ID: 1163377699

View in Genome Browser
Species Human (GRCh38)
Location 19:16943876-16943898
Sequence TCGGGCCTCACTGGAGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163377699_1163377703 6 Left 1163377699 19:16943876-16943898 CCTATCACTCCAGTGAGGCCCGA No data
Right 1163377703 19:16943905-16943927 TCTGCCTCCTCTTTGCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163377699 Original CRISPR TCGGGCCTCACTGGAGTGAT AGG (reversed) Intronic