ID: 1163383748

View in Genome Browser
Species Human (GRCh38)
Location 19:16986249-16986271
Sequence CTCAGGGCATGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 715
Summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 640}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163383748_1163383768 25 Left 1163383748 19:16986249-16986271 CCATCTTCCCTCCATGCCCTGAG 0: 1
1: 0
2: 4
3: 70
4: 640
Right 1163383768 19:16986297-16986319 TTTGGTGGGTAGGACGCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 53
1163383748_1163383762 11 Left 1163383748 19:16986249-16986271 CCATCTTCCCTCCATGCCCTGAG 0: 1
1: 0
2: 4
3: 70
4: 640
Right 1163383762 19:16986283-16986305 GCCCCTCATGGCAGTTTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 76
1163383748_1163383761 10 Left 1163383748 19:16986249-16986271 CCATCTTCCCTCCATGCCCTGAG 0: 1
1: 0
2: 4
3: 70
4: 640
Right 1163383761 19:16986282-16986304 GGCCCCTCATGGCAGTTTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 100
1163383748_1163383767 24 Left 1163383748 19:16986249-16986271 CCATCTTCCCTCCATGCCCTGAG 0: 1
1: 0
2: 4
3: 70
4: 640
Right 1163383767 19:16986296-16986318 GTTTGGTGGGTAGGACGCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 99
1163383748_1163383760 7 Left 1163383748 19:16986249-16986271 CCATCTTCCCTCCATGCCCTGAG 0: 1
1: 0
2: 4
3: 70
4: 640
Right 1163383760 19:16986279-16986301 CCGGGCCCCTCATGGCAGTTTGG 0: 1
1: 0
2: 1
3: 10
4: 83
1163383748_1163383757 -1 Left 1163383748 19:16986249-16986271 CCATCTTCCCTCCATGCCCTGAG 0: 1
1: 0
2: 4
3: 70
4: 640
Right 1163383757 19:16986271-16986293 GGTTGTGCCCGGGCCCCTCATGG 0: 1
1: 0
2: 0
3: 12
4: 131
1163383748_1163383769 26 Left 1163383748 19:16986249-16986271 CCATCTTCCCTCCATGCCCTGAG 0: 1
1: 0
2: 4
3: 70
4: 640
Right 1163383769 19:16986298-16986320 TTGGTGGGTAGGACGCGCTGGGG 0: 1
1: 0
2: 0
3: 0
4: 79
1163383748_1163383766 15 Left 1163383748 19:16986249-16986271 CCATCTTCCCTCCATGCCCTGAG 0: 1
1: 0
2: 4
3: 70
4: 640
Right 1163383766 19:16986287-16986309 CTCATGGCAGTTTGGTGGGTAGG 0: 1
1: 0
2: 3
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163383748 Original CRISPR CTCAGGGCATGGAGGGAAGA TGG (reversed) Intronic
900188162 1:1342538-1342560 CTCAGGGCACCCAGGGAACAGGG + Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
901078776 1:6571906-6571928 CTCTGAGCCAGGAGGGAAGAAGG - Intronic
901490998 1:9596131-9596153 CTCAGGGCCTGGAGAGGACAGGG - Intronic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902263344 1:15243725-15243747 CCCAGGGCAGGGAGTGAAGGGGG - Intergenic
902379496 1:16045970-16045992 CCCAGGGCATGGAGGAGGGAAGG - Intronic
902822993 1:18954928-18954950 CTCAGGGAGTGGGGAGAAGAGGG + Intronic
903259943 1:22126213-22126235 CTCCTGGCCTGGAGGCAAGATGG - Intronic
904375935 1:30082554-30082576 CTCAGTGCCTGGAGGGCTGATGG + Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
904795762 1:33055268-33055290 CCTATGGCATGGAGGGGAGATGG + Intronic
904896895 1:33824380-33824402 CTCAGGGACTGGATGGCAGAGGG - Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905788481 1:40776614-40776636 CTCAGGGATTGGAGGGAGGCCGG - Intergenic
905936463 1:41827923-41827945 GGCAGGGAAGGGAGGGAAGAGGG + Intronic
906262543 1:44405472-44405494 TTCAGGACACGGAGGGAAGCAGG - Exonic
906659460 1:47572255-47572277 CCCAGGGGATGGATGGATGATGG - Intergenic
907383559 1:54110830-54110852 ATCAGGGCATGCTGGGCAGAGGG - Intronic
907468324 1:54654219-54654241 CTTAGGGCAGGGAGAGGAGAAGG + Intronic
907645715 1:56241166-56241188 CTCAGGGGACGGAGGCAGGAGGG + Intergenic
908107210 1:60857317-60857339 CTAAGGGCAAGGACTGAAGAGGG - Intergenic
908170256 1:61497412-61497434 CACAGGGCATGAAAGGAAGCTGG + Intergenic
908833514 1:68205523-68205545 CTCAGGGCAGTGCTGGAAGAAGG - Intronic
909074270 1:71034763-71034785 ATCATGGCATGGAGGAAACATGG + Intronic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909732724 1:78914821-78914843 CTCTGCGCTTGGAGGGTAGAAGG + Intronic
909897822 1:81095395-81095417 CTCAGAGAATGGAGGCAGGATGG + Intergenic
910369906 1:86504270-86504292 CGCAGAGGCTGGAGGGAAGAAGG - Intergenic
911651271 1:100391675-100391697 CTAAGGACCTTGAGGGAAGAGGG + Intronic
912692990 1:111818679-111818701 CCCAGGGCATGGAGCAAAGAAGG - Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913186486 1:116373956-116373978 CTCAGGGCACGGAGGGCGGAGGG - Exonic
913432014 1:118805635-118805657 ATCAAGGAATGGAGTGAAGAAGG - Intergenic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
914703029 1:150150633-150150655 CGCAGGGCCTGGAGGGAACCTGG + Intronic
914814747 1:151055217-151055239 CTAAGGGCCTGGTGGGAAGAGGG + Intronic
915603668 1:156937908-156937930 ATCGTGGCATGGATGGAAGAGGG - Intronic
915731642 1:158058402-158058424 GGCAGGGCAGGGAGGGAGGAGGG - Intronic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
916887626 1:169085693-169085715 CTCAAGGCCAGGAGGTAAGAGGG + Intergenic
917132655 1:171758412-171758434 ACCAGGGCATGGAGGGAAAATGG + Intergenic
917563690 1:176188004-176188026 CTGATCTCATGGAGGGAAGAGGG - Intronic
917766680 1:178227321-178227343 CACAGGGCTTACAGGGAAGATGG - Intronic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
920188512 1:204177528-204177550 AGCAGGGCCTGAAGGGAAGAGGG + Intergenic
920203963 1:204277944-204277966 CTCAAGGCTTGCAAGGAAGAGGG + Intronic
921245006 1:213229029-213229051 TTCAGAGCATGCATGGAAGATGG + Intronic
921366981 1:214383523-214383545 CTCTGGCCATGGCGGGAGGAAGG + Exonic
921422635 1:214966141-214966163 CTTAGGGGTTGGAGGGAAGGTGG + Intergenic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922075200 1:222236737-222236759 TTCAGGCCATGGTGGGAAGTGGG - Intergenic
922889064 1:229046553-229046575 CGCAGGGCGTGGAAGGAAGAGGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922978619 1:229805764-229805786 CTAAGTGCTTGGAGGGAGGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923552780 1:234977511-234977533 CTGAGGACATGGGGTGAAGATGG - Intergenic
924202157 1:241671757-241671779 CTCCCACCATGGAGGGAAGAAGG - Intronic
1062771174 10:102705-102727 TTCAGGCCGTGGAGGGAAGTGGG + Intergenic
1062974364 10:1672583-1672605 CGCGGGGCTTGGAGGGAGGAAGG - Intronic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1063503083 10:6572134-6572156 CTCAGGGGCTAGAAGGAAGAGGG - Intronic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1065795593 10:29304765-29304787 CTCAGGGCTGGGAGGCAGGAGGG + Intronic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067060121 10:43073982-43074004 CACAGGGAAGGGAGGGAGGAGGG - Intergenic
1067259215 10:44672988-44673010 CTCAGGGAATGGCGAGATGATGG + Intergenic
1067270516 10:44787815-44787837 CTCTGGGCATGGAGGAAGGTAGG - Intergenic
1067346075 10:45440057-45440079 AGCAGGGCAAGGAGGGAAGAGGG + Intronic
1067356434 10:45532550-45532572 CACATGGCATAGAGGGAGGAAGG - Intronic
1067474918 10:46558533-46558555 GCCAGGGCATGAATGGAAGAAGG - Intergenic
1067702575 10:48584340-48584362 GCCAGGGTATGGATGGAAGAGGG - Intronic
1069629816 10:69890595-69890617 GCCAGGGCATGGAGGGAGGCAGG + Intronic
1069675314 10:70242426-70242448 GTCAGGGCCTGGAAGGAAGGAGG + Intergenic
1070312263 10:75282348-75282370 TTCAGTCCAGGGAGGGAAGAGGG - Intergenic
1070795835 10:79215775-79215797 CCCAGGGCATGGAAGGGAGATGG + Intronic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1072805070 10:98418948-98418970 CTGAGGGCACGGAGGAAAGCTGG + Intronic
1072809024 10:98445505-98445527 CTCAGGGCCTGGAGAGACCAGGG - Intronic
1073008696 10:100343546-100343568 CCCAGGGCTTGGAAGGAGGATGG - Intergenic
1073998489 10:109342898-109342920 GTCAGGGCATAGAGGGCAAAAGG + Intergenic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1075072326 10:119327371-119327393 CCCAGGGCACAGAGGGGAGAAGG - Intronic
1075211298 10:120493567-120493589 CCCAGGGCATGGAAGGCAGCGGG - Intronic
1075729384 10:124627279-124627301 CCCGGGGCATGGAGGGCACAGGG - Intronic
1076164255 10:128268979-128269001 CCCAGGCCATGGAGGCAAGGGGG + Intergenic
1076202183 10:128567631-128567653 CTCAGGGCCTGGAGGCAGCATGG - Intergenic
1076216306 10:128696271-128696293 CTGAGGGCATGGAGGGCTGTGGG - Intergenic
1076578629 10:131491400-131491422 CTCAGGGCATGGAGGATGCAAGG + Intergenic
1076793999 10:132790050-132790072 CTCAGGACATGGATGGATGCAGG + Intergenic
1077047297 11:552204-552226 CTCAGGGCCTGGAGGGAACATGG + Exonic
1077763855 11:5135516-5135538 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1078577401 11:12513768-12513790 CTCAGGGCGTGTAAGGAACAAGG - Intronic
1078630383 11:12998019-12998041 ATCAGGGGCTGGAGGGAAGGAGG - Intergenic
1079178567 11:18167937-18167959 TTCAGGGGAAGGATGGAAGAGGG + Intronic
1079469027 11:20760552-20760574 TCAAGGGCATGGATGGAAGAAGG + Intronic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1080950470 11:37026483-37026505 TTCAGGTCATGATGGGAAGAGGG + Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081651587 11:44827501-44827523 GCCAGGGCAGGTAGGGAAGATGG + Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083317096 11:61822535-61822557 CTGAGGGCCTGGGAGGAAGAAGG - Intronic
1083344545 11:61980145-61980167 AGCAAGGCATGGAGGGAATAAGG + Intergenic
1083426817 11:62592300-62592322 CTCAGGACAGGGAGGGACTACGG + Intergenic
1083599512 11:63938332-63938354 CTCAGGGTTTAGAGGGGAGACGG - Intergenic
1084208648 11:67610809-67610831 CTAAGGGCATGGGGTGAACAAGG + Intronic
1084889529 11:72229909-72229931 TTCAGGGCCTGGAGGGAACAAGG - Exonic
1084955874 11:72691325-72691347 CCCTGGGCATGGAAGGAAGGAGG - Intronic
1084961060 11:72716970-72716992 CTCAGGTCATGTAGGGGAGACGG - Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085039757 11:73319974-73319996 TCCAGGGCAAGGAGGGAAGGTGG + Intronic
1085125908 11:74002216-74002238 GCAAAGGCATGGAGGGAAGAGGG - Intronic
1085447622 11:76611095-76611117 CTCCGGCCATGGAGAGGAGAGGG + Intergenic
1085699002 11:78729685-78729707 CTCACCGAGTGGAGGGAAGATGG + Intronic
1086124900 11:83340382-83340404 GTGAGGGCAAGGAGTGAAGAGGG - Intergenic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1087903703 11:103671333-103671355 CTCAGGGGATTGTGGGGAGAGGG - Intergenic
1088671969 11:112150556-112150578 CACAGGGAAGGAAGGGAAGACGG - Intronic
1088782099 11:113145760-113145782 CTCAGGGGGTGGAGGAAAGTGGG - Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089536537 11:119163753-119163775 CTCAGGCCCAGGAGAGAAGAGGG - Intergenic
1089623211 11:119734772-119734794 CTCAGGGCCAGGAGGGAACATGG - Intergenic
1089775396 11:120832072-120832094 CTCAAGGCAAGGAGGGGGGAGGG - Intronic
1090175703 11:124647564-124647586 CTCAGGGCATGGATGGAGGGAGG - Intronic
1090890059 11:130915661-130915683 CTCAGGGCATGGAGGACAGGTGG + Exonic
1090955471 11:131509921-131509943 CTCAGGGCATCAAAGCAAGAAGG + Intronic
1091590830 12:1842195-1842217 ATCAGGGCGTGGAGTGCAGAAGG + Intronic
1092203565 12:6602180-6602202 AGCAGGGCAAGGGGGGAAGAGGG + Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092416357 12:8293184-8293206 ATCAGGGCACAGAGGTAAGAGGG + Intergenic
1093084919 12:14856282-14856304 CAAAGGGCAGGGATGGAAGAAGG - Intronic
1093445376 12:19250887-19250909 CGCAGGGCTTGGGGGGAAAATGG + Intronic
1093581927 12:20793078-20793100 CTCAGGCCATGATGGGAAGTGGG + Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094668613 12:32546646-32546668 CATAGAGCATGGAGGGAAGTAGG + Intronic
1095268096 12:40183545-40183567 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1095722151 12:45412559-45412581 ATGAGAGCATGAAGGGAAGAAGG - Intronic
1096532210 12:52249219-52249241 CTCTGGGCATGGGGGGAGGGAGG - Intronic
1097246624 12:57610968-57610990 CCCGGGGCCTGGAGGAAAGAAGG + Intronic
1097926979 12:65139523-65139545 ATCAGAGCATGGTGGGAGGAGGG - Intergenic
1097952191 12:65443863-65443885 GCCAGGGGATGGTGGGAAGATGG - Intronic
1098291696 12:68962648-68962670 CTCAGGCCATGATGGGAAGGGGG + Intronic
1100390089 12:94140408-94140430 CTCAGGGAATGGGGTGAAGTTGG - Intergenic
1100428605 12:94510174-94510196 CTCTGTGCATGGCGTGAAGAAGG + Intergenic
1100435240 12:94565234-94565256 GTCAGGACATGAAGTGAAGAGGG + Intergenic
1101727042 12:107396291-107396313 TTCAGTGCAGGCAGGGAAGAAGG - Intronic
1101776127 12:107795648-107795670 ATCAGAGGTTGGAGGGAAGAGGG + Intergenic
1102033938 12:109760346-109760368 CTCCGGTTATGGAGGAAAGAGGG + Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102444415 12:112990869-112990891 CTCAGGTCATGATGGGAAGGGGG - Intronic
1102534357 12:113569780-113569802 CTGAGGACATGGAGTCAAGAGGG + Intergenic
1102579701 12:113878561-113878583 CTCAGGGCAGGGTGGTAAGGTGG - Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1104755131 12:131264513-131264535 CTCAGAGCCTGAAGGGTAGAGGG - Intergenic
1104914008 12:132255146-132255168 CTCAGGTCCTGATGGGAAGAGGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105272969 13:18894951-18894973 CTCAGGGCATAGAGGACAGGTGG + Intergenic
1106123047 13:26877853-26877875 CTCAGGCCATGATGGGAAGTGGG - Intergenic
1107155811 13:37165978-37166000 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1107821196 13:44287135-44287157 CTCAGGGTATTGAGGGTGGATGG + Intergenic
1107966488 13:45602796-45602818 CTCAGAGCAGGGTGGGAAAATGG - Intronic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1108390964 13:49947290-49947312 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1109622208 13:64925399-64925421 TTCAGGCCATGGAGGGCTGAAGG - Intergenic
1109805090 13:67429263-67429285 TTCAGGCCATGAAGGGAAGAGGG + Intergenic
1110176832 13:72567272-72567294 CACAGTGCATGGTGGGAAGGTGG - Intergenic
1110591928 13:77273156-77273178 CTCAGGGAAAGATGGGAAGAAGG + Intronic
1110758854 13:79207947-79207969 CTCAGGCCCTGCAGGGATGAAGG + Intergenic
1112079561 13:95954347-95954369 CTCAGGCCATGATGGGAAGGGGG + Intronic
1112260574 13:97874367-97874389 CTCAGGGGTTAGAGGCAAGATGG + Intergenic
1112761364 13:102696920-102696942 GGCAGGGCAGGGAGGGAACAGGG + Intergenic
1113264416 13:108601684-108601706 CTCAGGGCAGGGTTGGAAGTTGG - Intronic
1113590335 13:111494392-111494414 GGCAGGGCATGGAGGGATGGAGG + Intergenic
1113670112 13:112170650-112170672 CTCAAGGCATGGCTGGAAAAGGG - Intergenic
1114139587 14:19894988-19895010 CCCAGGTCAAGGAGGGAACAAGG - Intergenic
1114187344 14:20413087-20413109 CACAGGGCAAGGAAGTAAGAGGG + Intronic
1114523509 14:23352997-23353019 CCCAGGGGAGGGAGGGAAGGGGG + Intergenic
1115617779 14:35112657-35112679 TTCAGGGCATGATGGGAAGTGGG + Intronic
1117846005 14:59912641-59912663 CACAGACCACGGAGGGAAGAAGG - Intergenic
1118718923 14:68580092-68580114 CTCAGGGCAGGCAGGTAGGATGG - Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118845224 14:69543071-69543093 CTCAGGACAGGGAGGAAAGCTGG + Intergenic
1119197551 14:72728408-72728430 CCAATGGCATGGAGGGAAGAAGG + Intronic
1119471697 14:74904427-74904449 TTCGGGCCATGGTGGGAAGAGGG - Exonic
1119772005 14:77225879-77225901 CTCAGTGCCTGGAGAGCAGAGGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG + Intronic
1121109103 14:91300310-91300332 ATCAGGGCATGGAGGGACTATGG - Intronic
1122029336 14:98901210-98901232 ATAAGGGCTGGGAGGGAAGAGGG - Intergenic
1122779959 14:104139349-104139371 CTTGGGGCTTGGAGGGAAGCAGG + Intronic
1122981534 14:105194359-105194381 CTTGGGGGATGGAAGGAAGAGGG - Intergenic
1124097702 15:26664410-26664432 GACAGGGCATGGGAGGAAGAGGG + Intronic
1124103292 15:26715055-26715077 CTGAGGGCATGCAGACAAGAGGG + Intronic
1124234027 15:27971169-27971191 CGCATGGCATGGTGGGAAAACGG + Intronic
1125477707 15:40058624-40058646 CTCAGGGGAAGGAGAGGAGAGGG + Intergenic
1125726142 15:41869138-41869160 CTCATTGCATGGAGGAAGGAAGG + Intronic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1126662285 15:51044972-51044994 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1126663352 15:51053585-51053607 CTGAGGGCAAGGTGGGGAGAAGG - Intergenic
1127776890 15:62270645-62270667 CACAGGGCAGGGAGGGAGGTGGG + Intergenic
1127901260 15:63342649-63342671 TTCAGGCCATGATGGGAAGAGGG - Intronic
1127972802 15:63974995-63975017 TTCAGGCCATGGTGGGAAGAGGG - Intronic
1128142184 15:65310039-65310061 CCCCCAGCATGGAGGGAAGAGGG - Intergenic
1128234177 15:66056240-66056262 TTCTGGGCCTGGAGAGAAGAGGG + Intronic
1128518307 15:68358099-68358121 TACAGGTCATGGAGGGAAGATGG - Intronic
1129274350 15:74435243-74435265 CTCAGGACTCTGAGGGAAGAAGG - Intergenic
1129709698 15:77814314-77814336 CTGAGGGCACGGTGGGAAGTGGG - Intronic
1129881057 15:79006151-79006173 CTCCGGGCATGGGAGGAGGAGGG + Intronic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1131379903 15:91954917-91954939 CTCAGGGCACAGAGCCAAGAAGG - Intronic
1132164020 15:99566625-99566647 CCCCGGGCTTGGAGGGAAAAGGG - Intronic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1132977976 16:2719975-2719997 CTCAGGGGCAGGAGGGATGATGG + Intronic
1133000063 16:2845781-2845803 CTCAGGCCATGATGGGAAGAGGG + Intergenic
1133034551 16:3027562-3027584 GTCAGGACCTGGAGGAAAGAGGG - Exonic
1134000237 16:10777161-10777183 CTCAGGGCAGGGGAGGAAAAGGG + Intronic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1134618504 16:15670088-15670110 CTCAGAGCAAGGCGGGGAGATGG - Intronic
1134841561 16:17405828-17405850 CTGAGGGCAGGGAGGGGAAATGG - Intronic
1135323227 16:21510534-21510556 CTCAGGTCATGATGGGAAGAAGG + Intergenic
1135752885 16:25070922-25070944 CTCAGGGCAGGGAGAAGAGAGGG - Intergenic
1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG + Intronic
1136070672 16:27785141-27785163 CCCCGGGAATGGAGGGAAGTGGG - Intergenic
1136284592 16:29233570-29233592 CTCAGAGCAGGAAGGGCAGAGGG + Intergenic
1136334711 16:29603721-29603743 CTCAGGTCATGATGGGAAGAGGG + Intergenic
1137790065 16:51167488-51167510 GTCAGGGCACTGAGGGAACAGGG - Intergenic
1137875271 16:51990708-51990730 CTCAGGAGATGGAGGGTAGGAGG - Intergenic
1137982429 16:53081177-53081199 TACAGGGCATGGAGGCAGGATGG + Intronic
1138029274 16:53547010-53547032 ATCAGTGCATGGAGGGTGGAGGG + Intergenic
1138632312 16:58307673-58307695 CTCAGGCCATGATGGGAAGAGGG + Intronic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139782604 16:69364298-69364320 CTCAGGGAAGGGAGGGAGGGAGG - Intronic
1140142028 16:72267223-72267245 CTCAGGTGAAGGAGGCAAGAAGG - Intergenic
1140802696 16:78503214-78503236 CTGAGAGCATGATGGGAAGATGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142035426 16:87859556-87859578 CTCAGGTCACGATGGGAAGAGGG + Intronic
1142089624 16:88203083-88203105 CTCAGAGCAGGAAGGGCAGAAGG + Intergenic
1142144011 16:88485175-88485197 CTCAGGGCCTGGATGGACGCTGG + Intronic
1142563649 17:825897-825919 CTAAGGGCATGGAGGAGGGAGGG + Intronic
1142623371 17:1178792-1178814 CTCAGGGAAGGGTGGGGAGAAGG + Intronic
1142859408 17:2751824-2751846 CTCATGAAATGGAGGGAATATGG - Intergenic
1142890450 17:2939681-2939703 CTCAGGGCAGGGATGGAGGGGGG + Intronic
1143288715 17:5812210-5812232 TTCAGGCCATGATGGGAAGAGGG + Intronic
1143383724 17:6512399-6512421 CTCAGTGACTGAAGGGAAGAGGG + Intronic
1143822130 17:9573160-9573182 TTCAGGCCATGATGGGAAGAGGG + Intronic
1144044307 17:11441098-11441120 TTGAAGTCATGGAGGGAAGAAGG - Intronic
1144077517 17:11732792-11732814 CACAGGGCATGGAGGGGAACAGG - Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144299930 17:13913705-13913727 CTCAGGCCATGATGGGAAGGGGG + Intergenic
1145242672 17:21248907-21248929 CTCAGGCCCAGGAGGGAGGAGGG - Intronic
1145279674 17:21458173-21458195 CTCAGGGCAGGGAAGAAGGAGGG + Intergenic
1146719376 17:35113073-35113095 GGCAGGGCATGGAGGGTAGGTGG - Intronic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1147056913 17:37841837-37841859 CTCAGTGCATGGGAGGAAGAAGG - Intergenic
1147323143 17:39657947-39657969 CCCAGGGGAGGGAGGGAGGAAGG - Intronic
1148742032 17:49898405-49898427 AGCAGGGCTGGGAGGGAAGAGGG - Intergenic
1148862660 17:50612726-50612748 TTCGGGGCAGGGAGGGAGGAAGG - Intronic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1149432510 17:56605636-56605658 CTGAGGGCGAGGATGGAAGATGG - Intergenic
1151582967 17:74990594-74990616 CCCAGGAGAGGGAGGGAAGAAGG + Intronic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152133316 17:78490292-78490314 CACAGGGCATGGTGGGGAGTGGG - Intronic
1152227658 17:79100062-79100084 ATCAGGGAATGGAGGGAGGTGGG - Intronic
1152524456 17:80879510-80879532 TCCAGGGCAGTGAGGGAAGAAGG - Intronic
1153099700 18:1452245-1452267 CCCAGGGCCTGGAGTGAACATGG + Intergenic
1153982008 18:10318139-10318161 CTCAGGTCATGACAGGAAGAAGG + Intergenic
1155380557 18:25217829-25217851 CACAGGGCATTGAGGGGATAGGG + Intronic
1155507696 18:26548707-26548729 CGCAGGGGATGGAGGGGAGGGGG + Intronic
1155541036 18:26868522-26868544 CTGAGGGCAAGGATGGGAGAAGG - Intergenic
1155550995 18:26964899-26964921 CACAGGGAAAGGAGCGAAGATGG + Intronic
1156133212 18:34003851-34003873 TTCAGGGCATGATGGGAAGTGGG + Intronic
1157182410 18:45509571-45509593 TTCAGGTCATGGAGGGGACAGGG + Intronic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157307554 18:46528278-46528300 TTCAGTGCATGGAGAGGAGAAGG + Intronic
1157310169 18:46546803-46546825 CACAGGGGAGGGAAGGAAGATGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157386221 18:47261492-47261514 CACTGGGCATGGAGGGGTGAAGG - Intergenic
1158434710 18:57427903-57427925 CTCCGGGCTTGCGGGGAAGAAGG - Intergenic
1158799580 18:60890519-60890541 AGCAGGGCAGGGAGGGATGATGG - Intergenic
1158962955 18:62601585-62601607 CACAAAGCATGGAGGGAAAACGG + Intergenic
1159324362 18:66895054-66895076 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1159832425 18:73293718-73293740 CTCATGGCATAGAGAGTAGAAGG + Intergenic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160915601 19:1495112-1495134 CTCAGGGCCTAGAGGCACGATGG + Intronic
1161460635 19:4394900-4394922 CTCATGGCATCGAGGGGATAGGG - Intronic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1162318272 19:9954490-9954512 CTCAGGAGGTGGAGGCAAGAGGG + Intergenic
1162418561 19:10552870-10552892 CTGAGGACCTGGCGGGAAGAGGG - Exonic
1162444313 19:10712894-10712916 GGCAGGGCATGGAGGGGACAGGG + Intronic
1162646663 19:12054985-12055007 CTCAGGGCAGGAGGGGAACAAGG + Intergenic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163648968 19:18506091-18506113 CCCAGGGCTTGGAGGGAGGCTGG - Intronic
1165040189 19:33063596-33063618 CTCAGGACCTAGAGGGAGGAAGG + Intronic
1166012284 19:39951359-39951381 CTAAGGGCAGGGTGGGAAGCAGG - Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166306954 19:41940538-41940560 CTCAGGGCATGGAGGGGAAGGGG + Intergenic
1166993147 19:46705119-46705141 TTCAGGGCCTGGGGGGCAGATGG - Intronic
1167292268 19:48630759-48630781 CACAGGGCAGGAAGGGAACAGGG + Exonic
1167776305 19:51559909-51559931 CTCTGGACATGGTGAGAAGATGG - Intergenic
1167944042 19:52973162-52973184 GTCAGGACATGGCAGGAAGATGG + Intergenic
1167977055 19:53236285-53236307 CTCAAGGAATGGATGTAAGATGG - Exonic
1167980899 19:53274089-53274111 GTCATGGCTTGGAGGGAAGAGGG + Intergenic
1167985497 19:53311242-53311264 GTCACGGCTTAGAGGGAAGAGGG - Intergenic
1167993256 19:53378679-53378701 GTCAGGACATGGCAGGAAGATGG - Intronic
1168113819 19:54209683-54209705 CACAGAGCCTGGAGGGCAGATGG + Intronic
1168156239 19:54474269-54474291 CGCAGGGGATGGAGTGAAGCAGG + Intergenic
925120769 2:1416010-1416032 CTTGGGGCATGGATGGAAGCTGG - Intronic
925132217 2:1502066-1502088 CCCAGGGGATGGAGAGAAAATGG + Intronic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925472774 2:4180718-4180740 CTGAGGGCATCCAGTGAAGAAGG - Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926148572 2:10411828-10411850 CTCAGGGCAAGGAGGTAGGCTGG + Intronic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
927025782 2:19067681-19067703 TTCTGAGCCTGGAGGGAAGAGGG + Intergenic
927512105 2:23650195-23650217 CTCAGGGGCTGGAGAAAAGAGGG + Intronic
927711281 2:25327946-25327968 CAAAGGGCCTGGAGGGAATAGGG - Intronic
927757013 2:25716844-25716866 CTCCTGACATGGAGGAAAGAAGG - Intergenic
929133702 2:38602890-38602912 CTCCGGGCAGGGAGCGGAGACGG - Exonic
929779570 2:44949191-44949213 CTAGGGGCAGGGACGGAAGAGGG - Intergenic
931248559 2:60510831-60510853 CTCAGGGCCTGTGGGGAAAATGG - Intronic
931905407 2:66837452-66837474 GTCAGGGAATGCAGGGAAGTGGG - Intergenic
932220174 2:69993168-69993190 CTCAGGCCACGTAGCGAAGAGGG + Intergenic
932476763 2:72011293-72011315 GTCAGAGCTTGGAGGAAAGAAGG - Intergenic
932702441 2:74001120-74001142 CACAGGGCAGGGAGGGAGGCAGG - Intronic
932841839 2:75090334-75090356 TTCAGGCCATGAAGGGAAGTGGG + Intronic
933420961 2:82044144-82044166 CTCTAGGCATTGTGGGAAGAGGG - Intergenic
933707671 2:85304023-85304045 CTCAGCGCAAGGAGGGAGCAGGG - Intronic
934133269 2:88970164-88970186 CTCAGGCCCTGGAGTGAGGAGGG - Intergenic
934136027 2:88997346-88997368 CTCAGGTCCTGGAGTGAGGAGGG - Intergenic
934163334 2:89272617-89272639 CTCAGGGCACGCAGGGAGGGTGG + Intergenic
934234293 2:90216426-90216448 CTCAGGCCCTGGAGTGAGGAGGG + Intergenic
934851208 2:97702368-97702390 CAAGGGGCATGGAGGGAAAATGG - Intergenic
934881364 2:97983352-97983374 TTCAGGCCATGATGGGAAGAGGG - Intronic
935424204 2:102902915-102902937 CCCAGGGCATTGTGGGAAGTCGG + Intergenic
937026710 2:118704749-118704771 CTCAGAGCATTGTAGGAAGAAGG - Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937850088 2:126624246-126624268 CTCAGGCCATGATGGGAAGTGGG - Intergenic
938749244 2:134312994-134313016 CTCAGAGCAAGGAAGGAAAAAGG - Intronic
939811442 2:146837845-146837867 CAAAGAGCATGGAGGCAAGAAGG - Intergenic
940533525 2:154908785-154908807 GTCAGGTCATGGAGGGAGTATGG - Intergenic
941238790 2:163011501-163011523 GTCAGGGCATGGGGGGAAAGGGG - Intergenic
941867239 2:170347906-170347928 GTCAGGGGCTGGAGGGGAGAAGG - Intronic
942335431 2:174879912-174879934 CACAGGGCATGAAGGGAAGATGG + Intronic
942342582 2:174963600-174963622 CTCAGGCCCTGGAGGGAACCTGG + Intronic
942409758 2:175696488-175696510 CTAAGAGAATGGAGGAAAGAAGG + Intergenic
944211086 2:197207196-197207218 ATCATGGCATGGAGGGAAGGGGG + Intronic
944659728 2:201911384-201911406 TTCAGGCCATGAAGGGAAGCAGG - Intergenic
945406143 2:209451396-209451418 AGCAGGGCATGGAGGGAAGGGGG - Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946372973 2:219291629-219291651 CCCGGGGCAGAGAGGGAAGATGG + Intronic
947489172 2:230579084-230579106 CTCATGGTGTGGAGGGAGGAAGG - Intergenic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948654338 2:239467125-239467147 GTCAGGGCGTGGGGGGAAGCTGG + Intergenic
948876356 2:240831847-240831869 GTCAGGGCCTGGAGGGGAGCTGG + Intergenic
1169132352 20:3172897-3172919 CTTAGGCCACCGAGGGAAGACGG - Intronic
1169494385 20:6100431-6100453 CTCAGGGCTGGGAGGGTAGGAGG + Intronic
1169514944 20:6305720-6305742 ATCAAGTCATGGAAGGAAGAGGG + Intergenic
1170431450 20:16280356-16280378 ACCAGGGGATGGAGGGAAGGAGG + Intronic
1170823766 20:19776162-19776184 CTCAGGCCATGATGGGAAGTGGG + Intergenic
1170936675 20:20816228-20816250 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1170937618 20:20823697-20823719 GTCAGGGCCTGGAAGGAGGAAGG - Intergenic
1170939381 20:20835713-20835735 CACATGGCGAGGAGGGAAGAGGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171877767 20:30594272-30594294 CTCAGGCGCTGGAGGGAGGACGG - Intergenic
1171957738 20:31472862-31472884 CTCAGGTCCTGGAGGACAGAGGG - Intronic
1172299999 20:33842710-33842732 TACAGGGCTGGGAGGGAAGAGGG - Intronic
1172321250 20:33996789-33996811 TTCAGGGGCTGGAGGGAGGAGGG - Intronic
1172611282 20:36254501-36254523 GCCAGGGCCTGGAGGGAAGAGGG + Intronic
1173614661 20:44394903-44394925 CTAAGGACAGGGAGGGAGGAAGG + Intronic
1173727086 20:45305609-45305631 GTCAGAGCCTGGAGGGAGGAAGG + Intronic
1173904177 20:46613793-46613815 CTCAGGGCAGAGGGGGAAGGAGG + Intronic
1174145222 20:48448537-48448559 CCCAGCCCATGGTGGGAAGAGGG + Intergenic
1174362488 20:50037736-50037758 CTCAGGGCTCGGAGGGAAGGGGG - Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175220258 20:57412577-57412599 CTCAATGCATGCAGGGAAGAAGG - Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG + Intergenic
1176838306 21:13815605-13815627 CTCAGTGCATGGGGGGTAGTAGG + Intergenic
1176984534 21:15420785-15420807 CTCAGGTCACTGAGGGAGGATGG + Intergenic
1177541541 21:22499470-22499492 GTCAGGGCATGGAGGAAAAGGGG + Intergenic
1178897389 21:36570395-36570417 TTCAGGTCATGATGGGAAGAGGG - Intronic
1179182402 21:39057139-39057161 CTAAGGGCATGGGGGCAGGAGGG - Intergenic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1180099687 21:45578841-45578863 GTCAGGGCAGGGAGGGACCAGGG - Intergenic
1180120965 21:45747819-45747841 CTCAGAGGAGGGAGGAAAGAAGG - Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181080052 22:20407942-20407964 CCCAGTGCATTCAGGGAAGATGG + Exonic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181592309 22:23893049-23893071 TTCAGGGAATGGAGAGAAGTGGG + Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182411351 22:30189636-30189658 CTCAGGGCAAGGAGGGAGCAAGG - Intergenic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1182736867 22:32537089-32537111 CACAGGGCATGCAGGCAAGAAGG + Intronic
1183136023 22:35888625-35888647 CTCATGGCAGAAAGGGAAGAGGG + Intronic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183370970 22:37432186-37432208 GTCAGGGCATGCAAGGATGAAGG + Intergenic
1183372858 22:37444796-37444818 CACAGGGCCTGGAGGCATGAAGG + Intergenic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183540850 22:38428514-38428536 CTCAGGGCAAGCAGGACAGAGGG - Intronic
1183670202 22:39268420-39268442 CACAAGGCATGATGGGAAGAAGG + Intergenic
1183706258 22:39476493-39476515 CTCTGGCCATCCAGGGAAGATGG + Intronic
1184205269 22:42998382-42998404 GTCAGGGCATGTTGGGGAGATGG - Intronic
1184866540 22:47204718-47204740 CTCAGGGCCTGGAAGGATGCTGG + Intergenic
1185088448 22:48753121-48753143 CTCAGTGCATGGGGAGCAGAGGG - Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949344892 3:3067662-3067684 CACAGGGCAAGAAGGGAGGAAGG + Intronic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950172860 3:10851596-10851618 AGCAGGGCCTGGAGGGAAGAAGG - Intronic
950193478 3:10993272-10993294 CCCAGGGCATGGAGGGGACGCGG + Intronic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
950537451 3:13587609-13587631 TTCAGGCCATGAAGGGAAGTGGG + Intronic
950654059 3:14425709-14425731 CTCGGGGCAGGGAGGGTGGAAGG + Intronic
951982514 3:28581278-28581300 CTCAGGTCTTGGTGGGCAGAAGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952673100 3:35994469-35994491 CTCAGGGCCTTGAGTGAACATGG + Intergenic
952868667 3:37877261-37877283 GTCAGGGCAAGGAGGGAATGGGG - Intronic
953320009 3:41962928-41962950 CTCAGGCAATGATGGGAAGATGG + Intergenic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
953545295 3:43859912-43859934 CCCAGGGCAGGGAGGGAGAAGGG + Intergenic
953636618 3:44670161-44670183 CTGAGGGCAGGTGGGGAAGAGGG + Intergenic
954149809 3:48651753-48651775 CGCAGAGCATGGAAGGAAGCAGG + Intronic
954448380 3:50558752-50558774 TTCAGGGACTGCAGGGAAGAGGG - Exonic
955913126 3:63878842-63878864 CCCAGAGCAGGGAGGGAACAAGG + Intronic
956716067 3:72081161-72081183 TTCAGGCCATGATGGGAAGAGGG - Intergenic
956786408 3:72646285-72646307 CTCAGGGAAGGGAGATAAGAAGG + Intergenic
957305232 3:78449283-78449305 TTCAGGCCATGGTGGGAAGTGGG + Intergenic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
960363418 3:116742013-116742035 CTCAATGCATGCAGGAAAGAGGG + Intronic
960844475 3:121993662-121993684 CCCAGGGCCTGGAGGGAATTGGG + Exonic
961088377 3:124089731-124089753 GTCAGGGCAGTGAGGGAGGATGG + Intronic
961265048 3:125634914-125634936 CGCAGGGCTTGGTGGGGAGAAGG + Intergenic
961787776 3:129357917-129357939 CCCAGGGCAGGGAGGGGACAGGG + Intergenic
961957437 3:130818520-130818542 TTCAGGCCATGATGGGAAGAGGG + Intergenic
962182838 3:133226607-133226629 CTCAGGCCATGATGGGAAGTGGG - Intronic
962240008 3:133744291-133744313 CGCAGGGCATGGAAAGAAGATGG - Intergenic
963066106 3:141265873-141265895 CTCAGAGCAGGAAGGGAAGTGGG + Intronic
964205881 3:154174506-154174528 AGCAGGGGTTGGAGGGAAGAAGG + Intronic
964421671 3:156510438-156510460 CTCGGGGCTGGGAAGGAAGAGGG - Intronic
965853644 3:173062285-173062307 CACAAGGCAAGGAGGGAAGAAGG - Intronic
965954021 3:174346282-174346304 CTCAGGGCTTTAAGGGAATAGGG - Intergenic
966049896 3:175603475-175603497 GTCAGGGCCTGGAGGGAGAAGGG - Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966883624 3:184362785-184362807 AGCAGGGCCTGGGGGGAAGAGGG + Intronic
967334014 3:188322340-188322362 ACCAGGGCATGCAGTGAAGAAGG - Intronic
967521573 3:190438809-190438831 CACAGGGCATAGAGGGAAACAGG - Intronic
967806521 3:193719069-193719091 ATCAGGGGTTGGAGGGAAGGAGG + Intergenic
967862455 3:194162148-194162170 CTCAGAGCACTGAAGGAAGAGGG + Intergenic
968177211 3:196561357-196561379 CTCACGGCTTGGGGTGAAGATGG - Exonic
969192536 4:5533750-5533772 AACAGGGCATGGGGGAAAGAGGG + Intergenic
969198971 4:5586477-5586499 TTCAGGCCATGAAGGGAAGGGGG + Intronic
969566262 4:7980189-7980211 TTCAGGCCATGAAGGGAAGAGGG + Intronic
969643453 4:8412798-8412820 CGCAGGGCAGCGAGGGAGGATGG - Intronic
970739629 4:19220257-19220279 CTAATGGAATGGAAGGAAGAAGG + Intergenic
971028747 4:22613786-22613808 CACAGGGAAAGGAGGGAATATGG + Intergenic
971076374 4:23153755-23153777 TTCAGGCCATGAAGGGAAGGTGG + Intergenic
971156368 4:24087573-24087595 ATGAGGACTTGGAGGGAAGATGG - Intergenic
971302952 4:25456846-25456868 CTCATGGCATGTAGGGAGTAAGG - Intergenic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
971553540 4:27982481-27982503 CACAGGGCAAGTAGTGAAGAAGG + Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973730282 4:53816354-53816376 CACAGGGGATTGAGGCAAGAGGG - Intronic
973737704 4:53888798-53888820 GCCAGGGGATGGAGGGCAGAGGG + Intronic
973771817 4:54213715-54213737 CTAAGGCCCTGGAGGCAAGAAGG + Intronic
974825051 4:67117447-67117469 GTCAGGGGGTGGAGGGAAAAGGG + Intergenic
975991648 4:80264923-80264945 CTCAGGGCATTGCCTGAAGAAGG + Intergenic
976098863 4:81539122-81539144 CTGAGGCCTTGGAGGCAAGAAGG - Intronic
976744654 4:88391155-88391177 CTCAGAGCCTGTAGGGAAGAAGG - Intronic
977152295 4:93527873-93527895 CTAAGGCCTTGGGGGGAAGAGGG - Intronic
977241864 4:94581119-94581141 CCCAGGGCATGGGGGAAAGTGGG + Intronic
977726531 4:100302782-100302804 TCCAGAGCATGGAGGGAAGGCGG - Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
979319318 4:119303867-119303889 GTTAGAGCATGGAGGGAACATGG - Intronic
979754739 4:124326559-124326581 CTCAGAGCATGGAGGGGCAAGGG + Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
980370594 4:131864469-131864491 CTTGGGGCATGGAGGGAAAGGGG + Intergenic
980480264 4:133378702-133378724 CTCAGGCCATGATGGGAAGTGGG - Intergenic
980988630 4:139719017-139719039 CACAGGGCATGCTGGGCAGAGGG + Exonic
981117928 4:141013972-141013994 CTCAGGGGAGGGAGGGAATGGGG - Intronic
981524732 4:145698677-145698699 TTCAGGGCATGATGGGAAGTGGG - Intronic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
983649004 4:170020285-170020307 CTCAGGGCAGGGAAGGAAAGGGG - Intronic
983831963 4:172338951-172338973 GTCCAGGCATGGAGGGGAGAGGG + Intronic
984937645 4:184903242-184903264 CTCAGCGCAAGGAGGCAAGGTGG + Intergenic
985406502 4:189643817-189643839 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986462808 5:7990493-7990515 CTCAGGGCTGGCAGGGAGGAAGG - Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986707572 5:10464151-10464173 CTCAGCCCATGGTGGGCAGAGGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987285447 5:16451602-16451624 CTCAGGGCAAGGAGGAAACTTGG + Exonic
987719745 5:21618025-21618047 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
987720726 5:21628745-21628767 TTCAGGCCATGAAGGGAAGCGGG + Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
989679211 5:44009282-44009304 CTCAGGGGAAGTAGGGGAGAGGG - Intergenic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
991609508 5:68435865-68435887 CTCAGGGCATTGGGGAAATAGGG - Intergenic
991638891 5:68733873-68733895 CTCAGGTCATGGAGGAGAAATGG - Intergenic
992193023 5:74312668-74312690 CTCAGGCCATGATGGGAAGAGGG + Intergenic
992409926 5:76495420-76495442 CTCAGTTCCTGGAGGGCAGAGGG + Intronic
992453454 5:76894020-76894042 TTCAGGTCATGAAGGGAAGTGGG + Intronic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
992541868 5:77774042-77774064 TTCAGGCCATGATGGGAAGAGGG + Intronic
993086800 5:83373131-83373153 CTCAGGGCATGGCAAGCAGAAGG - Intergenic
993132264 5:83913502-83913524 CACAGAGCATAGAGGTAAGATGG - Intergenic
996690336 5:126333581-126333603 AAAAGGCCATGGAGGGAAGATGG + Intergenic
996858958 5:128042926-128042948 GCCAGGGCAGGGAGGAAAGAAGG + Intergenic
996959077 5:129222461-129222483 CTCAGGGCAGGGCGGGGAGGGGG - Intergenic
997217200 5:132122665-132122687 CTCAGGGCCTGTCGGGAAGTTGG + Intergenic
997871443 5:137508996-137509018 CTCAAGGCATGAAGTGAAAAGGG + Intronic
999311985 5:150557540-150557562 CTGAGGGCCTGGGAGGAAGATGG - Exonic
999318071 5:150596823-150596845 GTCAGGGCAAGGAGGCTAGAAGG + Intergenic
999591141 5:153148055-153148077 GCCAGGGCATGGAGCAAAGAGGG - Intergenic
999672981 5:153973917-153973939 ATGAGGACATGGAAGGAAGAGGG - Intergenic
1000026197 5:157361323-157361345 CTCTGGGCCTGCAGGTAAGAGGG + Intronic
1000895406 5:166849055-166849077 CTCAAGGAATGGAGGAGAGAAGG + Intergenic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1002027005 5:176402576-176402598 CTCATGGCAGGGAGGGAAGGGGG - Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1002984277 6:2173442-2173464 TACAGGGCATGGAGGGAAGGAGG + Intronic
1003075239 6:2977939-2977961 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003674809 6:8193206-8193228 CTCAGGCCATGATGGGAAGATGG + Intergenic
1003731755 6:8832406-8832428 GTCAGGGATTGGAGGAAAGAAGG - Intergenic
1004180819 6:13379117-13379139 CCCAGGGAGTGGTGGGAAGATGG + Intronic
1004734102 6:18387500-18387522 CGCAGAGCACGGAGGAAAGACGG + Exonic
1005227314 6:23657627-23657649 CTCCGGGCTTGGAGGGACCAAGG - Intergenic
1005449236 6:25956904-25956926 CTCAGGCCATTAAGGGAAGTGGG - Intergenic
1005463898 6:26093272-26093294 CCCAGGGCACAGTGGGAAGAGGG + Intronic
1005997990 6:30943087-30943109 GCCAGGGCAGGAAGGGAAGAGGG + Intronic
1006884600 6:37370620-37370642 CTCAGGGCTTGGTGGGCAGAGGG - Intronic
1007500149 6:42290663-42290685 CTCACAGCAAGGAGAGAAGAAGG + Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007610795 6:43147533-43147555 CTCAGGGCAGGGTAGGCAGAAGG + Intronic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1008029201 6:46674087-46674109 CTCAGGGTCAGGAGGGATGAGGG + Intronic
1008291686 6:49723552-49723574 ATCAGGCCATGGTGGGAAGTGGG + Intergenic
1008858552 6:56121170-56121192 CTCATGGCATAGAGGGTAGAAGG + Intronic
1010767054 6:79787858-79787880 CTCAGGACATTGGGGGATGAAGG - Intergenic
1012045347 6:94265355-94265377 CCCAGGACATGCAGGGAATATGG + Intergenic
1012201491 6:96411701-96411723 CACAGATCAGGGAGGGAAGAAGG - Intergenic
1012579223 6:100844751-100844773 CTCAAGGTAGGGAGGGAAAAGGG + Intronic
1012815255 6:104016074-104016096 CTCTGTGCATGAAGGGAATATGG - Intergenic
1012890709 6:104894059-104894081 TTCAGGCCATGGAGCAAAGAGGG - Intergenic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1013607340 6:111762414-111762436 TTCAGGCCATGAAGGGAAGGTGG + Intronic
1013718694 6:112995738-112995760 GTCAGGGACTGGAGGGAGGAAGG - Intergenic
1013747858 6:113367017-113367039 GTAAGTGCAAGGAGGGAAGAAGG - Intergenic
1014171968 6:118288714-118288736 TTCAGGGCATGATGGGAAGGGGG - Intronic
1014340306 6:120197363-120197385 CTAAGGGCTTGGAGGAATGAGGG + Intergenic
1014774116 6:125488828-125488850 CTCAGGCCATGCAAGGGAGAGGG + Intergenic
1015142463 6:129950436-129950458 CACAGGCTTTGGAGGGAAGAGGG + Intergenic
1015710154 6:136130403-136130425 CACATGGCATAGAGGCAAGATGG - Intronic
1015975077 6:138782075-138782097 CTCAAGGGTAGGAGGGAAGAAGG - Intronic
1016028553 6:139313880-139313902 CTCAGGCCATGATGGAAAGAGGG + Intergenic
1016295109 6:142565509-142565531 CTCAGGCCATGATGGGAAGTAGG - Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1016706914 6:147119470-147119492 GCCAGGGGCTGGAGGGAAGAGGG + Intergenic
1016761944 6:147747356-147747378 TTCAGGGCATGAAGGCAACAAGG + Intergenic
1017311369 6:152982084-152982106 CTCAGGGCCTGGAGTGGAAAGGG - Intronic
1017645854 6:156539300-156539322 CTCAGGGCAAGGCGTGGAGAGGG - Intergenic
1018050803 6:160006161-160006183 CACAGGGCATGCAGGGTACAGGG - Intronic
1018423479 6:163660458-163660480 CACAGGGCATTGAGTGAAGGTGG - Intergenic
1018523306 6:164677911-164677933 CACAGGGCATGAAGAGAATATGG + Intergenic
1018683607 6:166284629-166284651 GTCAGGGCGTGGATTGAAGATGG - Intergenic
1018857239 6:167683475-167683497 CACAGGGGATGGAGGGATGGGGG + Intergenic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019323127 7:424605-424627 CTCGGGGCTGGGAGGGGAGAAGG + Intergenic
1019485216 7:1286129-1286151 CTCAGGGTATGACGGGCAGAGGG + Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020138000 7:5597127-5597149 CTTCGGCCAAGGAGGGAAGATGG + Intronic
1020198144 7:6058650-6058672 CCCAGGGCATGGGGGCAAGACGG + Intronic
1020885703 7:13816848-13816870 ATCAGGGGAAGGAGAGAAGAGGG - Intergenic
1021360023 7:19701369-19701391 TACAGGGAACGGAGGGAAGAAGG + Intronic
1021848712 7:24787257-24787279 CACAGGGGAAGGAGGGAACATGG + Intergenic
1022005807 7:26264646-26264668 TTCAGGCCATGAAGGGAAGTGGG - Intergenic
1023192585 7:37598670-37598692 CTCAGGGCAAGGTGGTAAAATGG - Intergenic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1023599784 7:41870360-41870382 CTCAGGACACGGAGAGATGATGG + Intergenic
1023773453 7:43582080-43582102 CTCAGGCCATGGTGGTAAGGTGG + Intergenic
1024517576 7:50272412-50272434 CACAGGGCATGGCAGGAAGGGGG - Intergenic
1026247430 7:68633706-68633728 TTCAGGCCATGGTGGGAAAAGGG - Intergenic
1027230192 7:76267879-76267901 GCCAGGGCTTGGTGGGAAGAGGG - Intronic
1027519671 7:79189782-79189804 GTCAGGGGTGGGAGGGAAGAAGG - Intronic
1028368999 7:90069675-90069697 TTCAGAGCATGGTGGGAAGCAGG - Intergenic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1029379691 7:100204944-100204966 CTCAGGCCTGGGAGGGAAGTGGG + Intronic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029730406 7:102434494-102434516 CTCAGGGCAGTGAGGGCTGAGGG - Intronic
1030064884 7:105651993-105652015 CCCAGGGCATGGAGCTCAGAAGG + Intronic
1030124916 7:106144516-106144538 ATCAGGGCTTGTAGGGTAGATGG - Intergenic
1031227147 7:119053978-119054000 TTCAGGCCATGAAGGGAAGTGGG - Intergenic
1032612090 7:133425621-133425643 CTCAGGTCATGACGGGAACATGG + Intronic
1032674257 7:134113841-134113863 TTCAGGCCATGATGGGAAGAGGG + Intergenic
1033586816 7:142780388-142780410 CTCAGGAGATGCAGGGAGGAAGG - Intergenic
1033983373 7:147193568-147193590 CACAGAGCATTGAGGGAACATGG + Intronic
1034277154 7:149828991-149829013 CTCCGGGTATGGAGGGAACCTGG + Intergenic
1034295891 7:149972161-149972183 CTCAGGGAAGGGCGGGAGGATGG - Intergenic
1034410906 7:150941689-150941711 CACATGGCAGGGAGGGGAGAGGG + Intergenic
1034675544 7:152890374-152890396 CTCAGGGCCTGGTGGGAGGGTGG + Intergenic
1034801476 7:154058748-154058770 CTCAGAGCCGGGGGGGAAGAGGG - Intronic
1034802430 7:154062286-154062308 CTCAGAGCCGGGGGGGAAGAGGG - Intronic
1034810162 7:154124741-154124763 CTCAGGGAAGGGCGGGAGGATGG + Intronic
1034819394 7:154202771-154202793 CTCAAGGCATGGAAGGAAGGAGG - Intronic
1035095761 7:156353686-156353708 CGCAAGGAATGGAGGGAACAGGG - Intergenic
1035371994 7:158385973-158385995 CTCAGGGCATGGGAGGAGGGAGG - Intronic
1035372084 7:158386244-158386266 CTCAGGGCATGGGAGGAGGGAGG - Intronic
1035435039 7:158853299-158853321 TTCAGGACATGATGGGAAGAGGG + Intergenic
1035663401 8:1363679-1363701 GTCAGGACATGGAGAGAAGCTGG + Intergenic
1035673707 8:1439701-1439723 CCTAGGGGATGGCGGGAAGAAGG - Intergenic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036544816 8:9757482-9757504 GTCAGGGGAAGGAGGGAAGTGGG - Intronic
1036636652 8:10555211-10555233 TTCGGGGCATGATGGGAAGAGGG + Intergenic
1037018621 8:13940454-13940476 TTAAAGGCATGGAGGGAAGGGGG + Intergenic
1037776502 8:21839037-21839059 CCCAGAGCAAGGAGGGAGGATGG + Intergenic
1037818442 8:22124159-22124181 CCTAGGGCTTGGAGGGAAGGAGG - Intronic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1038506756 8:28091339-28091361 CTCAGGCCATGATGGGAAGTGGG - Intronic
1038986148 8:32812625-32812647 CCCAGGGAATGGAGGTAGGAAGG - Intergenic
1039456711 8:37712084-37712106 CTCAAGGCATGTGGGGACGAGGG - Intergenic
1039685298 8:39795282-39795304 TTCAGGCCATGATGGGAAGAGGG + Intronic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1040547043 8:48406855-48406877 CTGAGGTCAGCGAGGGAAGATGG + Intergenic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042199880 8:66271112-66271134 TTCAGGCCATGATGGGAAGAGGG - Intergenic
1043002800 8:74780085-74780107 TTCAGGCCATGATGGGAAGAAGG + Intronic
1043537956 8:81226749-81226771 CTCCAGGCAAGGAAGGAAGATGG - Intergenic
1044211969 8:89561113-89561135 TTCAGGCCATGATGGGAAGAAGG - Intergenic
1044522039 8:93209867-93209889 CCCAGGGCATGGTGGAAACATGG + Intergenic
1044592873 8:93930922-93930944 CCCACAGCATGGAGGGAATAAGG - Intergenic
1045377592 8:101590615-101590637 CTCGGGGCTTGGTGGGAAGAGGG + Intronic
1046007771 8:108506427-108506449 CTCAGGGGGTGGAGCCAAGATGG - Intergenic
1046470639 8:114669380-114669402 CTCAGGTCATAATGGGAAGATGG + Intergenic
1046997789 8:120543591-120543613 CTCAGGACAAGGAGGGATGTGGG + Intronic
1047941209 8:129829210-129829232 CTCAGGGGAAGGAGGGAGCAGGG - Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048258306 8:132923090-132923112 TTCAGGGCATGGAATGAAGCAGG + Intronic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048471011 8:134704133-134704155 CTCAGGTAATGCAGGGAAAAGGG - Intronic
1048544375 8:135372683-135372705 GTGAGGACATGGGGGGAAGATGG + Intergenic
1048726879 8:137396274-137396296 GTCAGGGGATGGTTGGAAGAAGG - Intergenic
1048787111 8:138062358-138062380 CGGAGGGCATGGCCGGAAGAAGG + Intergenic
1049345388 8:142135985-142136007 TTCAGGACAAGGAGGGAACAGGG - Intergenic
1049398843 8:142415815-142415837 GTCAAGGCATGGATGGAAGCTGG - Intergenic
1049495059 8:142926160-142926182 TTCAGAGCATGGACTGAAGAAGG - Intergenic
1049592037 8:143466961-143466983 CTAAGGCCAAGGAGGGAAGAAGG + Intronic
1051431284 9:16983451-16983473 CACAGGGCATTAAGGTAAGAAGG + Intergenic
1052053646 9:23879486-23879508 GTCAGGGAAAGGAGGGAATAGGG - Intergenic
1052067517 9:24040566-24040588 CACAGAGCAAAGAGGGAAGATGG - Intergenic
1052635025 9:31092239-31092261 TTCAGAGAATGGAGGGTAGAAGG - Intergenic
1053003680 9:34591093-34591115 CCCAGGCCGTGGCGGGAAGAAGG - Intergenic
1054779971 9:69157064-69157086 TTCAGGCCATGAAGGGAAGTGGG - Intronic
1056844981 9:90029838-90029860 CACAGGGCATGGATGTGAGAGGG + Intergenic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1057841242 9:98487014-98487036 CTCAAGGAAGGGAGCGAAGAGGG + Intronic
1057898618 9:98930210-98930232 CTCAGGGCCTGGAGTGATGGGGG + Intergenic
1059263230 9:112999721-112999743 CACAGGGCAAGGTGGGCAGAAGG + Intergenic
1059541498 9:115134872-115134894 CCCTGAGCATGGAGGGAGGAAGG - Intergenic
1059989099 9:119847833-119847855 CTCAGAGCAAATAGGGAAGATGG - Intergenic
1060299728 9:122368202-122368224 CTCAGGGCCTGGGGTGAAGCTGG + Intergenic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060824121 9:126677786-126677808 CTCAGGGCATTGCGGGGAGGAGG + Intronic
1061207869 9:129174924-129174946 CCCAGTGGATGGAGGGAGGAAGG - Intergenic
1061511323 9:131062908-131062930 ATCAGGGGCTGGAGGGAGGAAGG - Intronic
1062005030 9:134234793-134234815 CCAAGGGTATGGCGGGAAGAGGG - Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062259309 9:135652094-135652116 CTCAGGCCAAGATGGGAAGAGGG - Intergenic
1062389154 9:136327308-136327330 CCCAGGGAATGCAGGGGAGAGGG - Intergenic
1062517451 9:136943707-136943729 CTCAGAGCTTGGAGGCCAGAGGG - Intronic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1203657587 Un_KI270753v1:13281-13303 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
1185444310 X:249810-249832 CTCAGGCCATGACAGGAAGAGGG + Intergenic
1186371959 X:8955877-8955899 CTCATGAGATGGAGGAAAGAGGG - Intergenic
1186558043 X:10581551-10581573 TTCAGGACAAGAAGGGAAGAAGG - Intronic
1186753039 X:12641389-12641411 CTGAGAGCATGGAGGGGAGGGGG - Intronic
1187258548 X:17663193-17663215 TTCGTGGCATGGAGGGGAGAGGG + Intronic
1187281850 X:17863357-17863379 CTAAGAAAATGGAGGGAAGAAGG + Intergenic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190119754 X:47650395-47650417 CTCTGGGCCTGGAGGGTGGAGGG - Intronic
1190558738 X:51666106-51666128 TTCAAAGCATGGAGGAAAGAAGG + Intergenic
1190605184 X:52134182-52134204 CTCAGGGAATTGAGTGAGGATGG + Intergenic
1191111340 X:56805099-56805121 CTCAGGGCATTCCAGGAAGAAGG + Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1194256605 X:91643101-91643123 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1194956725 X:100189662-100189684 ATCAGAGTGTGGAGGGAAGAAGG + Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195548187 X:106137372-106137394 CTCAAGACATACAGGGAAGAAGG - Intergenic
1198097503 X:133394481-133394503 ATCAGGGCAAGGAGAAAAGAGGG + Intronic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198657921 X:138934983-138935005 CTGAGGGCAGGGGGAGAAGAGGG - Intronic
1199589880 X:149457501-149457523 TTCAGGGCATCGAGAGAAGAGGG + Intergenic
1200080833 X:153575577-153575599 CTAAGGGCATGGAGGGGTGGGGG + Intronic
1200295860 X:154919511-154919533 CTCAGGGCAAGGAGGAAACTTGG + Intronic
1200383999 X:155870378-155870400 TTCAGGCCATGAAGGGAAGTGGG - Intergenic
1200575324 Y:4882379-4882401 TTCAGGCCATGAAGGGAAGTGGG + Intergenic
1202196676 Y:22305379-22305401 CTCAGGGCATGGAAGGGAGCCGG + Intergenic