ID: 1163377703

View in Genome Browser
Species Human (GRCh38)
Location 19:16943905-16943927
Sequence TCTGCCTCCTCTTTGCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163377697_1163377703 10 Left 1163377697 19:16943872-16943894 CCCTCCTATCACTCCAGTGAGGC No data
Right 1163377703 19:16943905-16943927 TCTGCCTCCTCTTTGCTCCTTGG No data
1163377700_1163377703 -3 Left 1163377700 19:16943885-16943907 CCAGTGAGGCCCGAATTATTTCT No data
Right 1163377703 19:16943905-16943927 TCTGCCTCCTCTTTGCTCCTTGG No data
1163377699_1163377703 6 Left 1163377699 19:16943876-16943898 CCTATCACTCCAGTGAGGCCCGA No data
Right 1163377703 19:16943905-16943927 TCTGCCTCCTCTTTGCTCCTTGG No data
1163377691_1163377703 30 Left 1163377691 19:16943852-16943874 CCCACTCCCTGGCTGGCCAGCCC No data
Right 1163377703 19:16943905-16943927 TCTGCCTCCTCTTTGCTCCTTGG No data
1163377698_1163377703 9 Left 1163377698 19:16943873-16943895 CCTCCTATCACTCCAGTGAGGCC No data
Right 1163377703 19:16943905-16943927 TCTGCCTCCTCTTTGCTCCTTGG No data
1163377694_1163377703 23 Left 1163377694 19:16943859-16943881 CCTGGCTGGCCAGCCCTCCTATC No data
Right 1163377703 19:16943905-16943927 TCTGCCTCCTCTTTGCTCCTTGG No data
1163377695_1163377703 14 Left 1163377695 19:16943868-16943890 CCAGCCCTCCTATCACTCCAGTG No data
Right 1163377703 19:16943905-16943927 TCTGCCTCCTCTTTGCTCCTTGG No data
1163377693_1163377703 24 Left 1163377693 19:16943858-16943880 CCCTGGCTGGCCAGCCCTCCTAT No data
Right 1163377703 19:16943905-16943927 TCTGCCTCCTCTTTGCTCCTTGG No data
1163377692_1163377703 29 Left 1163377692 19:16943853-16943875 CCACTCCCTGGCTGGCCAGCCCT No data
Right 1163377703 19:16943905-16943927 TCTGCCTCCTCTTTGCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163377703 Original CRISPR TCTGCCTCCTCTTTGCTCCT TGG Intronic