ID: 1163377525

View in Genome Browser
Species Human (GRCh38)
Location 19:16942631-16942653
Sequence CTGAGTCAGCAGAGGTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163377525_1163377528 0 Left 1163377525 19:16942631-16942653 CCAAGAAACCTCTGCTGACTCAG 0: 1
1: 0
2: 0
3: 20
4: 235
Right 1163377528 19:16942654-16942676 CTCACAGAGGACCCCACAGCTGG 0: 1
1: 0
2: 3
3: 31
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163377525 Original CRISPR CTGAGTCAGCAGAGGTTTCT TGG (reversed) Intronic
900603750 1:3514849-3514871 CTGAGACTGCAGAGTCTTCTCGG - Intronic
902972692 1:20065907-20065929 CTGAGGCAGGAGGGATTTCTTGG + Intronic
902982255 1:20133195-20133217 CTGAGTTATCAATGGTTTCTTGG - Intergenic
903334675 1:22616927-22616949 CAGTGTCAGCAGTGGCTTCTGGG + Intergenic
904407835 1:30305012-30305034 CAGAGTATGCAGAAGTTTCTAGG - Intergenic
904498986 1:30903253-30903275 CTGAGTCTGCAGAGGTGACCAGG - Intronic
904773226 1:32892692-32892714 CTGAGGCAGCAGAAGTTTATGGG + Intronic
904890424 1:33775480-33775502 CTGGGTCAGGAAAGGCTTCTTGG + Intronic
905473893 1:38212443-38212465 CTGAGGCAGCTGGGGTTTCCAGG + Intergenic
905694881 1:39966981-39967003 CGGGGTGAGCAGAGGTCTCTGGG + Intronic
906199926 1:43953380-43953402 CTGAGGTCCCAGAGGTTTCTAGG - Intronic
908560842 1:65304637-65304659 CAGAGTCAGGAGAGGATTCTCGG + Intronic
910688732 1:89944169-89944191 CTCCGTCAGCAGACTTTTCTTGG - Intergenic
912147733 1:106814691-106814713 CTGATTCTGCAGAGATTTATAGG - Intergenic
914811780 1:151033990-151034012 CTGAGACAGCAGATGTGTCCAGG + Exonic
915002654 1:152607696-152607718 CTGAGCCAGGAGAGGGTGCTGGG - Intergenic
915226942 1:154418567-154418589 CTGAGTCAGAGAAGGTTGCTGGG + Intronic
915231011 1:154445335-154445357 CTGAGCCGCCAGAGGTTACTGGG + Intronic
917837250 1:178951159-178951181 CTGAGTCAGCAGATTTGTTTGGG - Intergenic
923348804 1:233083366-233083388 CTGTGTCAGCAGGGGTATCCAGG + Intronic
1062818545 10:517382-517404 CTGAGTCAGCAGCTGTTTTCTGG + Intronic
1067545559 10:47190085-47190107 ATGAGTCAGTGGAGGTATCTGGG + Intergenic
1067815539 10:49473153-49473175 TTGATTCACCAGAGGTCTCTAGG - Intronic
1069083764 10:64115936-64115958 TTGAGTCTGCAAAGGTTTCTAGG + Intergenic
1069107568 10:64402246-64402268 CTGGGTCATCAGGGGGTTCTTGG + Intergenic
1069760264 10:70805684-70805706 CTAAGTCAGCAGAGGTTACCTGG - Intergenic
1073779897 10:106825689-106825711 TTGTGTCAGCAGAGGTTTATTGG - Intronic
1074193547 10:111159232-111159254 TTGAGTCAGGAGAGGTTGGTGGG + Intergenic
1074381736 10:112986241-112986263 GTGAGTCAGTAGATGTTTCTCGG + Intronic
1075202532 10:120417259-120417281 TTGGTTCAGCAAAGGTTTCTTGG + Intergenic
1075544389 10:123343393-123343415 GGGAGTCAGCAGGGGTTTCACGG + Intergenic
1075647576 10:124106634-124106656 CTAAGTCAGAACAGGTTTTTCGG + Intergenic
1076165602 10:128279908-128279930 CTCACTCAGCAAAGGTTTGTGGG + Intergenic
1076946997 10:133658320-133658342 CTGTGTCAGCACAGGGCTCTGGG - Intergenic
1077890714 11:6416246-6416268 ATGAGCCAGCAGAGGAGTCTAGG - Intronic
1078118802 11:8484160-8484182 CTGAGACAACATAGGTTACTAGG - Intronic
1079226797 11:18613893-18613915 CTTATTCAGCAGATATTTCTTGG - Intronic
1079604967 11:22353963-22353985 CTGAGTCAGTAGATGTGTTTGGG - Intronic
1080540733 11:33262144-33262166 CTGAGTCAGTGGAGGCTTTTAGG + Intronic
1080845183 11:36020760-36020782 CTGGGTCAGCAGAGGTGCCCTGG - Intronic
1082185195 11:49171186-49171208 CTGAGTGGGCAGAGGTTAGTTGG - Exonic
1082986520 11:59174174-59174196 CTGATTGAGGAGAGCTTTCTGGG + Intronic
1085452157 11:76640917-76640939 CTGTGTCAGAAGAGGGATCTAGG - Intergenic
1086205993 11:84258867-84258889 CCCAGTTATCAGAGGTTTCTGGG + Intronic
1086681137 11:89674156-89674178 CTGAGTGGGCAGAGGTTAGTTGG + Intergenic
1091059699 11:132449999-132450021 CAGAGCCAGCGCAGGTTTCTGGG - Intronic
1093092793 12:14939791-14939813 CAGAGTCTTCAGAGCTTTCTAGG - Intergenic
1093973677 12:25398173-25398195 CTGATTCATCAGAGGTGTCAGGG - Intergenic
1094010811 12:25807596-25807618 CTGAGTCATCAGAGTTTTCAAGG + Intergenic
1095336919 12:41039735-41039757 CAGAGATAGCAGATGTTTCTTGG + Intronic
1096522190 12:52190784-52190806 CAGAGTCAGGAGGAGTTTCTTGG + Intronic
1097270468 12:57771035-57771057 CTGAGGCAGCAGAAGCTACTAGG + Intronic
1098230468 12:68367867-68367889 CAGAGCCTGCAGAGGTTTATGGG - Intergenic
1100242348 12:92722205-92722227 CTGTGTCAGCTGGGGTTGCTCGG - Intronic
1100998543 12:100330714-100330736 CTGAGTGAGCAGAGTTTTGGAGG + Intronic
1101580145 12:106035631-106035653 GTGAAACAGCAGAGTTTTCTTGG - Intergenic
1101730672 12:107424685-107424707 CTGGGTCAGGAGAGGAGTCTGGG - Intronic
1102267651 12:111501484-111501506 CTGAGGCTGAAGAGGTATCTTGG - Intronic
1103139668 12:118537484-118537506 CTGAGGCAGCAGTGGGTTTTGGG - Intergenic
1103211379 12:119169387-119169409 CTCTGACTGCAGAGGTTTCTGGG + Intergenic
1104009931 12:124923109-124923131 ATGAGAAATCAGAGGTTTCTGGG - Intergenic
1105253602 13:18724118-18724140 ATGAGTCAGCAGAAGTTTGCGGG + Intergenic
1105294817 13:19078564-19078586 CAGAGTCAGAAGAGTATTCTTGG - Intergenic
1107906746 13:45068289-45068311 CTGAGACAAGAGAGGTTTCAGGG - Intergenic
1108696038 13:52903195-52903217 GCGAGTCAGAAAAGGTTTCTTGG - Intergenic
1110495133 13:76159457-76159479 TTGAATCAACAGACGTTTCTGGG + Intergenic
1111145303 13:84170800-84170822 CTGGGGCAGCAGAGGTTACACGG + Intergenic
1113424529 13:110197220-110197242 GAGAGTCAACAGAGGGTTCTGGG - Intronic
1113850775 13:113416496-113416518 GTAAGTCAGCAGAGGGTTCCAGG + Intergenic
1114533285 14:23408445-23408467 CTGGGGCAGCAGACCTTTCTTGG - Intergenic
1118249571 14:64146667-64146689 GTGATTCAGCAGAGGTTCCAAGG - Intronic
1118867900 14:69717806-69717828 CTGAGGCAGCCTAGGTGTCTGGG + Intergenic
1118891105 14:69909857-69909879 GTGAGACAGCAGAGGTTTTTGGG + Intronic
1119170327 14:72530128-72530150 CTGAGCCAGAAGAGCTGTCTAGG + Intronic
1119725350 14:76918969-76918991 ATGAGTCAGCAGAGGCGTCGTGG + Intergenic
1119738059 14:76996560-76996582 CTGGTTCAGCACAGGCTTCTAGG - Intergenic
1119854787 14:77891381-77891403 CTGACTCAGGAGTGGCTTCTGGG - Intronic
1120887679 14:89464473-89464495 CTTTCTCAGCAAAGGTTTCTTGG - Intronic
1122280879 14:100621874-100621896 CTCAGTCCGCAAGGGTTTCTTGG + Intergenic
1122865307 14:104601261-104601283 CTGAGTCTGCACAGGTATCGGGG + Intronic
1202921063 14_KI270723v1_random:30869-30891 CTGTGTCAGCACAGGGCTCTCGG - Intergenic
1202923849 14_KI270724v1_random:6705-6727 CTGTGTCAGCACAGGGCTCTGGG + Intergenic
1123983617 15:25624934-25624956 CTGAGGCTGCAGAGGTGACTGGG - Intergenic
1126789170 15:52204836-52204858 CCGCGTGAGCGGAGGTTTCTGGG + Intronic
1128217222 15:65942847-65942869 CTCAGTCTTCAGGGGTTTCTGGG + Intronic
1132058283 15:98669268-98669290 TTCAGGCAGCAGAGGTTTCAAGG - Intronic
1132465421 16:75347-75369 CTGGGGTAGCAGAGGATTCTGGG - Intronic
1133236000 16:4387729-4387751 CTTGGTCACCAGAGGTTTCATGG - Intronic
1135785438 16:25344764-25344786 CTGAGTAGACAGAGGTGTCTGGG + Intergenic
1137559416 16:49493205-49493227 CTGAGTCAGCAGAGGCTTGAAGG - Intronic
1137571739 16:49570868-49570890 GTGTGTCAGCAGAGGTCTCTAGG + Intronic
1139341301 16:66269891-66269913 CTGGTTCAGCAGAGGACTCTTGG - Intergenic
1141689356 16:85587682-85587704 CTGGGGCAGGAGAGGGTTCTCGG - Intergenic
1142308523 16:89299185-89299207 AAGAGTCTGCAGAGGTTTCTAGG + Intronic
1142337422 16:89498852-89498874 CTCATTCAGCAAAGGTTTCAGGG + Intronic
1142402983 16:89870724-89870746 CTCAGGCAGCAGAGGCATCTGGG + Exonic
1143331485 17:6139315-6139337 CTGAATCAGCAGGGCTTTCCTGG - Intergenic
1143852859 17:9825795-9825817 CTAAGTCAGCTGTGCTTTCTGGG - Exonic
1144082895 17:11780932-11780954 CTGAGACAGCAAAGATTTCAAGG - Intronic
1144530365 17:16032879-16032901 CTCAGTCTGCAGACGTTCCTGGG - Intronic
1145001182 17:19305792-19305814 CTGAGTTGGGAGAGTTTTCTTGG + Intronic
1145064517 17:19753025-19753047 CTGACTCGGCAGAGGCTTCCTGG - Intergenic
1146539081 17:33679448-33679470 CTCATTCAGCAGGGATTTCTTGG + Intronic
1149249940 17:54756538-54756560 CTGAATCAGCAGAAATTTATTGG - Intergenic
1151911937 17:77089066-77089088 CTGGGTTAGCCCAGGTTTCTAGG + Intronic
1152645537 17:81466953-81466975 CTGAGTCAGCAGTGCCTTCCTGG + Intergenic
1153708973 18:7778337-7778359 CTGAGTCATCACGGTTTTCTTGG + Intronic
1153911715 18:9710520-9710542 CAGAGAAAGAAGAGGTTTCTGGG + Intronic
1158283082 18:55849151-55849173 CTGTGAAAGCAGAGGTTTGTGGG - Intergenic
1163377525 19:16942631-16942653 CTGAGTCAGCAGAGGTTTCTTGG - Intronic
1164879052 19:31715432-31715454 CCGAGTGAGCAGCGTTTTCTGGG - Intergenic
1164902883 19:31942998-31943020 CTGGGTTAGCAGAATTTTCTGGG + Intergenic
1164925858 19:32129378-32129400 ATGAGTCACCACAGGATTCTCGG - Intergenic
1166033154 19:40148077-40148099 CGGAGTCTGCAGAGGTTTGGAGG + Intergenic
1166581120 19:43900975-43900997 ATGAGACAGCTGGGGTTTCTTGG + Intronic
1166583646 19:43925984-43926006 CTTACTGAGCAGAGGTTGCTGGG - Intronic
1168018357 19:53591591-53591613 CAGAGTCTTCAGAGTTTTCTAGG + Intergenic
928252492 2:29694053-29694075 CTGAGTTAGTAGAGTTTTCTAGG + Intronic
933805205 2:85994077-85994099 CTGACTCAGCACAGGGTTCTCGG - Intergenic
934937587 2:98476603-98476625 CTGAGCCAGGAGAGGTCTCCAGG - Intronic
937322695 2:120970445-120970467 CTGAGCCAGCAGAGGGGTCTGGG + Exonic
937846211 2:126582045-126582067 CTGAGGAACCAGAGGTTTCATGG + Intergenic
939363273 2:141201394-141201416 GTGAGTCAGAAAATGTTTCTTGG - Intronic
939658269 2:144854323-144854345 CTGGGTAAGAAGAGGTTTCAGGG - Intergenic
941161805 2:162044063-162044085 ATCAGTAAACAGAGGTTTCTGGG - Intronic
943764695 2:191648129-191648151 CTGAGTCAGCAGTAGCTCCTTGG + Intergenic
945710240 2:213285609-213285631 CTGAGTCAGGACAGGTTAATCGG - Intronic
946174755 2:217915731-217915753 CTGGGTCAGGAGTGGATTCTTGG - Intronic
947317429 2:228876549-228876571 GGGAGTCAGCAGTGGTTGCTGGG - Intronic
947542810 2:230990468-230990490 CTGAGCCTGCAGAGCTTTCCAGG + Intergenic
948174519 2:235932601-235932623 CTCACTCAGCAGAGGCTGCTTGG - Intronic
948417187 2:237818113-237818135 CTGAGTCAGCAGTGTTTTGTAGG - Exonic
1169653846 20:7900051-7900073 CTGAGTCAGAACAGATTCCTAGG - Intronic
1171258327 20:23708997-23709019 TTGAGTCATCCCAGGTTTCTTGG + Intergenic
1173191761 20:40882306-40882328 CTGAGGCAGCTGAGTTTTCTGGG + Intergenic
1176085434 20:63293611-63293633 CTGAGTCAAGCCAGGTTTCTGGG + Intronic
1177049442 21:16213759-16213781 ATGAGTCTGTAGAGGTGTCTTGG + Intergenic
1177871356 21:26576716-26576738 CTGATTTAGAAGAGGATTCTTGG - Intergenic
1178524992 21:33320176-33320198 CTGAGGAGGCAGAGGTTGCTGGG + Intergenic
1178807367 21:35850907-35850929 CTGAGTCTGCAAATATTTCTGGG - Intronic
1179289484 21:40006136-40006158 CTGAGCCAGCTGAGGCTCCTGGG - Intergenic
1179480164 21:41671929-41671951 CTGCCCCAGCAGTGGTTTCTCGG - Intergenic
1181102620 22:20551547-20551569 CTGCCTCGGCAGAGCTTTCTGGG + Intronic
1181104667 22:20566860-20566882 CTCTGTCAGCAGTAGTTTCTAGG + Intronic
1182155381 22:28066980-28067002 CTCAGTCAGGAGAGGCTTCCTGG - Intronic
1182162968 22:28141836-28141858 GTGAGTCAGAAGAGGTTTCGTGG - Intronic
1182482134 22:30615880-30615902 CTGAGTCAGCACAAGATTGTGGG + Intronic
1182574998 22:31267048-31267070 CTCAGTCAGAAAAGTTTTCTGGG - Exonic
1182657470 22:31902182-31902204 ATGAGTCAGTAGATATTTCTTGG + Intronic
1183495599 22:38141811-38141833 CTGGGTGCGCAGAGGATTCTCGG + Intronic
1183742490 22:39676622-39676644 CTGGGTTTGCAGAGGCTTCTGGG + Intronic
1184097351 22:42323731-42323753 ATGAGGAAGCAGAGGCTTCTCGG - Intronic
1184610191 22:45598552-45598574 GGGAGTCAGGACAGGTTTCTTGG - Intronic
1184954920 22:47879563-47879585 CTGAGGCAGGAAAGGTTTGTGGG - Intergenic
1185233093 22:49694522-49694544 CTGAGTTATCTGGGGTTTCTGGG + Intergenic
949328884 3:2899169-2899191 CTTAACCAGCAGAGGTCTCTAGG - Intronic
953926830 3:46986885-46986907 CTGAGACAGCAGAGGTGGCCAGG - Intronic
954039564 3:47874595-47874617 CTTATTCAGCAGCGGCTTCTGGG - Intronic
954436906 3:50501104-50501126 CTGACCCAGCAGAAGGTTCTGGG + Intronic
954710016 3:52501025-52501047 CAGAGTAAGCAGAGGGTTCTGGG - Intronic
957040877 3:75334574-75334596 CTAAATCAGCAGAACTTTCTAGG + Intergenic
957080465 3:75632096-75632118 CTGTGTCAGCACAGGGCTCTGGG + Intergenic
957211375 3:77262825-77262847 CTGAGACAGCAGAGGTTGGATGG + Intronic
960651889 3:119960131-119960153 TTGTCTCAGCATAGGTTTCTGGG - Intronic
962754544 3:138457817-138457839 CCCAGGCAGCAGAGCTTTCTTGG + Intronic
968804631 4:2764161-2764183 CTGGGTCACCAGACGGTTCTGGG - Intergenic
969214830 4:5713095-5713117 CTGAGTCAGCTGAGGCTTACCGG + Intronic
969974869 4:11088195-11088217 CTGAGTCAGGAGATGTTAATAGG + Intergenic
970946550 4:21699691-21699713 CTGAGCCAGGAGAGACTTCTGGG + Intronic
972239884 4:37178864-37178886 CTGAGTGAACAGAGGTAGCTGGG - Intergenic
972899481 4:43665426-43665448 ATGAGTCATCAGGGTTTTCTAGG + Intergenic
973924748 4:55726117-55726139 ATGAGCCAGGAGAGGTTTCATGG + Intergenic
975677033 4:76837148-76837170 CTGAAACACCAGAAGTTTCTTGG - Intergenic
975738769 4:77407908-77407930 CTAAGTCAGAAGAGGTGACTGGG - Intronic
976430149 4:84953750-84953772 GTGAATCAGAACAGGTTTCTTGG - Intronic
976447784 4:85151464-85151486 CAGTGTCAGCAGAGAATTCTTGG + Intergenic
978549175 4:109906237-109906259 ATGAGTCATTAGAGTTTTCTAGG - Intergenic
980813872 4:137917970-137917992 CTGAGGCACCTGAGGCTTCTTGG + Intergenic
981678357 4:147365437-147365459 TTGAGGGAGCAGAGGTTTATAGG - Intergenic
982444066 4:155469726-155469748 CTTAGTTAGAAGAGGTATCTTGG + Intergenic
983003890 4:162458126-162458148 CTGTGTAAGAAAAGGTTTCTGGG + Intergenic
985168127 4:187119096-187119118 CTGCTTCAGCAGAGTATTCTAGG + Intergenic
985450455 4:190059119-190059141 CTGTGTCAGCACAGGGCTCTGGG - Intergenic
985748117 5:1659290-1659312 CTGAGTCAGCACAGCCTGCTTGG - Intergenic
987136171 5:14901564-14901586 CTGAGTCAGGAGCAATTTCTAGG - Intergenic
988834108 5:35014658-35014680 ATGAGTTAGCAGAGGTTCCAAGG - Intronic
989489789 5:42036955-42036977 CTCAGTCATCAGTTGTTTCTTGG + Intergenic
991449063 5:66732431-66732453 CTGGGTCAGCAAAGGCTTCCAGG - Intronic
992758530 5:79931715-79931737 CAGAGTCATCAGAGACTTCTAGG + Intergenic
994214648 5:97123919-97123941 CAGAGGCAGCATAGGTTTGTAGG + Intronic
997659155 5:135576761-135576783 CAGCCTCAGCAGAGATTTCTGGG + Intronic
998497213 5:142601344-142601366 CTGAGACAGAAGAGGTTCCCAGG + Intronic
1000643255 5:163730675-163730697 CTAACTCAGAAGAGGGTTCTAGG + Intergenic
1001170954 5:169418469-169418491 CTCAGTCAGAAGAATTTTCTTGG + Intergenic
1001997909 5:176176792-176176814 CTGTGGCAGCAGAGCTTCCTGGG - Intergenic
1002436525 5:179235008-179235030 CAGAGTGAGCAGTGTTTTCTCGG - Intronic
1004011083 6:11688017-11688039 CCGAGTTAGCAGAGGATTGTAGG - Intergenic
1004120649 6:12818323-12818345 CTGGGTCAGCTGAGATGTCTGGG + Intronic
1005684956 6:28245390-28245412 CTGAGACATCAGAGGATTCATGG - Exonic
1006793491 6:36718156-36718178 CTTAGCCAGCAGAGGTGTCCCGG - Intronic
1007398888 6:41592468-41592490 CTGAGCCAGCAGGGCTTGCTTGG + Intronic
1009031166 6:58059887-58059909 TGGAGTCAGCAGAGGTTGTTGGG + Intergenic
1009207022 6:60814349-60814371 TGGAGTCAGCAGAGGTTGTTGGG + Intergenic
1010015207 6:71097372-71097394 ATGAGTCTTCAGAGTTTTCTAGG + Intergenic
1011813043 6:91155136-91155158 GAGAGTAAGCTGAGGTTTCTTGG + Intergenic
1012058450 6:94446080-94446102 CTGTGTCAGTTGATGTTTCTGGG - Intergenic
1017826298 6:158084502-158084524 CTGAATCAGAAGAGTTTTGTTGG - Intronic
1018094191 6:160370959-160370981 CTGTGTCAGGAAAGGCTTCTAGG - Intronic
1024573046 7:50740396-50740418 ATTAGTCAGCAGATCTTTCTTGG - Intronic
1026635940 7:72081806-72081828 CAGGCTCAGCAGAGGTATCTGGG - Intronic
1028975301 7:96906002-96906024 CTGAGTGCTCAGAGCTTTCTAGG - Intergenic
1029822495 7:103159414-103159436 CTGCTTCCTCAGAGGTTTCTAGG - Intergenic
1031450791 7:121915346-121915368 CTGAGACCGGAGAGGCTTCTGGG + Intronic
1031931150 7:127687183-127687205 CTGAGACACCTGAGGTTACTAGG + Intronic
1035496533 7:159332475-159332497 CTGGGTCAGCTGAGGTTTGAGGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040459634 8:47634788-47634810 CTAAGTCAGCAAAGGTTGCCTGG - Intronic
1042708716 8:71691106-71691128 GGGAGTCAGCAGATGTGTCTAGG - Intergenic
1043314725 8:78906356-78906378 CTGAGTCAGATTAGGTTTTTTGG + Intergenic
1044371647 8:91419198-91419220 TGGAGTCAGCAGTGGTTTCCAGG + Intergenic
1044457983 8:92411410-92411432 CTGAGTGAGCAGAGCTTCGTCGG + Intergenic
1044645769 8:94441557-94441579 CTGAATAAGTGGAGGTTTCTGGG - Intronic
1044898452 8:96918542-96918564 CTGAGTAAACAGAGGGTCCTGGG - Intronic
1045797069 8:106058620-106058642 CTGGAGCAGCTGAGGTTTCTGGG - Intergenic
1046465255 8:114593523-114593545 CTGAGGTAGCAGAGGCTTCATGG + Intergenic
1048425904 8:134323295-134323317 CTAAGTCTGCAAAGGCTTCTAGG - Intergenic
1048695555 8:137024068-137024090 TTCAGTCAGTGGAGGTTTCTCGG - Intergenic
1049215211 8:141404661-141404683 CTGAGTCAGCAGAGGCTTGGGGG + Intronic
1049403571 8:142441740-142441762 ATGAGAGATCAGAGGTTTCTAGG + Intergenic
1049606003 8:143529490-143529512 CTGAGTCCTCAGAGGTCCCTGGG - Intronic
1049947380 9:610552-610574 CTGACGCAGCAGAGGGTACTCGG - Intronic
1050275585 9:3994784-3994806 CTGCATCAGAAGTGGTTTCTCGG - Intronic
1050900031 9:10935976-10935998 CTTAATCAGCAGATGATTCTAGG + Intergenic
1051688447 9:19683342-19683364 TTGCCTCAGCATAGGTTTCTGGG + Intronic
1052895579 9:33744831-33744853 ATGAGTCTTCAGAGTTTTCTAGG - Intergenic
1055002751 9:71471550-71471572 CTTTGTTAACAGAGGTTTCTTGG + Intergenic
1055134908 9:72817417-72817439 CTGTGTCAGTAGACGTTCCTCGG - Intronic
1055462015 9:76528425-76528447 CTGAGGCAGCAGTGGCTACTTGG - Intergenic
1056924598 9:90822293-90822315 TTAAGTCAGCAGATTTTTCTTGG + Intronic
1057785334 9:98083178-98083200 CTTAGACAGCAGATGTTTCTGGG + Intronic
1058162346 9:101583102-101583124 TTGAGAAAGCAGAGGTTTATAGG + Intronic
1059327792 9:113514813-113514835 CTGAGGGAGCAGAGATTTCCAGG + Intronic
1059559301 9:115316890-115316912 CTGAGTCAGGAGAGGATAATTGG - Intronic
1060948167 9:127582664-127582686 CTGAAACAGGAGAGCTTTCTGGG - Intergenic
1062060078 9:134490593-134490615 GAGAATCAGCAGAGGATTCTGGG + Intergenic
1062189898 9:135242576-135242598 CAGAGACAGCAGAGGTTGCAAGG - Intergenic
1188262812 X:28038861-28038883 CAGAGTCATCAGAGTTTCCTTGG - Intergenic
1189011785 X:37053307-37053329 CTGAGGCTGCACAGGTTACTGGG - Intergenic
1189036924 X:37502979-37503001 CTGAGGCTGCACAGGTTACTGGG + Intronic
1192200118 X:69061238-69061260 CTTGGGCAGCAGAGGCTTCTGGG - Intergenic
1192259192 X:69493959-69493981 GTGAGTCATCAGTGATTTCTTGG + Intergenic
1194123605 X:89988794-89988816 TAGAGGCATCAGAGGTTTCTTGG + Intergenic
1194739082 X:97550691-97550713 CTGAGTTGGCAGAGGTTATTTGG - Intronic
1196405731 X:115360681-115360703 ATGAGTCAGCAAAGGCTGCTTGG - Intergenic
1198047408 X:132916521-132916543 TTGAGTCAGCAGAGTGTTATGGG + Intronic
1198585166 X:138112621-138112643 ATGATTCTGCAGAGGTTCCTGGG - Intergenic