ID: 1163377707

View in Genome Browser
Species Human (GRCh38)
Location 19:16943932-16943954
Sequence TCACTGAAGTGAAATTCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163377700_1163377707 24 Left 1163377700 19:16943885-16943907 CCAGTGAGGCCCGAATTATTTCT No data
Right 1163377707 19:16943932-16943954 TCACTGAAGTGAAATTCACGTGG No data
1163377702_1163377707 14 Left 1163377702 19:16943895-16943917 CCGAATTATTTCTGCCTCCTCTT No data
Right 1163377707 19:16943932-16943954 TCACTGAAGTGAAATTCACGTGG No data
1163377704_1163377707 0 Left 1163377704 19:16943909-16943931 CCTCCTCTTTGCTCCTTGGAATT No data
Right 1163377707 19:16943932-16943954 TCACTGAAGTGAAATTCACGTGG No data
1163377705_1163377707 -3 Left 1163377705 19:16943912-16943934 CCTCTTTGCTCCTTGGAATTTCA No data
Right 1163377707 19:16943932-16943954 TCACTGAAGTGAAATTCACGTGG No data
1163377701_1163377707 15 Left 1163377701 19:16943894-16943916 CCCGAATTATTTCTGCCTCCTCT No data
Right 1163377707 19:16943932-16943954 TCACTGAAGTGAAATTCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163377707 Original CRISPR TCACTGAAGTGAAATTCACG TGG Intronic