGCAGAGGG - Exonic
904498852 1:30902588-30902610 ACAGGGGTTTGGGGGGATGATGG + Intronic
904926492 1:34053025-34053047 AAGTGGCTTTGGAAGGAAGAGGG + Intronic
904956768 1:34291096-34291118 AAGTGGGATTGGGGGAACAATGG + Intergenic
905972591 1:42153261-42153283 AAGGGGGTTGGGGGCGAGGAGGG - Intergenic
906189529 1:43887425-43887447 AAGTGGGTTTGGAGTGTAGAAGG + Intronic
906277108 1:44524454-44524476 AACCGGGTTTGGGTGGAAGGAGG - Intronic
906324272 1:44834554-44834576 AAGTGGGTTTGCTGAGAGGAAGG + Intronic
906578320 1:46911350-46911372 AAGAGGGTTAGGGGGAAGGATGG - Intergenic
906616263 1:47234932-47234954 AATTGGGTTTGGGGGGATGAGGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
908179245 1:61587880-61587902 AAGAGAGTTTGGGAGGAATATGG - Intergenic
908819162 1:68065791-68065813 AAGTTGGTTTGCAGGGAACAAGG - Intergenic
910920747 1:92343810-92343832 TATTGGGTTTGGGAGGTAGAGGG + Intronic
911210976 1:95137646-95137668 AAGAGGGGATGAGGGGAAGAAGG - Intronic
912409168 1:109467562-109467584 TGGTGGGTTTGGGGGCAGGACGG - Intronic
914866052 1:151430026-151430048 AAGTGGGGGTGGGGGGCAGGGGG + Intronic
915270034 1:154747282-154747304 AGGGGGATTTGAGGGGAAGACGG - Intronic
916058696 1:161084827-161084849 GTGTGGGTTTGGGGGGGTGAGGG + Intronic
916098114 1:161369280-161369302 ATGAGGATTTTGGGGGAAGAAGG - Exonic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917721151 1:177787731-177787753 AATTGGATTTGGTGGGAAAAAGG + Intergenic
918098636 1:181354747-181354769 GAGAGGGTTTGGGGGGATAATGG + Intergenic
918264758 1:182831453-182831475 AAGTAGGGTTGGGGGGCAGTGGG + Intergenic
920130299 1:203726979-203727001 AAAAGAGTTTGGGGAGAAGATGG - Intronic
920550188 1:206854097-206854119 TAGGGGGTTTGGGGGGAAGGGGG + Intergenic
921598112 1:217076968-217076990 AAATAGGTAAGGGGGGAAGAAGG + Intronic
922308655 1:224367297-224367319 AAGTAGGGTTTGGAGGAAGATGG + Intronic
923023707 1:230187757-230187779 AAGGGGGTTAAGTGGGAAGATGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923649858 1:235864342-235864364 GAGTAGGTTTGGTGGGGAGAAGG - Intronic
924137122 1:240980363-240980385 AAGAGGGTTTTGTGGCAAGATGG - Intronic
924442214 1:244095917-244095939 AAGTAAGTTTGGGGGCCAGAGGG - Intergenic
1063042365 10:2356447-2356469 ACGTGGGGTTGGGGAGAGGAGGG - Intergenic
1063282198 10:4642435-4642457 TAGTGGGGTTGGGGGGTAGATGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064082921 10:12323064-12323086 AAGTGGATTTGGGAGCTAGAGGG - Intergenic
1064599062 10:16974776-16974798 GAGTGGGTTGGGGAGGAAGAGGG - Intronic
1065162481 10:22937466-22937488 ATGTGGGTTGGTGGAGAAGATGG + Intronic
1065319459 10:24495627-24495649 AAGAGGACTTAGGGGGAAGAAGG + Intronic
1065585321 10:27211954-27211976 AAGTGGGGGTGGGGGTAGGAAGG + Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1066442043 10:35448683-35448705 TGGTGGGTTTGAGGGGCAGAGGG + Intronic
1066633554 10:37479828-37479850 AAGTGGATTTGGGGGCTCGAGGG - Intergenic
1067083637 10:43227085-43227107 CAGTGGGTTAAGGGGGAAAAGGG + Intronic
1067410598 10:46060863-46060885 AAGAGGGTGTGGGGGACAGAGGG - Intergenic
1067749641 10:48962280-48962302 AAGTGGCTTTGGAGCCAAGAAGG - Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1069689859 10:70343334-70343356 ATGTGGTTTTGGGGGGGAAAAGG + Intronic
1069994991 10:72336503-72336525 GAGTGAGTGTGGGGGGAAGGCGG - Exonic
1070195606 10:74153551-74153573 ACGTGGGATTAGGGGAAAGAAGG + Intronic
1070352180 10:75603211-75603233 AAGTGGATTTCGGGTGAAGAAGG + Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1070765441 10:79053582-79053604 AACTGGGTCTGGGAGGGAGAGGG + Intergenic
1071176837 10:82936443-82936465 CATAGGGTTTAGGGGGAAGATGG + Intronic
1071889516 10:89987815-89987837 GAGTAAGTTTGGGGGGAAGAGGG - Intergenic
1072117987 10:92382031-92382053 AAGTGGGTGTTGGGGGGAGGAGG + Intergenic
1072921794 10:99583027-99583049 AGTTGGGTTTGGTGGGAGGAGGG + Intergenic
1073840576 10:107494721-107494743 TAGAGGGTTTGGGGGAAAGCTGG - Intergenic
1073900019 10:108209389-108209411 TAGGGGGATTGGGGGGAAGTTGG - Intergenic
1074243079 10:111658398-111658420 AAATGGGTTTGGTGGTGAGAAGG - Intergenic
1075206600 10:120454657-120454679 AAGTGGTTTTGGAGGGCAAAAGG - Intergenic
1075584715 10:123649223-123649245 AAGTGAGTGTTGGGGAAAGAAGG + Intergenic
1075619226 10:123913674-123913696 AAGTGGGTGTGAGGAGAGGAAGG + Intronic
1076222553 10:128746082-128746104 AACTGGGGTTGGGGAGAGGATGG + Intergenic
1076289398 10:129332694-129332716 AATTGGGGGTGGGGGGAAGAGGG + Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077436492 11:2541887-2541909 AAGGGGGTTTGGGGGCCAGTCGG + Intronic
1077587064 11:3461989-3462011 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1077852039 11:6082446-6082468 ATGTGGGGTTGGGGGGAAGGTGG + Intergenic
1077861223 11:6181798-6181820 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1077879616 11:6338622-6338644 AAGTGGGTTGGGGGTGGGGAAGG - Intergenic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1078676808 11:13426796-13426818 AAAAGGGGTTGGGAGGAAGAAGG + Intronic
1078989386 11:16631195-16631217 AAGTGTGTTTTGGTGGTAGATGG + Intronic
1079229816 11:18639976-18639998 AAATTGGATTGGGGGGATGAAGG + Intergenic
1079565763 11:21880040-21880062 TTGTGGGGTTGGGGGGAAGCGGG + Intergenic
1080305999 11:30837043-30837065 ATGTGTGTTTGAGGGGAGGATGG + Intronic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080506452 11:32918782-32918804 AGGGGTTTTTGGGGGGAAGAGGG - Intronic
1080663923 11:34319221-34319243 CGGTGGGGTTGTGGGGAAGAAGG - Intronic
1080944619 11:36957620-36957642 AAGTGTGTTGGGAGGGAAGTGGG + Intergenic
1082082004 11:48019362-48019384 AGGTGGGGTTCGGGGGAAGGTGG - Intronic
1082833791 11:57638245-57638267 ATGGGGGTTGGGGGAGAAGAGGG + Intergenic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1083542974 11:63527531-63527553 AAGTGGGTTGGAGGGGAAAGAGG - Intergenic
1084464342 11:69313430-69313452 AAGTGGGTTGGGGGCCATGAAGG + Intronic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084829930 11:71760941-71760963 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1085961079 11:81462882-81462904 AGGTGGGTTTGGGGGGAGAGGGG - Intergenic
1086195214 11:84129801-84129823 AAGTGCTTTTGGGGGCAAGGAGG - Intronic
1086418973 11:86619038-86619060 ATGGCGGGTTGGGGGGAAGAAGG - Intronic
1086700801 11:89898575-89898597 AAGTTGGTGTGGTGGGAAGTTGG - Intergenic
1086705368 11:89945952-89945974 AAGTTGGTGTGGTGGGAAGTTGG + Intergenic
1086847687 11:91772639-91772661 AAGTGGGGTGGGGGGGAGGGTGG - Intergenic
1086876769 11:92105954-92105976 AAGAGGGATGGAGGGGAAGAGGG + Intergenic
1087513027 11:99122128-99122150 AAGTGGAGTTGGGGGGAGGTTGG - Intronic
1088121873 11:106379518-106379540 AAGTGGGAGTGGGGGGAAGGGGG - Intergenic
1088472218 11:110198679-110198701 GAGTGGGGTTGGGGGGTGGAGGG - Intronic
1088906734 11:114160836-114160858 AGGTGGTTTTGGGGGTCAGAAGG + Intronic
1089174309 11:116537316-116537338 ACGTGGGTGTTGGGGGACGAGGG - Intergenic
1089563382 11:119357104-119357126 GGGTGGGTTTGGGGGGAGGGTGG + Intronic
1089631089 11:119784674-119784696 AAAAGGGTTTGGGGTGAACACGG - Intergenic
1089731332 11:120520961-120520983 AAGTGGGTTTGGGCGGGGCACGG + Intronic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1090549673 11:127806259-127806281 AAGGAGGTTTGGGGCGCAGAAGG - Intergenic
1091381973 12:67486-67508 AAGTGGGTGTGAGGGAGAGACGG + Intronic
1091409590 12:230257-230279 AAGAGGTCTTGGGGGGAAGGAGG + Intronic
1092255952 12:6927121-6927143 AATTGGGGGTGGGGGGATGAAGG - Intronic
1092413305 12:8270736-8270758 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1094443549 12:30505665-30505687 AAGAGGGTTCAGGGTGAAGAGGG - Intergenic
1095565581 12:43619871-43619893 AAGTGAGTTTGGGGGAAATGAGG - Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096789060 12:54034025-54034047 AGGGGGGGTTGGGGGGAAGAGGG - Intronic
1097712800 12:62934313-62934335 AAGAGGGAGTGGGGAGAAGAGGG + Intronic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098846228 12:75538971-75538993 AAGTGGGCTGGAGGGAAAGAAGG - Intergenic
1099312453 12:81044506-81044528 AAGTGGATTTGAGGGTGAGATGG - Intronic
1099383884 12:81990180-81990202 AAGTGGGCTGGAGGGGAAGGAGG + Intergenic
1100323790 12:93522141-93522163 AAGAGGATTTGAGGGCAAGAGGG - Intergenic
1101305016 12:103519729-103519751 AAATGGGTTGGAGGGGTAGATGG - Intergenic
1101944951 12:109129702-109129724 AACTGCTTTTGGGGGGCAGAGGG - Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1103024402 12:117562059-117562081 AAATGGGTTGGGGGGAATGATGG + Intronic
1103394494 12:120597419-120597441 ATGTGGATTTAGGGTGAAGAGGG + Intergenic
1103526993 12:121575728-121575750 AAGTATGTTAGGGAGGAAGACGG + Intronic
1104204141 12:126620140-126620162 AAGTGGGTGTGGGGGTGAGGGGG + Intergenic
1104215811 12:126732290-126732312 AGGTGTGTTTGGGGTGAGGATGG - Intergenic
1104220636 12:126781475-126781497 AAGTGTGTTTTGGGAGAACATGG - Intergenic
1104259252 12:127167384-127167406 ATGTGGGATAGGGTGGAAGAAGG + Intergenic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104762460 12:131305620-131305642 AACTGGGTTTGGGAGAAGGAAGG + Intergenic
1104817317 12:131655176-131655198 AACTGGGTTTGGGAGAAGGAAGG - Intergenic
1105324273 13:19355849-19355871 ACGTGGGTATGTGGGGATGAGGG - Intergenic
1106191773 13:27459724-27459746 TGGTGGGTTGGGGGGGAAGCCGG + Intergenic
1106473969 13:30081533-30081555 GGGTGGGGTTGGGGGGAAGGTGG - Intergenic
1106506871 13:30378165-30378187 GAGCGGGTTTGGAGAGAAGATGG + Intergenic
1107651410 13:42549028-42549050 AAGTGGGGCTGGGGGAAACAGGG - Intergenic
1107731250 13:43351268-43351290 ATGTGTGTTTTGGGGGTAGAAGG - Intronic
1107850421 13:44566916-44566938 AAGTGGGATGTGGGGGGAGAAGG + Intronic
1107991084 13:45819776-45819798 AAGTGGGTTTGGGGCTTTGAGGG - Intronic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1110585754 13:77189896-77189918 AAGTGAGATTGCAGGGAAGATGG - Intronic
1112471109 13:99690409-99690431 GATTGGGTTTGGGGGGCACAGGG - Intronic
1113067810 13:106389783-106389805 AAGTGGGTTCAGGAGGTAGAGGG - Intergenic
1113931464 13:113971179-113971201 AAGGGGGTGTTGTGGGAAGAGGG - Intergenic
1114819999 14:26007224-26007246 ACGGGGGTTGGGGGGGAAGGGGG + Intergenic
1116623146 14:47231952-47231974 AAATGGGTTATGGGGGTAGATGG + Intronic
1117184803 14:53228879-53228901 AACTGGCTTTGTGGGGGAGATGG - Intergenic
1117881122 14:60314508-60314530 AAGAGGGGTTGGGGAGAAGGAGG + Intergenic
1119794671 14:77385252-77385274 AAGTGGGGTTGGGGATAGGAAGG - Intronic
1120757994 14:88262236-88262258 GAGTGGGTTTTGGTGGAAGGCGG - Intronic
1121453187 14:94022419-94022441 AATGGGGTTGGGGGTGAAGATGG - Intergenic
1121453257 14:94022862-94022884 CAGTGGGATTGGGGGGATTAGGG - Intergenic
1121509373 14:94501002-94501024 AAGTGGTTTTTGGGGGTAGAAGG - Intronic
1121677393 14:95765105-95765127 CAGCTGGTTTGGGGGGTAGATGG - Intergenic
1122067411 14:99183507-99183529 AAGTGGGTCTGGAAGGAACATGG - Intronic
1122424239 14:101596403-101596425 AAGTGGGTCTGAGTGGCAGATGG + Intergenic
1122424245 14:101596438-101596460 AAGTGGGTCTGAGTGGCAGATGG + Intergenic
1122680382 14:103456411-103456433 AAGTGTGAATGAGGGGAAGAGGG - Intronic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122863900 14:104594947-104594969 AGGTGGGTTTGGGGAGGAGATGG - Intronic
1124505322 15:30267619-30267641 AAGGCAGTTTGTGGGGAAGAGGG + Intergenic
1124738230 15:32271012-32271034 AAGGCAGTTTGTGGGGAAGAGGG - Intergenic
1125196957 15:37058141-37058163 AGGTGGGTGTGGGGGGAGTAGGG - Intronic
1127366087 15:58292024-58292046 AAGGGGGTTTGGGGGAAAAGAGG - Intronic
1127885461 15:63195783-63195805 AAGAGGGTTGGGGGTGAGGATGG + Intronic
1128537150 15:68500154-68500176 AAGGGAGTATGGGGGGAAGGGGG - Intergenic
1128919436 15:71596907-71596929 AAGAGGGCGTGTGGGGAAGAAGG + Intronic
1129162572 15:73754742-73754764 AATTGGTTTTGGAGGGTAGAAGG + Intergenic
1130514132 15:84612773-84612795 AATTGGGGTTGGGAGGAATAAGG + Intronic
1131184337 15:90262437-90262459 AAATGGTGTTGGGGAGAAGAGGG - Intronic
1131228944 15:90646625-90646647 AAGTTGGTTTGGGAGGTCGATGG - Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131963638 15:97814655-97814677 AAGTGGGTTTGGAGGGTGCAAGG + Intergenic
1132153250 15:99476975-99476997 ACGTGGGTTGGGGGAGGAGATGG + Intergenic
1133354516 16:5126241-5126263 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1133925441 16:10188357-10188379 AATTGGGATTGGGGTGAAGAGGG + Intergenic
1134271735 16:12739010-12739032 GAGTGGGTTTGGGAGGGAGGCGG + Intronic
1136189446 16:28606930-28606952 AGGTGGGTTTGATGGGAGGAAGG - Exonic
1137454069 16:48604938-48604960 AAGTGGGGTGGTCGGGAAGAGGG - Intronic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1139394471 16:66629622-66629644 AAGTGACTTTTGTGGGAAGAGGG + Intronic
1140126609 16:72123525-72123547 AAGTGAGTATGGGAGGAAAAAGG - Exonic
1140157205 16:72443555-72443577 AAAAGGGATTGGGGGAAAGAAGG - Intergenic
1141150968 16:81564499-81564521 GAGTTGATGTGGGGGGAAGAAGG + Intronic
1141210172 16:81972379-81972401 AAGTGGGGGGAGGGGGAAGAAGG - Intergenic
1141710696 16:85697291-85697313 AAGTGTGTGTTGGGGGAACATGG - Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1143173476 17:4943522-4943544 GAGGGGGTTAGGGGAGAAGAGGG + Intronic
1143671369 17:8398136-8398158 ATAGGGGTGTGGGGGGAAGATGG - Intergenic
1143718859 17:8796454-8796476 ATGTGTGTTGGGGGGGAAGTGGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144321227 17:14122186-14122208 AAATGGATTTGGGGGAAAAAAGG + Intronic
1144330640 17:14220963-14220985 AGGAGGGTTTGAGGGGAAGGGGG + Intergenic
1146589550 17:34116845-34116867 AAGTGTGTGTGGGGGGAGGAGGG + Intronic
1147422671 17:40330474-40330496 ACGTGTGCTGGGGGGGAAGAGGG - Intronic
1148386954 17:47241006-47241028 AAGTGGGGTTGGGGGAAGGGAGG + Intergenic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148651778 17:49255284-49255306 AAGTGGGGGTGGGGTGAACACGG - Intergenic
1149037967 17:52156895-52156917 AATTGGGGTTGGGAGGAAGCTGG - Intronic
1149180276 17:53928079-53928101 TAGTGGGTTGAGGGGGAAGTGGG - Intergenic
1149342429 17:55700538-55700560 AAGTGGTTTGGGGTGGAAGATGG - Intergenic
1152369969 17:79880698-79880720 AAGTGAGATTGGAGGGAAGGTGG + Intergenic
1153063039 18:1013752-1013774 GAGTGGGTTTTGGAGGAAGCTGG + Intergenic
1154406901 18:14100667-14100689 GAGTGGGTATGGTGGGGAGAAGG + Intronic
1155994877 18:32320470-32320492 AAGTGGAGTTGGGGGAAAGGAGG + Intronic
1156081737 18:33343672-33343694 AAGTGGGATTGGGGAGTTGAGGG + Intronic
1156453091 18:37277596-37277618 AAGAGGGCTGGGGGGAAAGATGG + Intronic
1157106796 18:44781495-44781517 AGGTGGGGGTGGGGGGGAGAGGG - Intronic
1157187668 18:45554283-45554305 AAAGGGAGTTGGGGGGAAGAAGG + Intronic
1157531926 18:48428670-48428692 AAGTGGGTGTGGGGAGAGGGAGG - Intergenic
1160175800 18:76593010-76593032 AAGTGGCTTTGCAGGGGAGACGG - Intergenic
1161161818 19:2765836-2765858 AGGAGGGCGTGGGGGGAAGATGG + Intronic
1162065615 19:8123687-8123709 AAGTGTGTTTGGGGGAAAAGGGG - Intronic
1162373404 19:10291812-10291834 GAGTGGGTGTGGGGAGGAGATGG + Intronic
1163229424 19:15990135-15990157 TGGTGGGGTTGGGGGGAGGATGG + Intergenic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1164441186 19:28282037-28282059 AAGGGGGTCTGGGAAGAAGATGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165203960 19:34168217-34168239 AAGTTTATTTGGGGGGAGGATGG - Intergenic
1165935201 19:39384735-39384757 AGGTGGGTTGAGGGGGAGGAGGG - Exonic
1166387158 19:42388866-42388888 AGATGGGTTTGGGGGGAATCAGG - Intronic
1166626953 19:44366638-44366660 AAGTGGGGGTGGGGGGAATGGGG - Intronic
1166813229 19:45526572-45526594 ATTTGGGTTTTGGGGGAAAAGGG + Exonic
1167146084 19:47681313-47681335 AGGCGGGTTTGGGAGGAAGAGGG + Intronic
1167748399 19:51366323-51366345 AAGTGGCTGCGGCGGGAAGATGG - Intronic
925210849 2:2044712-2044734 GGTTGGGTTTTGGGGGAAGAAGG - Intronic
925747868 2:7059443-7059465 AAGTGGGTGGGAGGGGAACACGG - Intronic
925826126 2:7850024-7850046 ATGTGGGTCTGGGGAGACGAAGG + Intergenic
926101472 2:10121077-10121099 TAGTGTGTTTGGGGTGAAAATGG + Intergenic
926730908 2:16034662-16034684 TGGAGGGTTTGGGGGGAAGTGGG + Intergenic
926968762 2:18445088-18445110 ATGAGGGTTTGGCGGGTAGATGG - Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927517264 2:23679780-23679802 CAGAGGGTGTGGGAGGAAGAGGG + Intronic
927581155 2:24249352-24249374 CAGTCAGTTTGGGGGGAGGATGG - Intronic
927608221 2:24508610-24508632 AAAAGGGGATGGGGGGAAGAGGG - Intronic
927853111 2:26512138-26512160 AAGAGGGTTTGGGCAGCAGAAGG + Intronic
928397491 2:30954124-30954146 AAGCGGGTTTGTGGAGAGGAGGG + Intronic
928430948 2:31218046-31218068 AAGTAGGTTGGGAAGGAAGAGGG - Intronic
928498592 2:31862924-31862946 AAATGGGATTGGGGGGAGGTGGG + Intergenic
928758691 2:34556549-34556571 TTGTGGGGTTGGGGGGAAGGGGG - Intergenic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
930312251 2:49755951-49755973 AAGTGGGGAAGGGGGAAAGAAGG + Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
932335738 2:70930486-70930508 AGGTGGCTGTTGGGGGAAGAGGG - Intronic
932495571 2:72144312-72144334 GAGTGTGTTTGGTGGGGAGAGGG - Intronic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933189146 2:79313818-79313840 GTGTGTGTTTGGGGGTAAGAGGG + Intronic
933283778 2:80361766-80361788 GAGAGGTTTTGGGGGGAAGGAGG - Intronic
933745024 2:85564272-85564294 AAGTGGAGTTGGGGGGAGGAAGG + Intronic
933940328 2:87239707-87239729 AAGTGGGCTTGGGAGGCAGACGG + Intergenic
934133376 2:88970849-88970871 AAGTGGGTTTGAGATGAAAAGGG + Intergenic
934555923 2:95286963-95286985 AGGTGGGGTTGGGAGGAAGATGG + Intronic
934916919 2:98307897-98307919 AAAGGAGGTTGGGGGGAAGATGG - Intronic
935228575 2:101076653-101076675 AAGAGGGATGGGGAGGAAGAGGG + Intronic
935635111 2:105243955-105243977 AAGTGGATTTGGTGGGTTGAAGG - Intergenic
935886712 2:107628456-107628478 CCATGGGTTTGGGGGGAAGTGGG - Intergenic
936352810 2:111726069-111726091 ACGTGGGCTTGGGAGGCAGACGG - Intergenic
936996129 2:118416242-118416264 AGGTGGGATTTGGAGGAAGACGG + Intergenic
939106256 2:137952093-137952115 AAGTGTGTGTGGGTGGGAGAGGG - Intergenic
939767363 2:146267396-146267418 AGGTGGGTTTTGGGGGGTGAAGG + Intergenic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
943116334 2:183676298-183676320 ATGGGGGTTTGGGGGCAGGAGGG + Intergenic
943340200 2:186671548-186671570 AAGTGGGGTTGGGAGGTAGAAGG - Intronic
943496185 2:188623489-188623511 AAGTGGATTTAGGGGGCAGGAGG + Intergenic
944463967 2:199982081-199982103 CAGTAGGTTTGGGGGGAACAGGG - Intronic
945027917 2:205637063-205637085 AAGGGGGGTGGGGGGGAGGAGGG - Intergenic
945892287 2:215442712-215442734 AAGTGGGTTCTTGGGGTAGAAGG + Intergenic
946634035 2:221704837-221704859 AAGTGTATTTGGGAGGAGGAGGG - Intergenic
946685821 2:222268622-222268644 ACGGGGGGTTGGGGGGCAGAGGG + Intronic
946816889 2:223588034-223588056 CAGTGGGTTTGGGGGCTGGAAGG - Intergenic
947387737 2:229608726-229608748 AAGTGGGTTGGGGAGGAGTAGGG + Intronic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947590127 2:231380686-231380708 AGGTGGGTTTTGAAGGAAGATGG - Intergenic
947983023 2:234426074-234426096 AAGTGGGTTTTGTGGGTAGGTGG - Intergenic
948292741 2:236838480-236838502 ATGTGGCTTTGGGGGAAAAAAGG - Intergenic
948760477 2:240187238-240187260 AAGTGGGGTGGGAGGGAGGAAGG + Intergenic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
948835733 2:240625164-240625186 AAGTGGGCTGGGGAGGAGGAAGG + Intronic
1168873011 20:1147018-1147040 AATCTGTTTTGGGGGGAAGATGG - Intronic
1169514361 20:6299776-6299798 GCATGGGTTTGTGGGGAAGAAGG + Intergenic
1170707897 20:18761976-18761998 AGGTGGGTTTGGGTGTACGAGGG + Intronic
1170879965 20:20288314-20288336 GAGTGGTTTTCGGCGGAAGAGGG - Intronic
1170890529 20:20371490-20371512 CAGTCTGTTTGGGGGGAAAATGG + Intergenic
1171221538 20:23402495-23402517 AAGTGGGGTTTGGGGGGAGGGGG - Intronic
1172038633 20:32028471-32028493 TAGTGGGTTTGAGGGGCAGCAGG + Intronic
1172549116 20:35785069-35785091 TAGTGGGTTTTGGAGGAAGGAGG + Intronic
1172750277 20:37245905-37245927 AGGTGGGTCTGGGAGGAAGGAGG + Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173581462 20:44149618-44149640 AGCAGGGGTTGGGGGGAAGAGGG - Intronic
1173997942 20:47353800-47353822 AAGGGGGGTTGGGGGGAAGCAGG + Intronic
1174090055 20:48039580-48039602 AAGGGGGGTTGGGTGGAAGTGGG + Intergenic
1174105611 20:48160519-48160541 AAGGGGGTTTAGAGGGAACATGG - Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174389969 20:50213062-50213084 AATTGGGGTTTGGGGGAGGAGGG - Intergenic
1174749244 20:53095757-53095779 AACTGGGGTGGGGGGTAAGAAGG - Intronic
1175328753 20:58148236-58148258 ATGTGGCTTTGGGTGGAAGTGGG - Intergenic
1175427135 20:58875458-58875480 AAGAGGCATTGGGGGGAACAGGG + Intronic
1175493797 20:59398463-59398485 GAGGGGGTGTGGGGGGAAAAGGG - Intergenic
1175966059 20:62660818-62660840 AAGTGGGGCTGGGGGAAGGAGGG - Intronic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1176283227 20:64327347-64327369 AAGTGGGTGTGAGGGAGAGACGG - Intergenic
1178345633 21:31825511-31825533 AGGTGGGTGTGAGGGGGAGAAGG - Intergenic
1178604065 21:34019900-34019922 AAAAGGGTATGGGGTGAAGATGG + Intergenic
1179295472 21:40058233-40058255 ATGTGGGTTTTGGGGGTAGCAGG - Intronic
1180111059 21:45651243-45651265 AAGTGGATTTGGGTTGATGAAGG + Intronic
1181119735 22:20657846-20657868 AAATAGTTTTGGGGGGCAGATGG + Intergenic
1182128913 22:27836415-27836437 ATGCGGGTTTGGGGGAAGGAGGG - Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182249921 22:28992156-28992178 GCGGGGGGTTGGGGGGAAGAGGG - Intronic
1182737930 22:32544423-32544445 AAGTGGGTTGAGGGGCAAGTGGG - Intronic
1183095257 22:35548104-35548126 CAGGGAGGTTGGGGGGAAGAAGG + Intronic
1183985503 22:41567973-41567995 AATTGGGTGTTGAGGGAAGAGGG - Intronic
1184260458 22:43312479-43312501 AAATGGGGTTGGGGGGAGGCTGG + Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184796243 22:46735002-46735024 AAGTGGGGTTGGTGGAAGGAAGG + Intronic
1184970901 22:48019169-48019191 AGGTGGGTTTGGGGTGAAAAGGG + Intergenic
1185017769 22:48355094-48355116 AGGTGGGTTTGTGAGGGAGAGGG - Intergenic
1185417333 22:50717412-50717434 AGGTGGGATTGTGGGGAAGAAGG + Intergenic
949576960 3:5347732-5347754 GAAAGGGTTTGTGGGGAAGAAGG - Intergenic
949906805 3:8864581-8864603 AAGTGAGTTTGGCTGGCAGATGG + Intronic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950213426 3:11140554-11140576 AAGTGGCTTCGGGGAGAGGATGG - Intronic
951485499 3:23204130-23204152 AAGTGGGGTGGGCGGGAAGGGGG - Intronic
951630699 3:24716727-24716749 AGGTGGGATTGGGGGGAGGAAGG + Intergenic
951696134 3:25447545-25447567 AAGGTGGTTTGGGGAGCAGAAGG - Intronic
952621000 3:35342389-35342411 AAGTGGGGGAGGGGGGAAGAAGG + Intergenic
952740645 3:36730976-36730998 GAGTGGCTTTGAGAGGAAGATGG + Intronic
953095509 3:39770631-39770653 AAGTTGGTGTAGGGGAAAGATGG - Intergenic
953253937 3:41271205-41271227 AGTTGGGTGTGGGGAGAAGAAGG - Intronic
953350715 3:42213711-42213733 AAGTTGGTTTGGGGGCTTGATGG + Intronic
954153909 3:48674260-48674282 ACATGGGTGTGGGGTGAAGAGGG + Exonic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
954916122 3:54149786-54149808 AAGTTTGGTTAGGGGGAAGACGG + Intronic
955017586 3:55087340-55087362 CAGTAGGTTTTGTGGGAAGATGG - Intergenic
955398992 3:58577786-58577808 AAATGGCTCTGGGGGGAAAAGGG + Intronic
955524724 3:59808434-59808456 AGGTGGGGTTGTGGGGAAAAAGG - Intronic
956693218 3:71896814-71896836 ATGTGGGTTTAGGGAGAAGGTGG - Intergenic
957058405 3:75461926-75461948 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
958916900 3:100060045-100060067 AAATGGGGGCGGGGGGAAGATGG + Intronic
959430908 3:106253933-106253955 AAGTGTGTTTGGAGGGTAGCTGG - Intergenic
959937277 3:112042083-112042105 GAGTGGGTTTGCGGGGAGGTGGG + Intronic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960430246 3:117560030-117560052 AAGTGTGTTTGTGGTGAGGAGGG + Intergenic
960982558 3:123244277-123244299 AAGTGGGTGGGGGCGGAAGTGGG + Intronic
961295041 3:125877776-125877798 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
961479452 3:127170758-127170780 AGGTGGGCTTGGGGGGAGGTGGG + Intergenic
962492997 3:135911616-135911638 AAGTGGGTCTGTTGGGAAGCAGG + Intergenic
962768385 3:138589091-138589113 AAGGGAATTTGGGGGGATGATGG + Intronic
962894538 3:139702212-139702234 AAGGGGGTTTGGGGCACAGAGGG - Intergenic
964140223 3:153390039-153390061 TAGTGGGTGTAGGGGGAAAAGGG - Intergenic
964304517 3:155326127-155326149 AAGTGACTTTGGGGGGGAGCTGG + Intergenic
964693099 3:159475665-159475687 TAATGGGTTTGGGGTTAAGAGGG - Intronic
965532225 3:169782980-169783002 GAGTGGGTTTGGGTTGAACATGG + Intronic
966463470 3:180203302-180203324 ACCTGGGTTTGGGGGGCACATGG + Intergenic
966578074 3:181525924-181525946 AAGTGGGTTGGGGTGGAAGCAGG - Intergenic
966911110 3:184560871-184560893 AAGTAGGTGTTGGGGGAAGAAGG - Intronic
967011467 3:185438789-185438811 AAGTGGCTTTAGAGGAAAGAAGG + Intronic
967155268 3:186685958-186685980 AAGTGGATTTGAGGGGCTGATGG + Intergenic
967156480 3:186696954-186696976 AAGTGGATTTGAGGGGCTGATGG + Intergenic
969515679 4:7646955-7646977 GAGGGGGTTTGGTGGGAACAGGG + Intronic
969967625 4:11013315-11013337 ATGTCGCTTTGGGGGGAAGCAGG + Intergenic
973835390 4:54804331-54804353 AAGTGGGTTTGGGGGGTGAATGG - Intergenic
974542494 4:63256035-63256057 GGGTGGGTTTGGGGAGGAGAAGG - Intergenic
977210821 4:94215624-94215646 AAGGGGGGTGGGGGGGAGGAGGG + Intronic
977380264 4:96263971-96263993 AAGTGGTTCTTGGGAGAAGAAGG + Intergenic
977566180 4:98583060-98583082 AAGTTGGGTTGAGGGGATGAGGG - Intronic
978308686 4:107361533-107361555 AAATGGGTCTGTGGTGAAGATGG + Intergenic
978314425 4:107419762-107419784 GAGTGGTTTTGTGGGGAAAATGG - Intergenic
978417972 4:108498699-108498721 AAGTGGGTTTGGGGAGATGTTGG + Intergenic
979100907 4:116613004-116613026 AAGTGTGTGTGGGGGGGAGGGGG - Intergenic
979483503 4:121245147-121245169 TAGTGGGTTAGGGAAGAAGAAGG + Intergenic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
979784435 4:124697826-124697848 AAGTGGGGTGGGGTGGAGGATGG + Intronic
979868510 4:125786359-125786381 ATGTGAGGTTGGGGGAAAGAAGG - Intergenic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
982010257 4:151099280-151099302 AAGCAGGTTTGGGGGTTAGACGG + Intergenic
982866908 4:160525000-160525022 ACCTGTGTTTGGGGGAAAGAGGG - Intergenic
983086560 4:163452401-163452423 AAGTGGGTTTGCAGGGATGCAGG + Intergenic
983678426 4:170323310-170323332 AAGGGGATTTAGGGGGAAGGAGG - Intergenic
984587504 4:181580380-181580402 AAATGGGTTGGGGTGGCAGATGG - Intergenic
984812366 4:183806659-183806681 AAGTGGGGGTCGGGGGAAGAAGG - Intergenic
985740699 5:1614694-1614716 AAGTGGGGTGGGGGGAACGAAGG - Intergenic
986291320 5:6401498-6401520 AAGGGTTTTTTGGGGGAAGAAGG - Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
987230514 5:15889086-15889108 AAGTGGGGCGGGGGGAAAGAAGG + Intronic
988653371 5:33178812-33178834 AATAGGGTGTGGGGGGATGATGG - Intergenic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989541064 5:42619330-42619352 AAATGGGTTTGAGGAGTAGAAGG - Intronic
989751408 5:44898790-44898812 AATTGGATTCGGGGGGGAGATGG - Intergenic
990956375 5:61344236-61344258 AAGTGGTATTTGGGGGAAGAAGG - Intronic
991258906 5:64645729-64645751 TAGAGGGTTTGGGGAGGAGAAGG - Intergenic
991422607 5:66456370-66456392 GAGTGGGGTTGGGGGGTAGTGGG - Intergenic
991620724 5:68542992-68543014 AGGTGGGTGTGGGGGGAGAAAGG + Intergenic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
992165982 5:74052252-74052274 AAATGAGTTTGGGGGGAATTGGG + Intergenic
992896344 5:81248413-81248435 AAGTGGGTTTGAGGGTGTGATGG + Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
994968445 5:106703877-106703899 CAGTGGTTCTGTGGGGAAGAAGG - Intergenic
995019309 5:107349038-107349060 TAGTGGGGTTAGGGGGAAGTGGG - Intergenic
995734543 5:115285939-115285961 AAATGGGTTGTGGGGGATGAGGG + Intronic
995887784 5:116915703-116915725 AAGTGGGTGTGGGGTGCTGAAGG + Intergenic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998170050 5:139867373-139867395 AAGTGGCATGGGTGGGAAGAGGG + Intronic
998373795 5:141678523-141678545 AAGAGGGCTTGGGGGCAAAATGG - Intronic
998484064 5:142486486-142486508 AGGTGGGTTTGGGGAAGAGATGG - Intergenic
999234779 5:150083902-150083924 AAGTGGGCTGGAGGGGAAAAGGG - Intronic
999435416 5:151559673-151559695 AAATGGGGTTGGGGGAGAGAGGG - Intronic
999494434 5:152083267-152083289 GAGCTGGTTTGGTGGGAAGAAGG + Intergenic
999674865 5:153988907-153988929 AAGTGGTTTTAGGTGGAAGCTGG - Intergenic
999690405 5:154141292-154141314 AAGTGGATTGGGGTGGATGAAGG + Intronic
1001109125 5:168881101-168881123 AGCTGGGCTTGCGGGGAAGAAGG - Intronic
1001332866 5:170774360-170774382 TAGTGGGGTTGGGGGGATGTAGG + Intronic
1001926662 5:175642129-175642151 AAATGGGGTTGGGGGGAATTAGG + Intergenic
1002123336 5:177022720-177022742 GTGAGGGTTTGCGGGGAAGATGG + Exonic
1002402121 5:178996648-178996670 AACTGGGTTTGGGAGGTGGATGG + Intergenic
1003685467 6:8298040-8298062 AAAAGGAGTTGGGGGGAAGAGGG - Intergenic
1004165019 6:13249355-13249377 ATGGGGGTTTGGGGGCAAGGTGG - Intronic
1004478289 6:15994679-15994701 CAGTGGGCTTGGGAGGGAGATGG + Intergenic
1005445678 6:25920061-25920083 ACTTGGTTTTGGTGGGAAGAAGG + Intronic
1005825516 6:29629263-29629285 AGGTGGGTCTGGGGGTAAGGGGG + Intronic
1006088830 6:31615949-31615971 AAGTGGGGTTGGGGAGTTGAGGG - Intronic
1006480982 6:34293971-34293993 AAGTGGGGTTAGTGGGAAAAGGG - Intronic
1006604887 6:35249063-35249085 AAGTGGGTCTGGTGGGAAACGGG + Exonic
1007182027 6:39935820-39935842 AACTGGGTATGGGGGAGAGAAGG + Intergenic
1007262680 6:40574923-40574945 AAGTGTGTTTTGGGAGAAGCAGG - Intronic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1008940329 6:57039648-57039670 AAGAGGATTTGGGTGTAAGAGGG - Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1010054573 6:71550643-71550665 ATATGTGTTTGGGGGGAAGTGGG - Intergenic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010577767 6:77553811-77553833 AAGTGGTTTTGGTAGGATGAAGG + Intergenic
1010709370 6:79154608-79154630 AAGGGGGTCTGGGTGGATGAGGG - Intergenic
1010928535 6:81772754-81772776 ATTTGGGTTTAGGGGGAAAATGG + Intergenic
1011716406 6:90109655-90109677 AAGCAGGTTTGGAGGGAGGATGG - Intronic
1012896045 6:104950727-104950749 AAGTGGGGGTGGGGGGAAAGGGG - Intergenic
1013365824 6:109437227-109437249 GAGTGGGTTTGGGAAGTAGATGG + Intronic
1013924633 6:115455661-115455683 AGTTGGGTTTGAGGGGAAAAGGG + Intergenic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014441717 6:121480933-121480955 AAGCAGATTTGGGGGGAATATGG - Intergenic
1014707288 6:124763122-124763144 AAATGGGGTTGGGGGAAAGCAGG + Intronic
1015025880 6:128532001-128532023 AAGTGGGGGTGGGGGGAAAGTGG - Intergenic
1015856409 6:137629813-137629835 AAGTGGGTTTGGGGAGGGGATGG - Intergenic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1016430287 6:143977080-143977102 AAGTGTGTTGGGGGGGGGGAAGG - Intronic
1016440930 6:144082621-144082643 AAGTGGGTGTGGGGGGAGGGGGG + Intergenic
1017136011 6:151147961-151147983 AAGAGGGTTGAGGGGCAAGACGG + Intergenic
1017163917 6:151390775-151390797 AAGTGGGTTTGGGGGAGGGGAGG - Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017769335 6:157633147-157633169 AGGTTGGTTTGGGGAGAAGTAGG + Intronic
1018025504 6:159802579-159802601 AAATTTGTTTGGGGGGAAGGGGG + Intronic
1018108197 6:160509094-160509116 AAGAGGTTTTGGGGGGAAATTGG - Intergenic
1018373638 6:163191263-163191285 AAGTAGGTTTGGGGGGTGGCGGG - Intronic
1021345158 7:19518217-19518239 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1021631828 7:22655181-22655203 AAGTGAGTTTCAGGAGAAGAAGG - Intergenic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1021866770 7:24965989-24966011 AAGGGGGTTTGGAGGAAACAAGG - Intronic
1022274519 7:28842253-28842275 AAGGGGGCTTGTGGGGAACAAGG + Intergenic
1022295851 7:29052127-29052149 CAGTGGACTTTGGGGGAAGATGG + Intronic
1022528791 7:31054188-31054210 AAGTGTGTGTGGGGTGACGATGG + Intronic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1022779704 7:33567795-33567817 AAGTAGGTTTTGGGGTAAGACGG - Intronic
1022854347 7:34300688-34300710 AAGTGGGATTGGGGCGATGTGGG + Intergenic
1023845497 7:44117853-44117875 AGGTGGGGTTGTGGGGAAGCAGG - Intronic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1023863071 7:44227006-44227028 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863233 7:44227470-44227492 AAGGGGGTATGGGGGGCAGGGGG + Intronic
1023863265 7:44227559-44227581 AGGAGGGTCTGGGGGGCAGAGGG + Intronic
1023863314 7:44227709-44227731 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023938694 7:44756834-44756856 AAGTGGGTTGGGGGAGAGGTGGG - Intronic
1024119523 7:46222714-46222736 AAGTGAGTTGAGGGGAAAGATGG + Intergenic
1024178376 7:46863462-46863484 GAGTGTGTGTGGGGGGAAAATGG - Intergenic
1024817635 7:53289330-53289352 AGGTGGGTTTGAGGGGCAGAAGG - Intergenic
1025996630 7:66531477-66531499 AAGTGGATTTGGTGGGTAGAGGG - Intergenic
1026158439 7:67848021-67848043 ATGAGGGTTTGGGCTGAAGAAGG - Intergenic
1026988683 7:74570880-74570902 AAGTGGATTTGGTGGGTAGAGGG - Intronic
1029177378 7:98674661-98674683 AAGTGGGTGGGGTGGGGAGAGGG - Intergenic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1031071543 7:117167385-117167407 AAGTGGCTGTAGGGAGAAGAGGG + Intronic
1032401303 7:131626226-131626248 AGGTGGGTTTGGTGGGAGCAGGG - Intergenic
1033126403 7:138711070-138711092 AAGTGGGGGTGGGGGGACGGTGG - Intronic
1033591142 7:142809357-142809379 AAGGGAGTTTGGGGGGCAGGTGG - Intergenic
1033718135 7:144024513-144024535 GAGTGGCTTGGGTGGGAAGAGGG - Intergenic
1033902845 7:146163765-146163787 AAGTGTGTTTGTAAGGAAGAGGG + Intronic
1034077760 7:148249230-148249252 CAGTGGGTTTGGTGGTGAGAAGG - Intronic
1034079486 7:148262989-148263011 GAGTGGGATTGTGGGGAAGGTGG - Intronic
1035270784 7:157718859-157718881 AGGTGGGTTTGGGGGTCTGAGGG - Intronic
1035271079 7:157720357-157720379 AGGTGGGTTTGGGGGTCTGAGGG - Intronic
1035899050 8:3437706-3437728 TAGTGGCTTTGGTGGGAACAGGG - Intronic
1036374966 8:8192138-8192160 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1036439250 8:8765758-8765780 CAGTGGGTTTCTGGGGGAGATGG + Intergenic
1036847401 8:12179142-12179164 CAGTGGCTTTGGGAGGAACAGGG + Intergenic
1036854577 8:12231013-12231035 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1036868769 8:12421463-12421485 CAGTGGCTTTGGGAGGAACAGGG + Intergenic
1036875936 8:12473506-12473528 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1037236097 8:16720926-16720948 AAGCGAGTTTGGGGGAAAAAAGG + Intergenic
1037447483 8:18980954-18980976 AAGAGGGTGTGAGGAGAAGAGGG - Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1037998711 8:23371985-23372007 AAGGGGGTTTGGGGGAGAAATGG + Intronic
1038043956 8:23750487-23750509 AAGAGGGATAGGGAGGAAGAGGG - Intergenic
1038232115 8:25710982-25711004 AAGTGGAACTGGGGGGAAAAGGG - Intergenic
1038539119 8:28376647-28376669 TAGTGGGTTTGGGGGAAAGTTGG - Intronic
1039807483 8:41013267-41013289 AAGGTGGTTGGGTGGGAAGAGGG - Intergenic
1039924346 8:41915736-41915758 TTGCAGGTTTGGGGGGAAGATGG - Intergenic
1040868328 8:52073498-52073520 AAGTGTGTTTGGGGAGATGTTGG - Intergenic
1041844148 8:62307912-62307934 AAGTAGTCTTGTGGGGAAGATGG + Intronic
1041935128 8:63324895-63324917 AAGCAGGTCTGGGGGGAAGCTGG - Intergenic
1042279086 8:67035903-67035925 AACTGGGGTAGGGAGGAAGAAGG + Intronic
1042528028 8:69785212-69785234 AAGTGGTTTTGGAGGCAAAAAGG + Intronic
1042855012 8:73257972-73257994 AATTAGATTTGGGGGGTAGAAGG + Intronic
1043398192 8:79858493-79858515 CAGTGGATTTGGGGAGGAGAAGG - Intergenic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1043606768 8:82010064-82010086 AAGTGGGATTTGGGAGAAGGGGG + Intergenic
1044692313 8:94893850-94893872 GGGTGGGTTTGGGGGAAAAATGG - Intronic
1044872114 8:96629549-96629571 AGAAGGGGTTGGGGGGAAGAAGG + Intergenic
1045246000 8:100442169-100442191 AATTAGGTCTGGTGGGAAGAGGG + Intergenic
1045474614 8:102542514-102542536 AGGTGGGTGTGGGAGGAGGAGGG - Intergenic
1045480232 8:102586104-102586126 GAGTGGGGTTGGGGAGCAGAAGG - Intergenic
1046508258 8:115164406-115164428 AAATGGCTCTGGGGGGAGGAAGG + Intergenic
1046968645 8:120195383-120195405 AAGTGTGTGTGGCGGGCAGAGGG - Intronic
1048822633 8:138393958-138393980 AAGTGGGGTTTGGGGGCAGTTGG + Intronic
1049702854 8:144022982-144023004 AAGAGGGTTTTCAGGGAAGAGGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1050073843 9:1843579-1843601 ATATGGTTTTGGGGGGAACATGG - Intergenic
1051088286 9:13377513-13377535 CAGTTGGGTTGGGGGGAGGAAGG + Intergenic
1052800945 9:32967638-32967660 AAGGAGGTTTGCGGGGAAGCTGG + Intergenic
1053054819 9:34988127-34988149 AAGTGGGGTTGGGGGCCAGGAGG - Intergenic
1054704401 9:68448070-68448092 AAGGGGCTTTGAGGGGAGGAGGG + Intronic
1054823646 9:69548810-69548832 AAGGGGCTTTGTGGGGAGGAGGG - Intronic
1055068644 9:72144714-72144736 AAGTAGTTTTGGGGGGCCGAGGG + Intronic
1055136504 9:72835136-72835158 GAGGGGGTTGGGGAGGAAGATGG - Intronic
1055600901 9:77917365-77917387 AAGGAGGGTGGGGGGGAAGAAGG + Intronic
1055936545 9:81609625-81609647 AAGTGGCTTCGTGGGGAAGCAGG - Intronic
1056236605 9:84600778-84600800 AACTTGGCTTGGGGTGAAGAGGG - Intergenic
1056528986 9:87470384-87470406 AAACGGTTTTGGGGGAAAGATGG - Intergenic
1056619682 9:88201265-88201287 AATAGGGGTTGGGGGGATGAGGG - Intergenic
1056665126 9:88575612-88575634 AAGTGGGGTTGGGAGGAAGGTGG + Intronic
1056671114 9:88627588-88627610 AAGGAGGATTGGGGGGAAGGTGG + Intergenic
1058031353 9:100201542-100201564 AACTGGGGTTGGGGAGCAGATGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059316835 9:113432982-113433004 AACTTGTTTTGGGGAGAAGAGGG + Intergenic
1059343508 9:113612933-113612955 AAGGGGCTTTGTGAGGAAGAGGG + Intergenic
1060007058 9:120009813-120009835 AAAGGGGTTTGGGAGGCAGATGG - Intergenic
1060774132 9:126357030-126357052 AAGTGGGGTTGGGGGAGTGATGG - Intronic
1060859084 9:126939074-126939096 AAGTGGGAGAGGGGGGCAGAGGG + Intronic
1060992293 9:127856090-127856112 AGTTGGGATTGGGGAGAAGAAGG + Intergenic
1061049585 9:128186484-128186506 AAGTGGTTTTGGGAGGAGGCAGG - Intronic
1061206247 9:129165249-129165271 AACTGGATTTGGGGGGCAGAAGG + Intergenic
1185843174 X:3412334-3412356 AAGTGGGCTTGAAGGGAAAAAGG - Intergenic
1186567474 X:10679007-10679029 AAGTGGGATTGCTGGGAGGAAGG - Intronic
1187229386 X:17406271-17406293 AAGGGGGTTTGGGGTGGAAATGG - Intronic
1187955064 X:24509477-24509499 ATGTGTGTGTTGGGGGAAGAGGG - Intronic
1188786787 X:34356496-34356518 AAGTTGAGTTGGAGGGAAGAAGG - Intergenic
1189245039 X:39556930-39556952 AACTGGGTTTGCTGGAAAGAGGG - Intergenic
1190752137 X:53371998-53372020 AAGGGAATTTGGGGGGAGGAGGG - Intergenic
1191217986 X:57952699-57952721 AAGTGTGTTGGGGGGGTACAGGG + Intergenic
1191852803 X:65598233-65598255 AGGTGGGGTCGGGGGGAAGAGGG + Intronic
1192260640 X:69504367-69504389 AAGTGTGTTTGGCGGGGAGCAGG - Intergenic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1196377141 X:115045874-115045896 AACTGGATTTGGGGGAAAGCAGG - Intergenic
1197569730 X:128134075-128134097 CCAAGGGTTTGGGGGGAAGAAGG + Intergenic
1197737325 X:129861415-129861437 AAGGGGGTTAGGGAGGAAGCAGG - Intergenic
1199892287 X:152097825-152097847 ATAGGGGTTTGGGGGGAAGTAGG + Intergenic
1199932670 X:152540191-152540213 AATTGGGTTTGGGTGGTAGGTGG - Intergenic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1201232021 Y:11874245-11874267 AAGTGGGTTTGAAGGGAAAAAGG + Intergenic
1201341034 Y:12934700-12934722 AAGTGGGTGAGGGAGGAATATGG - Intergenic
1201648017 Y:16257069-16257091 AAGTGAGTTTGTGTGGCAGATGG + Intergenic
1201654793 Y:16328232-16328254 AAGTGAGTTTGTGTGGCAGATGG - Intergenic
1201937628 Y:19424980-19425002 AAGTGAGTTTAAGGGGAAGTAGG - Intergenic