ID: 1163377696

View in Genome Browser
Species Human (GRCh38)
Location 19:16943871-16943893
Sequence GCCCTCCTATCACTCCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163377686_1163377696 26 Left 1163377686 19:16943822-16943844 CCATCCGAATCTGGGGCTCTCAC No data
Right 1163377696 19:16943871-16943893 GCCCTCCTATCACTCCAGTGAGG No data
1163377687_1163377696 22 Left 1163377687 19:16943826-16943848 CCGAATCTGGGGCTCTCACTCCA No data
Right 1163377696 19:16943871-16943893 GCCCTCCTATCACTCCAGTGAGG No data
1163377692_1163377696 -5 Left 1163377692 19:16943853-16943875 CCACTCCCTGGCTGGCCAGCCCT No data
Right 1163377696 19:16943871-16943893 GCCCTCCTATCACTCCAGTGAGG No data
1163377691_1163377696 -4 Left 1163377691 19:16943852-16943874 CCCACTCCCTGGCTGGCCAGCCC No data
Right 1163377696 19:16943871-16943893 GCCCTCCTATCACTCCAGTGAGG No data
1163377693_1163377696 -10 Left 1163377693 19:16943858-16943880 CCCTGGCTGGCCAGCCCTCCTAT No data
Right 1163377696 19:16943871-16943893 GCCCTCCTATCACTCCAGTGAGG No data
1163377690_1163377696 2 Left 1163377690 19:16943846-16943868 CCAGAGCCCACTCCCTGGCTGGC No data
Right 1163377696 19:16943871-16943893 GCCCTCCTATCACTCCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163377696 Original CRISPR GCCCTCCTATCACTCCAGTG AGG Intronic