ID: 1163375564

View in Genome Browser
Species Human (GRCh38)
Location 19:16928121-16928143
Sequence TTCACCCATGGAGCCCCAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163375556_1163375564 23 Left 1163375556 19:16928075-16928097 CCTCGCTGTAGCTCTCGTCCACC 0: 1
1: 0
2: 2
3: 6
4: 46
Right 1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG 0: 1
1: 0
2: 2
3: 22
4: 224
1163375557_1163375564 5 Left 1163375557 19:16928093-16928115 CCACCTCCATCTTCCTCCAGATT 0: 1
1: 0
2: 2
3: 51
4: 638
Right 1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG 0: 1
1: 0
2: 2
3: 22
4: 224
1163375561_1163375564 -8 Left 1163375561 19:16928106-16928128 CCTCCAGATTCGGAATTCACCCA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG 0: 1
1: 0
2: 2
3: 22
4: 224
1163375560_1163375564 -1 Left 1163375560 19:16928099-16928121 CCATCTTCCTCCAGATTCGGAAT 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG 0: 1
1: 0
2: 2
3: 22
4: 224
1163375558_1163375564 2 Left 1163375558 19:16928096-16928118 CCTCCATCTTCCTCCAGATTCGG 0: 1
1: 0
2: 1
3: 19
4: 181
Right 1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG 0: 1
1: 0
2: 2
3: 22
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163375564 Original CRISPR TTCACCCATGGAGCCCCAGC CGG Exonic