ID: 1163375564

View in Genome Browser
Species Human (GRCh38)
Location 19:16928121-16928143
Sequence TTCACCCATGGAGCCCCAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163375560_1163375564 -1 Left 1163375560 19:16928099-16928121 CCATCTTCCTCCAGATTCGGAAT 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG 0: 1
1: 0
2: 2
3: 22
4: 224
1163375561_1163375564 -8 Left 1163375561 19:16928106-16928128 CCTCCAGATTCGGAATTCACCCA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG 0: 1
1: 0
2: 2
3: 22
4: 224
1163375558_1163375564 2 Left 1163375558 19:16928096-16928118 CCTCCATCTTCCTCCAGATTCGG 0: 1
1: 0
2: 1
3: 19
4: 181
Right 1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG 0: 1
1: 0
2: 2
3: 22
4: 224
1163375556_1163375564 23 Left 1163375556 19:16928075-16928097 CCTCGCTGTAGCTCTCGTCCACC 0: 1
1: 0
2: 2
3: 6
4: 46
Right 1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG 0: 1
1: 0
2: 2
3: 22
4: 224
1163375557_1163375564 5 Left 1163375557 19:16928093-16928115 CCACCTCCATCTTCCTCCAGATT 0: 1
1: 0
2: 2
3: 51
4: 638
Right 1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG 0: 1
1: 0
2: 2
3: 22
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163375564 Original CRISPR TTCACCCATGGAGCCCCAGC CGG Exonic
900870110 1:5296330-5296352 TTCTCTCAGGGAGCCCCTGCAGG - Intergenic
901111902 1:6803985-6804007 TTCACCCATGTTGGCCAAGCTGG - Intronic
901786078 1:11625905-11625927 TTGAGCCACGAAGCCCCAGCTGG - Intergenic
901810734 1:11765699-11765721 TTCACCCAGGGAGACAGAGCTGG + Intronic
902113512 1:14102561-14102583 TTCACTCATGCAGCCCCTCCTGG + Intergenic
902622171 1:17656852-17656874 ACCACCCATTGAACCCCAGCGGG - Intronic
902858459 1:19226767-19226789 TTCAGCCATGTTGCCCAAGCTGG + Intronic
903010542 1:20327118-20327140 ATAACCCATGTAACCCCAGCAGG - Intronic
903518831 1:23931807-23931829 TTTACCCATGGCCCTCCAGCTGG - Intergenic
909864059 1:80644233-80644255 TTCCACCATGTAGCCCCGGCTGG + Intergenic
910255163 1:85240495-85240517 ATTACCCATGGTGGCCCAGCAGG - Intergenic
912712237 1:111958272-111958294 ATTAGCCATGGAACCCCAGCGGG - Intronic
914830629 1:151168436-151168458 TTCACTCTTGTTGCCCCAGCTGG + Intronic
915287534 1:154862491-154862513 TCCACCCCTGGAGGGCCAGCAGG - Intronic
917539463 1:175898879-175898901 GTGACCCCTGGAGCCCCAGAGGG - Intergenic
919902868 1:202056970-202056992 TGCACCCATGGTTCCCCAGGAGG - Intergenic
919935509 1:202248139-202248161 TCCACCCACGCAGCCTCAGCCGG - Intronic
920771593 1:208891787-208891809 TTCACCCATGTTGCCCAGGCTGG + Intergenic
922372491 1:224925300-224925322 TTCTCCCTTGGAGCCTCTGCAGG + Intronic
922723622 1:227911950-227911972 TTCACTCATGTTGCCCAAGCTGG + Intergenic
924239008 1:242023491-242023513 TTCACCCTTGGTGCCCAGGCTGG + Intergenic
1064343507 10:14508649-14508671 TTCAACCATGAAGTCACAGCAGG + Intergenic
1066280986 10:33918237-33918259 TTGACCCCTGGACCCCCAGAGGG + Intergenic
1069449735 10:68507100-68507122 TTTACTCATGTTGCCCCAGCTGG + Intronic
1070253167 10:74790782-74790804 TTCACCCATGTTGCCCAGGCTGG - Intergenic
1073042253 10:100615624-100615646 TCCCCCCAGGGTGCCCCAGCGGG - Intergenic
1074771779 10:116739620-116739642 TTGACACATGGAGCCCTAGAAGG - Intronic
1075737253 10:124671551-124671573 TCCACCCACAGAGCTCCAGCAGG + Intronic
1076902676 10:133347656-133347678 ATCACCCAGGGACCCCCACCCGG + Intronic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1078170309 11:8924618-8924640 TTCAACCAGGGACCCCCAGTGGG + Intronic
1080311885 11:30904172-30904194 TTCACCCAGGGATCCACAGCTGG - Intronic
1083255326 11:61491851-61491873 AGCCCACATGGAGCCCCAGCCGG - Intergenic
1084055615 11:66630384-66630406 TTTACCCATGTAGCCCAGGCTGG - Intronic
1086401345 11:86463316-86463338 TTCACCCATGAATCAGCAGCAGG - Intronic
1087467365 11:98525766-98525788 ACCACCCTTGGAGCCCCAGAGGG + Intergenic
1089151581 11:116368620-116368642 TTGACTCAGGGAACCCCAGCAGG + Intergenic
1096576205 12:52554358-52554380 TTCACCCATGGGGCTCCAGCAGG - Intergenic
1096868976 12:54581729-54581751 TTCCCCCATGTAGCCACAGTGGG + Intronic
1096994529 12:55830454-55830476 TCCACCCATGAACCCCCAGTTGG + Intronic
1097082048 12:56439134-56439156 TTCACTCTTGGTGCCCAAGCTGG - Intronic
1098007567 12:66014562-66014584 TTTACCCATGGCCCCCCAGATGG - Intergenic
1098781693 12:74695335-74695357 TTCACTCTTGTAGCCCAAGCTGG + Intergenic
1100293106 12:93236037-93236059 GTGACCCATGAAGCCCCAGAGGG - Intergenic
1101841018 12:108327728-108327750 TTCACCCATGGAGTTCAGGCTGG - Intronic
1102045689 12:109828781-109828803 TTTACCCAGGGATGCCCAGCTGG - Intronic
1102986884 12:117285428-117285450 TTCACCAATGTAGCAGCAGCTGG - Intronic
1103011650 12:117462725-117462747 TTCACCCATCCATCCCCTGCAGG - Exonic
1103724884 12:122992583-122992605 TTCACGCCTGGAGCCGCTGCTGG - Exonic
1103845245 12:123897525-123897547 TTCACCCATGTTGCCCAGGCTGG - Intronic
1111638191 13:90932470-90932492 TTCACCCTTGTTGCCCAAGCTGG + Intergenic
1113763972 13:112869395-112869417 TAAACCCAGGGAGCCCCAGCTGG + Intronic
1119604402 14:76002215-76002237 TTCACCCTTGTTGCCCAAGCTGG - Intronic
1121148663 14:91609436-91609458 TTCACCCAAGTAGCACCAGAAGG + Intronic
1121422347 14:93824596-93824618 TGCTCCCAGGGAGCCCCAGCAGG + Intergenic
1122247209 14:100412007-100412029 TTCACCCATGTTGCCCAGGCTGG - Intronic
1122738798 14:103859034-103859056 TTCACTCTTGTCGCCCCAGCTGG + Intergenic
1129705674 15:77792769-77792791 TTCACCCATGGATGCCATGCTGG + Intronic
1130880041 15:88047008-88047030 CTCGCCCATGGAGCCTCTGCAGG - Intronic
1131250655 15:90828089-90828111 GACACCCAGGGCGCCCCAGCAGG + Intergenic
1133305903 16:4808566-4808588 TTCACCCTTGTTGCCCAAGCTGG - Intronic
1134068625 16:11246618-11246640 TTCAACCATGTTGCCCAAGCTGG + Intergenic
1135740409 16:24970357-24970379 TTCTCCCAAGGAGTCTCAGCCGG + Intronic
1135761422 16:25141268-25141290 TCCACTGATGGAGCCCCAGATGG + Intronic
1136350643 16:29704968-29704990 TTCACTCTTGGTGCCCAAGCTGG - Intergenic
1136494371 16:30633275-30633297 TTCACTCTTGTTGCCCCAGCTGG + Intergenic
1137777811 16:51071172-51071194 TTCTCCCTTAGAGCCCCCGCAGG + Intergenic
1140665718 16:77225432-77225454 ATCTCCCCTGGAGCCCTAGCAGG + Intergenic
1140758742 16:78092079-78092101 TTCACCCTTGTTGCCCCTGCTGG - Intergenic
1141139641 16:81489107-81489129 TGCACCCATGAAGGCCCAGCTGG + Intronic
1141497336 16:84419258-84419280 TTCTCCCCTGGAGCCTCTGCAGG - Intronic
1141688893 16:85585545-85585567 TCCCCACATGGAGACCCAGCTGG - Intergenic
1142259947 16:89038007-89038029 TTCCCCAAAGCAGCCCCAGCGGG + Intergenic
1142278977 16:89137928-89137950 GGGACACATGGAGCCCCAGCTGG - Intronic
1143188023 17:5022297-5022319 GTCAGCCATGGTGGCCCAGCGGG - Exonic
1143378929 17:6483692-6483714 TTCCCCCATGCAGGACCAGCAGG + Exonic
1143673010 17:8409580-8409602 TTCACCCTTGTTGCCCAAGCTGG - Intergenic
1145037221 17:19549704-19549726 TTCACCCACGGACCCCAAGAAGG - Intronic
1145974795 17:28977805-28977827 TCCACCCAGTGAGCCACAGCCGG + Intronic
1146270599 17:31482872-31482894 TCCACACATAGAGCCCCAGCTGG + Intronic
1147241930 17:39096201-39096223 ATCACGAGTGGAGCCCCAGCAGG + Intronic
1147428534 17:40357489-40357511 CTCACCCCTGCACCCCCAGCTGG + Intronic
1147690948 17:42314124-42314146 CTCACCTGTGGGGCCCCAGCAGG + Exonic
1150424694 17:65067913-65067935 TTCACCCATGTTGACCAAGCTGG - Intergenic
1150668861 17:67171859-67171881 TTCACTCTTGATGCCCCAGCTGG + Intronic
1151897073 17:76987633-76987655 TTCCTCCACGTAGCCCCAGCAGG + Intergenic
1152291027 17:79440437-79440459 ATAGCCAATGGAGCCCCAGCTGG - Intronic
1154234343 18:12590115-12590137 TTCACTCTTGTCGCCCCAGCTGG + Intronic
1156298914 18:35818212-35818234 TGCACCCAGGGAGCACCACCAGG + Intergenic
1157428922 18:47607278-47607300 CTCACCCAAGGATCCACAGCTGG - Intergenic
1157605462 18:48923330-48923352 TTCCGCCATGGACCCCCTGCAGG - Intronic
1157711518 18:49852970-49852992 GTCACCAAAGGAGCCCCAGCAGG - Intronic
1160363851 18:78307802-78307824 CTCTACCATGGAGCCCCAGGAGG - Intergenic
1160411560 18:78678513-78678535 TTCTCCCCTGGAGCCCCAGAGGG - Intergenic
1160568939 18:79803675-79803697 TTCTCCCATCCCGCCCCAGCAGG + Intergenic
1161101807 19:2425241-2425263 TTCGCGCACCGAGCCCCAGCCGG - Exonic
1161357941 19:3829707-3829729 TTCACCCATGTTGCCCAGGCTGG + Intronic
1161375338 19:3936961-3936983 TTCACCCAGAAAGCCACAGCCGG - Intronic
1161460085 19:4391421-4391443 AGCACCCACGGAGCCCCAACTGG + Intronic
1162350433 19:10145689-10145711 TCAACCCTTCGAGCCCCAGCAGG + Intronic
1162697592 19:12488315-12488337 TTCACTCTTGTTGCCCCAGCTGG + Intronic
1163251268 19:16127675-16127697 TGCACCCAAGAAGCCCCGGCTGG - Intronic
1163375564 19:16928121-16928143 TTCACCCATGGAGCCCCAGCCGG + Exonic
1165436140 19:35796645-35796667 TTCACCCTTAAAGCCCCATCAGG + Intergenic
1165914588 19:39249970-39249992 TTCACCCTTGTTGCCCAAGCTGG + Intergenic
1165988400 19:39790774-39790796 TTCACTCTTGTTGCCCCAGCTGG - Intergenic
1166048946 19:40246808-40246830 GCCACTCTTGGAGCCCCAGCTGG - Intronic
1166450922 19:42900033-42900055 TTCACTCATGTTGCCCCGGCTGG - Intronic
1166462833 19:43004377-43004399 TTCCCTCATGTTGCCCCAGCTGG - Intronic
1166468966 19:43060836-43060858 TTCACTCATGTTGCCCCAGCTGG - Intronic
1166480106 19:43164355-43164377 TTCACTCATGTTGCCCCAGCTGG - Intronic
1166489929 19:43249888-43249910 TTCACTCATGTTGCCCCGGCTGG - Intronic
1166746107 19:45142571-45142593 TTCCTCCTGGGAGCCCCAGCAGG - Intronic
1167199040 19:48051219-48051241 TTCTCCCCTGGAGCCTCCGCAGG + Intronic
926113022 2:10194726-10194748 TGCCCCCGTAGAGCCCCAGCAGG - Intronic
927739129 2:25551467-25551489 TTCAGCCAAGGATCCCCAGCCGG - Intronic
928699710 2:33885811-33885833 TTCACTCTTGTTGCCCCAGCTGG - Intergenic
932790088 2:74647862-74647884 TTCACCCTTGTTGCCCAAGCTGG - Intronic
934897605 2:98132334-98132356 TTTGGCCATGGGGCCCCAGCTGG + Intronic
938236001 2:129707876-129707898 TTCCCCCAGGGAGCCCATGCAGG - Intergenic
938260667 2:129893007-129893029 AGCACCCATGGAGACCCAGGAGG - Intergenic
939700702 2:145387079-145387101 ATGACCCCTGGAGCCCCAGAGGG - Intergenic
940611988 2:156004697-156004719 TTTACCAATGGAAACCCAGCAGG - Intergenic
941046367 2:160680176-160680198 TTCATCCATGCATCCCCAGATGG - Intergenic
944512291 2:200476668-200476690 ATGACCCCTGGAGCCCCAGAGGG + Intronic
945047944 2:205798469-205798491 ATGACCCCTGGAGCCCCAGAGGG + Intergenic
946767090 2:223050825-223050847 TTCATCCATAAATCCCCAGCTGG - Intergenic
947944480 2:234089879-234089901 TTCTCCCCTGGAGCCCCCACAGG - Intergenic
1170893067 20:20392111-20392133 CCCACCCAGGGCGCCCCAGCAGG + Intronic
1171149753 20:22817105-22817127 TTCACCCACAAACCCCCAGCTGG + Intergenic
1172515538 20:35530277-35530299 TTCACTCTTGTCGCCCCAGCTGG + Intergenic
1173303627 20:41827397-41827419 ACCTCCCCTGGAGCCCCAGCAGG - Intergenic
1175105978 20:56615294-56615316 TTCCCCCATGGTGCCCAGGCTGG - Intergenic
1179349061 21:40590355-40590377 ATGAGCCATGGAGCCCCTGCAGG + Intronic
1179603817 21:42499228-42499250 TGCACCCAGGAAGCCCCAGGAGG + Intronic
1180020846 21:45125590-45125612 TTCCCCCAATGAGTCCCAGCAGG - Intronic
1181100148 22:20533483-20533505 TCCACCCAGGGAGGCCCAGCAGG - Intronic
1181429264 22:22868049-22868071 TTCTCCCATGGGCTCCCAGCCGG + Intronic
1181647767 22:24243065-24243087 GTCACTCAGGGAGACCCAGCAGG + Intronic
1181803460 22:25361616-25361638 TTCACCCATGGCCCTCCAGTGGG + Exonic
1182087747 22:27573322-27573344 TTAACCCCTGCAGCCCCGGCAGG - Intergenic
1182263180 22:29091001-29091023 TTCACTCTTGTTGCCCCAGCTGG + Intronic
1182277344 22:29198892-29198914 TTCACTCTTGTTGCCCCAGCTGG - Intergenic
1182662582 22:31935463-31935485 TTCACCCATGGTCACACAGCAGG - Intronic
1184498566 22:44858316-44858338 TTCACACATGCACCCGCAGCGGG + Intronic
1184693627 22:46128328-46128350 TCCACCCCTGGGGTCCCAGCTGG - Intergenic
1184707533 22:46224742-46224764 TTCACCCCAGCAGCCCCTGCAGG - Intronic
1184873527 22:47257765-47257787 CTCACCCATGGTGCCCAAGGTGG + Intergenic
1185275653 22:49949295-49949317 TCCACCCAAGGAGCCCCGTCAGG - Intergenic
950458498 3:13106701-13106723 CTAACCCATGGAGCCGCAGGAGG - Intergenic
950546096 3:13638870-13638892 TAGACCCACGGAGCCCGAGCAGG - Intergenic
950664515 3:14487146-14487168 TTCACCCAGGGAGCCCCCGCTGG - Exonic
950887752 3:16375804-16375826 TTCACCCATTCCTCCCCAGCAGG + Intronic
952107707 3:30088599-30088621 GTGACCCCTGGAGCCCCAGAGGG + Intergenic
953088425 3:39697693-39697715 TTTACCCCTGAAGCCCCAGGGGG - Intergenic
954293272 3:49660899-49660921 TGCAGCCCTGGAGCCGCAGCTGG - Exonic
954974875 3:54683998-54684020 TTCACTCATGTAGCCCAAGCTGG + Intronic
957297871 3:78355292-78355314 GTGACCCCTGGAGCCCCAGAGGG + Intergenic
957586495 3:82139200-82139222 ATGACCCCTGGAGCCCCAGAGGG + Intergenic
959294085 3:104513512-104513534 AGCAACCATGGAGCCCCAGGTGG + Intergenic
959723273 3:109515877-109515899 GTGACCCCTGGAGCCCCAGAGGG + Intergenic
963010063 3:140760457-140760479 ATAAGCCAAGGAGCCCCAGCAGG + Intergenic
963290722 3:143484536-143484558 TGCACCCATTGACCCCCATCAGG - Intronic
963595390 3:147318645-147318667 TTCACCCTTGTTGCCCAAGCTGG + Intergenic
964069499 3:152614531-152614553 TTCAGCCATGCAGCCCCACCTGG - Intergenic
964317809 3:155462802-155462824 TCCCCACATGCAGCCCCAGCTGG + Intronic
964369413 3:155984082-155984104 TTCACTCCTGGAGCTCCACCAGG - Intergenic
965467281 3:169045731-169045753 TTCATCCTTGGAGTTCCAGCTGG - Intergenic
967153300 3:186669275-186669297 TTTACCCAAGGACCCACAGCTGG - Intronic
968818777 4:2835022-2835044 TTCTGCCATGGAGTTCCAGCAGG + Exonic
969455487 4:7297530-7297552 TTCACCCAGGGAGACTCAGCAGG - Intronic
972269176 4:37493454-37493476 TTTATCCATGGAGTCACAGCAGG + Intronic
974164599 4:58185305-58185327 GTCACCCCTGGAGGCCCAGCTGG - Intergenic
974435309 4:61849525-61849547 TTCTCCCATTGAGCCCAAGCAGG + Intronic
974729540 4:65843906-65843928 TTTGGCCATGGTGCCCCAGCAGG + Intergenic
975102557 4:70531168-70531190 GCCACCCAGGGAACCCCAGCAGG + Exonic
975931871 4:79534118-79534140 TTCACCAATGTTCCCCCAGCGGG + Intergenic
975947352 4:79723791-79723813 GCCACCCATGAAGCCCCAGAGGG + Intergenic
978440952 4:108732720-108732742 TTCACCCTTGTTGCCCAAGCTGG + Intergenic
980191572 4:129531463-129531485 TTCACCCTGAGAGCACCAGCTGG - Intergenic
981824798 4:148927420-148927442 TTCAACCAAGGAGGCCCAGTAGG - Intergenic
985971275 5:3380639-3380661 TTCCCCCCTGGAGCCCCTGGAGG + Intergenic
986177597 5:5365164-5365186 ATCACCCACACAGCCCCAGCAGG - Intergenic
988635430 5:32978386-32978408 GTGACCCACGGAGCCCCAGAGGG - Intergenic
990463819 5:56053635-56053657 GTGACCCCTGGAGCCCCAGAGGG - Intergenic
990693916 5:58393663-58393685 TTCATCCATAGAACCCCAACAGG - Intergenic
991587381 5:68215179-68215201 TTCACCCCCGGAGCGCCAGGCGG + Intergenic
991904928 5:71500353-71500375 TTCACTCTTGTTGCCCCAGCTGG + Intronic
995226372 5:109705753-109705775 TTCTCCCCTGGAGCTCCAGAAGG - Intronic
996440044 5:123479911-123479933 GTGACCCATGGAGGCCCAGTGGG - Intergenic
1000280435 5:159777129-159777151 TTCCCCTATGGAGCCCTTGCAGG - Intergenic
1000882652 5:166715574-166715596 TTCACTCTTGTCGCCCCAGCTGG - Intergenic
1001052357 5:168423589-168423611 TGCAACCAGGGAGCCCCGGCTGG - Exonic
1002446851 5:179295314-179295336 TTCACCCAGGGAGAGCCAGGAGG - Intronic
1006259679 6:32857377-32857399 CATACCCATGGAGCTCCAGCTGG - Exonic
1006604992 6:35249716-35249738 TTTTCCCTTGTAGCCCCAGCTGG + Exonic
1007284600 6:40738399-40738421 TGTCCCCAGGGAGCCCCAGCCGG - Intergenic
1009879469 6:69547583-69547605 TTCACCCAGGGAGACCCGGGAGG - Intergenic
1015796401 6:137016241-137016263 TGTCCCCATGGAGCCCCAGCTGG - Intronic
1015951025 6:138552569-138552591 TTCACTCATGGCACCCTAGCTGG + Intronic
1017094161 6:150789834-150789856 TTCATCCATGGAGCCAGGGCTGG + Intronic
1018669780 6:166168496-166168518 CTCGCCCACGGAGCCCCAGGCGG + Exonic
1019424258 7:966347-966369 TTCACCCATGTTGCCCAGGCTGG + Exonic
1019923149 7:4175402-4175424 CTCACGCAGGGAGCCCCGGCTGG - Intronic
1020101609 7:5397172-5397194 TTCATCCATGCGGCCCAAGCCGG + Intronic
1020269342 7:6583873-6583895 TTTCCCCATGGTGCCCAAGCTGG - Intronic
1021629437 7:22629958-22629980 TGCCCCCATGGATCCCCAGCAGG - Intronic
1021939816 7:25668508-25668530 TTCACCCAGGGAGCTGCAGAGGG - Intergenic
1022172676 7:27844776-27844798 TGCCCCGTTGGAGCCCCAGCTGG - Intronic
1025708705 7:63889350-63889372 TTTACCCATTGAGACCCACCTGG - Intergenic
1026410007 7:70110484-70110506 TTCACTCTTGGTGCCCAAGCTGG - Intronic
1027333818 7:77127150-77127172 TGCACCCAGGGAGCTCCCGCAGG + Intronic
1029781974 7:102744164-102744186 TGCACCCAGGGAGCTCCCGCAGG - Intergenic
1032086815 7:128888812-128888834 GGCACCCCGGGAGCCCCAGCAGG + Intronic
1033161386 7:139000277-139000299 TTTCACCATGGTGCCCCAGCAGG - Intergenic
1033633800 7:143189263-143189285 ATGACCCCTGGAGCCCCAGAGGG + Intergenic
1033657509 7:143383137-143383159 TTCAGTCCTGGAGCCCCAGGTGG + Exonic
1035470420 7:159105666-159105688 CTCACACAGGGAGCCCCAGCAGG + Intronic
1038704929 8:29884605-29884627 TTCATGCTTGGAGGCCCAGCAGG - Intergenic
1039835543 8:41253610-41253632 TTTCCCCAGGGAGCCCCACCAGG + Intergenic
1043253247 8:78102121-78102143 TTCGCCCTTGTAGCCCAAGCTGG - Intergenic
1046255026 8:111685243-111685265 TTCATCCATAGAGCCTCTGCAGG + Intergenic
1048365168 8:133732167-133732189 TCCACCCATTCACCCCCAGCTGG + Intergenic
1049577559 8:143396778-143396800 TCCCTCCCTGGAGCCCCAGCAGG - Intergenic
1050829146 9:9989758-9989780 ATGACCCCTGGAGCCCCAGCGGG - Intronic
1053173625 9:35907590-35907612 TTCAGCCATCCTGCCCCAGCTGG + Intergenic
1053871011 9:42491944-42491966 TTCAGCCATGAAGCTCCAGGTGG + Intergenic
1054789565 9:69243057-69243079 TTTACCCATGTTGCCCAAGCTGG + Intronic
1055096993 9:72423886-72423908 TCCACCCAGGGAGCCCATGCCGG - Intergenic
1057962399 9:99469267-99469289 TTCTCCCACAGAGCCCCAGTTGG + Intergenic
1058321474 9:103636599-103636621 TTGACCCCTAGAGCCCCAGAGGG - Intergenic
1059137966 9:111824930-111824952 TTCACTCTTGTTGCCCCAGCTGG - Intergenic
1059526904 9:115000413-115000435 TTCACCCATGGAGTCCAAGGAGG - Intergenic
1060692995 9:125681405-125681427 ATCACTCATGGGGCCTCAGCAGG - Intronic
1061192954 9:129092950-129092972 GTCACCCCTGGAGCCCCCTCTGG + Intergenic
1062289630 9:135788726-135788748 TCCCCTCGTGGAGCCCCAGCTGG - Intronic
1185690220 X:2148679-2148701 TTCACTCATGTTGCCCAAGCTGG - Intergenic
1186459703 X:9738652-9738674 TTCACTCTTGTTGCCCCAGCTGG + Intronic
1187901332 X:24029154-24029176 TTCACTGATGGATCCCCAGTGGG - Intergenic
1189090552 X:38078156-38078178 CTCATCCATGGAGTCCCAGGAGG - Intronic
1190824923 X:54008979-54009001 TTCACCCATGTTGGCCAAGCTGG - Intronic
1191976886 X:66882427-66882449 TTCAGCCATTGAACACCAGCTGG - Intergenic
1194090495 X:89578725-89578747 TTTTCCCATGGTGCCCAAGCTGG + Intergenic
1194472638 X:94316317-94316339 TCCATCCATGGAGCCCCAAAAGG + Intergenic
1195466056 X:105180305-105180327 TTCACTCTTGCAGCCCAAGCTGG - Intronic
1195647521 X:107249524-107249546 ATGACCCCTGGAGCCCCAGAGGG + Intergenic
1199826264 X:151503648-151503670 TTCAGCCATGGTGCCCAGGCTGG + Intergenic
1200443148 Y:3234779-3234801 TTTTCCCATGGTGCCCAAGCTGG + Intergenic
1201311441 Y:12601403-12601425 TTCACCCCTGGACCCCCTGCAGG - Intergenic