ID: 1163377693

View in Genome Browser
Species Human (GRCh38)
Location 19:16943858-16943880
Sequence ATAGGAGGGCTGGCCAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163377693_1163377703 24 Left 1163377693 19:16943858-16943880 CCCTGGCTGGCCAGCCCTCCTAT No data
Right 1163377703 19:16943905-16943927 TCTGCCTCCTCTTTGCTCCTTGG No data
1163377693_1163377696 -10 Left 1163377693 19:16943858-16943880 CCCTGGCTGGCCAGCCCTCCTAT No data
Right 1163377696 19:16943871-16943893 GCCCTCCTATCACTCCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163377693 Original CRISPR ATAGGAGGGCTGGCCAGCCA GGG (reversed) Intronic