ID: 1163383795

View in Genome Browser
Species Human (GRCh38)
Location 19:16986459-16986481
Sequence CAGGGTGGGGACGCTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 1, 2: 4, 3: 50, 4: 486}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163383795_1163383805 29 Left 1163383795 19:16986459-16986481 CCAGCACCAGCGTCCCCACCCTG 0: 1
1: 1
2: 4
3: 50
4: 486
Right 1163383805 19:16986511-16986533 AACAGTGTGTTCAGCCAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 138
1163383795_1163383801 -6 Left 1163383795 19:16986459-16986481 CCAGCACCAGCGTCCCCACCCTG 0: 1
1: 1
2: 4
3: 50
4: 486
Right 1163383801 19:16986476-16986498 ACCCTGCACCACTGGTTTAATGG 0: 1
1: 0
2: 1
3: 10
4: 87
1163383795_1163383806 30 Left 1163383795 19:16986459-16986481 CCAGCACCAGCGTCCCCACCCTG 0: 1
1: 1
2: 4
3: 50
4: 486
Right 1163383806 19:16986512-16986534 ACAGTGTGTTCAGCCAAGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163383795 Original CRISPR CAGGGTGGGGACGCTGGTGC TGG (reversed) Intronic
900082664 1:870067-870089 CCGGGTGGGGCTGCTGTTGCGGG - Intergenic
900176340 1:1293051-1293073 CAGGCTGGCGTCGCGGGTGCTGG - Exonic
900210926 1:1455551-1455573 CAGGGAGGGGACCCCGGAGCTGG + Intronic
900216749 1:1485870-1485892 CAGGGAGGGGACCCCGGAGCTGG + Intronic
900223831 1:1523599-1523621 CAGGGAGGGGACCCTGGAGCTGG + Intronic
900255612 1:1697090-1697112 CTGGGTGGGGATGCTGGTCCTGG + Intronic
900264283 1:1749713-1749735 CTGGGTGGGGATGCTGGTCCTGG + Intergenic
900292093 1:1928002-1928024 CAGGGTGGGGACCCCGGTTCTGG - Intronic
900480786 1:2898163-2898185 CAGGGTGGAGCCGTTGGAGCAGG + Intergenic
900805608 1:4765849-4765871 CAGGGTGAGGCCACTGCTGCTGG + Intronic
901081504 1:6586567-6586589 GAGGGTGGGGACGCTAGGGTGGG - Intronic
901581603 1:10248732-10248754 CAGGGTGGTCACGATGGTGGTGG + Intronic
902414642 1:16231578-16231600 CAGGGTAGGGTCTCTGGGGCTGG + Intergenic
902518892 1:17004818-17004840 CAGGCTGGGGAAGCAGGTGAGGG + Exonic
902650465 1:17833906-17833928 AAGGGTGGGGATGGTGGAGCCGG + Intergenic
902987680 1:20165080-20165102 GAGGGTGGAGAAGCTGGTGAGGG - Intronic
903751518 1:25624375-25624397 CAGTGTGGGGACTCAGTTGCGGG + Intronic
903774407 1:25783496-25783518 CAGGGTGGGGGTGCTAGTCCTGG - Intronic
904491130 1:30859800-30859822 GAGGGTGGGGATGGTGGTGAGGG - Intergenic
905308272 1:37033612-37033634 CAGAGTGGGGACCCTGGGGAAGG - Intronic
905484149 1:38283961-38283983 CAGGGTGGGGGAGCTGGCCCAGG + Intergenic
905693046 1:39956462-39956484 CAGGTTGTGGCAGCTGGTGCCGG + Intronic
906522305 1:46474775-46474797 CAGGCTGGGGGCGCTGGGGAGGG + Intergenic
907329087 1:53659715-53659737 CAGGGTGGCACCGCTGGTGGGGG - Intronic
907406280 1:54255392-54255414 CTGGGTGGGAAGGCTGCTGCTGG + Intronic
907996446 1:59637488-59637510 CTGGGTGGGGAGGCTGAGGCAGG + Intronic
908437636 1:64121964-64121986 CAGGTTGTGGCAGCTGGTGCAGG - Intronic
910428866 1:87141608-87141630 CAGGATGATGACGCTGGTCCAGG - Intronic
912153337 1:106885072-106885094 CAGGGTGGTGTGGCTGGTGTAGG - Intergenic
912232064 1:107805956-107805978 CAGTGTGGGGAGGCTGGCTCAGG + Intronic
912411226 1:109481956-109481978 CTAGGTGGGCACCCTGGTGCTGG - Exonic
912491345 1:110064444-110064466 CAGGAGGGGAAGGCTGGTGCAGG + Intronic
914919729 1:151838855-151838877 CGGGGTGAGGACGTTGGGGCAGG + Exonic
915511777 1:156390602-156390624 GAAGGAGGGGACGCTGGTGTGGG - Intergenic
916065641 1:161133272-161133294 GGGGGTGGGGAGGATGGTGCGGG + Intergenic
916502825 1:165401234-165401256 CTGGGTGGGGAGGCTGTGGCTGG + Exonic
916688512 1:167169620-167169642 CAGGGAGAGGCCACTGGTGCAGG + Intergenic
916818548 1:168376162-168376184 TAGAGTGGGGTTGCTGGTGCAGG + Intergenic
917281379 1:173380615-173380637 AGTGGTGGGGACGCTGCTGCAGG - Intergenic
918078788 1:181190228-181190250 GTGGGTGGGGACGCTGGAGGTGG + Intergenic
918775724 1:188627722-188627744 AAGGGTGGGGTCCCTGGTGAGGG - Intergenic
919842809 1:201621949-201621971 CAAGGAGGGGAAGCTGGTGAAGG + Intergenic
919879783 1:201893867-201893889 CAGGGAGGGGCTGCTGATGCTGG + Intergenic
920097229 1:203494148-203494170 AAAGGTGGGGACTCTGGTGGAGG - Exonic
920204274 1:204280522-204280544 CAGGATGGGGAAGCTGGGCCAGG - Intronic
920291421 1:204925892-204925914 CAGGGTGAGGAAGCTGGGGTTGG + Intronic
920701014 1:208218066-208218088 CAGGATGGGGACCCTGGGTCAGG - Intronic
921303479 1:213772595-213772617 CCGGGAGGGGACACTGGTGGGGG - Intergenic
923141231 1:231162714-231162736 CAGGTTGAAGCCGCTGGTGCGGG + Intronic
1062802117 10:388592-388614 CAGGGTGGTCACGCTTGTGGAGG - Intronic
1062885179 10:1010903-1010925 CGGGGTGGGGAAGGTGGTGTAGG - Intronic
1062885254 10:1011178-1011200 CAGGGTGGGGAAGGTGGTGCAGG - Intronic
1063086427 10:2822437-2822459 CAGGGTGGGGACACTGGAAAGGG - Intergenic
1063251623 10:4280900-4280922 CTGGGTGGGGGCGCAGGTGTTGG - Intergenic
1064265346 10:13821117-13821139 CGGGGAGGGGAAGCTGCTGCGGG + Intronic
1065020025 10:21495933-21495955 GGGGGTGGGGACGCTGGGGGAGG + Exonic
1067069011 10:43119175-43119197 CAGGCTGGGGATGCTGATGGAGG - Intronic
1067510736 10:46893069-46893091 CTTGGTGGGGACCCTGGTTCTGG + Intergenic
1067651519 10:48158793-48158815 CTTGGTGGGGACCCTGGTTCTGG - Intronic
1067706283 10:48608572-48608594 CAGGCTGGGGACCCAGGTGCTGG - Intronic
1068407116 10:56604599-56604621 AAGGGTGGGGTCCCTGGTGAGGG + Intergenic
1068547419 10:58364357-58364379 CAGGGTGCTGACGCTGTTTCAGG - Intronic
1068553460 10:58431933-58431955 CTGGGTGGGAAGGCAGGTGCGGG + Intergenic
1068747305 10:60547634-60547656 GAGGGTGGGGAGGGTGGTGGTGG + Intronic
1069850508 10:71401228-71401250 TCGGGTGGGGTGGCTGGTGCGGG + Intronic
1069867917 10:71515056-71515078 CAGGGAGGTGACCCTGGTGCTGG + Intronic
1070380787 10:75878706-75878728 AAGGGTGGGGTCCCTGGTGAGGG - Intronic
1070811885 10:79302219-79302241 CAGGGTGGGGACGGGGGTGAGGG + Intronic
1071875237 10:89837345-89837367 CTGGGTGGCGACGCTCGTGGAGG + Intergenic
1072864218 10:99041583-99041605 GAGGCTAGGGAAGCTGGTGCTGG - Intronic
1073950911 10:108808242-108808264 CAGGGTGGGGCAGCTGGGGAAGG - Intergenic
1074003116 10:109392239-109392261 CAGGGTAAGGACGCTGGTGCTGG + Intergenic
1074532297 10:114305830-114305852 CCAGGAGGGGACGCGGGTGCAGG + Intronic
1074575372 10:114663883-114663905 CACGGTGGGGAACCTGGAGCAGG - Intronic
1075313116 10:121431127-121431149 CAGGGTGAGGACGCAGATGCAGG - Intergenic
1075654074 10:124149880-124149902 GGTGGTGGGGAGGCTGGTGCTGG - Intergenic
1075726141 10:124611856-124611878 CAAAGTGGGGGCGCTGCTGCCGG + Intronic
1075810542 10:125221861-125221883 GAGGGTGGGGAGGCTGTGGCTGG - Intergenic
1076379887 10:130017701-130017723 CAGGGTGGGGCCGAAGGTGGGGG - Intergenic
1076551474 10:131280824-131280846 GGTGGTGGGGATGCTGGTGCAGG - Intronic
1076614713 10:131747867-131747889 CAGGGTGGGGACGCTGAACCAGG + Intergenic
1076637304 10:131890997-131891019 CAGGAAGGGGACGCAGCTGCAGG - Intergenic
1076776108 10:132699192-132699214 CAGGGCGGGGGCTGTGGTGCAGG + Intronic
1076898224 10:133324742-133324764 TGGGGTGGGGATGCTGGGGCTGG + Intronic
1076898233 10:133324762-133324784 TGGGGTGGGGATGCTGGGGCTGG + Intronic
1076935380 10:133565379-133565401 CAGGGTTGGGGCGCGGGTGGCGG - Intronic
1077002762 11:332830-332852 CTGGGTGAGGACGCTGACGCCGG - Intergenic
1077147574 11:1052879-1052901 CAGGCTTGGGACACAGGTGCCGG - Intergenic
1077210133 11:1367047-1367069 CACGGAGGGGAGGCTGGAGCGGG + Intergenic
1077365505 11:2159961-2159983 CTGGGCGGGGGCCCTGGTGCAGG - Exonic
1077413189 11:2412993-2413015 CAGGGTGGAGGAGCTGGTGGAGG - Exonic
1077478224 11:2800992-2801014 CAGGGTGGGGACACTGGTAATGG + Intronic
1078553236 11:12294500-12294522 CAGGGTGGGGACCTAAGTGCAGG - Exonic
1079087062 11:17454125-17454147 CAGGGTGTGGGAGCTGCTGCAGG + Intronic
1079435755 11:20447344-20447366 TTGGGTGGGGACAATGGTGCCGG + Intronic
1079454253 11:20623439-20623461 CAGGGTGTTGTCGCTGGAGCTGG - Intronic
1080825629 11:35846605-35846627 CAGGGTTGGGACACTGGAGGTGG - Intergenic
1082710302 11:56546957-56546979 AAGGGTGGGGTCCCTGGTGAGGG + Intergenic
1083223534 11:61269060-61269082 CAGGGCGGGGAGGCAGGGGCCGG - Intronic
1083402870 11:62436138-62436160 CAGGGTGGGGAGGAAGTTGCAGG + Intronic
1083492437 11:63022779-63022801 CAGGGGAGGGAACCTGGTGCTGG + Intergenic
1083778714 11:64907103-64907125 CAGGGTGGGCAGGCTGGCGTGGG + Intronic
1083935355 11:65867135-65867157 CAGGGAGGTGACGCTGGGGCAGG - Intronic
1084166021 11:67375081-67375103 CAGGTTGGAGGCGCTGGGGCTGG - Intronic
1084315231 11:68341933-68341955 CTGGGTGGGCCAGCTGGTGCTGG + Intronic
1084490608 11:69476350-69476372 CTGGGTGGGGACTCTGGGACAGG - Intergenic
1084561499 11:69908040-69908062 CAGGGTGGGGAAACTGAGGCAGG + Intergenic
1085196228 11:74673467-74673489 CAGCGTGGGGACGGACGTGCAGG - Intergenic
1085205703 11:74730897-74730919 CAGGGTCAGGCCGCTGGTCCGGG + Exonic
1085255174 11:75168620-75168642 CAGGGTGGGGCAGCTGGGGCTGG - Intronic
1088187811 11:107193140-107193162 CAGGGTGGGCAGACTGGTGAAGG - Intergenic
1088989805 11:114942950-114942972 CACAGTGGGGACCCGGGTGCTGG - Intergenic
1090910405 11:131113664-131113686 CAGGGTGGGGACCCCAATGCAGG - Intergenic
1091221791 11:133934147-133934169 GTGGGTGGTGACGCTGGCGCTGG + Intronic
1091587062 12:1822462-1822484 CAGGGTGGTGTCCCTGGGGCTGG - Intronic
1091680469 12:2523143-2523165 GAGGGCGGGGGCGGTGGTGCTGG + Intronic
1091759609 12:3077880-3077902 CAGGGAGCGGTCGCGGGTGCCGG - Intronic
1093324780 12:17760205-17760227 CAGGATGGGGACCCTGGACCCGG + Intergenic
1096513724 12:52145438-52145460 GTGGGTGGGGGCGGTGGTGCAGG - Intergenic
1096520751 12:52183331-52183353 GGGGGTGGGGATGGTGGTGCAGG - Intronic
1096570471 12:52520192-52520214 CACGGAGGTGAAGCTGGTGCGGG + Exonic
1097033392 12:56105333-56105355 CGTGGTGGGGAAGCTGGTGGTGG - Intronic
1098235883 12:68417782-68417804 AACGGTGGGGACTCTGGTGGAGG + Intergenic
1098486677 12:71029482-71029504 CAGGGCTGGCATGCTGGTGCTGG - Intergenic
1101377624 12:104184484-104184506 AAGGGTGGGGTCCCTGGTGAGGG - Intergenic
1101768926 12:107730407-107730429 CAGGGTGAGGAGGCAGGTGCTGG + Intergenic
1101935405 12:109052795-109052817 CAAGCTGGGGACCCTGGTCCCGG - Intronic
1102136970 12:110583334-110583356 CAGGGAGGGGGCGGTGCTGCCGG - Intergenic
1102565552 12:113795012-113795034 GGGGGTGGGGATGCTGGTGGAGG + Intergenic
1103843759 12:123887087-123887109 CAGGGAAGGGAGGCTGGTGGTGG + Intronic
1103880810 12:124164414-124164436 CAGCATGGGGACCCTGGTCCTGG + Intronic
1104182222 12:126393255-126393277 AATGATGGGGACGTTGGTGCTGG + Intergenic
1104621141 12:130313706-130313728 CAAGGGGGAGACGGTGGTGCTGG - Intergenic
1104835346 12:131786597-131786619 CTGGGTGTGCACGCAGGTGCTGG + Intronic
1104855972 12:131902687-131902709 CGGGGTGGGGGTGATGGTGCAGG + Intronic
1105291785 13:19058115-19058137 AAGGCTGGGGACGCTGGAGCAGG + Intergenic
1106015225 13:25863120-25863142 CAGGGTGGGGTCTCTGGGGTGGG - Intronic
1106242659 13:27923144-27923166 CAGGCTGTGGACGCTGGCGCGGG - Intronic
1106485681 13:30170724-30170746 GAGGGTGGGGTAGGTGGTGCAGG - Intergenic
1106586215 13:31058490-31058512 CAGGTTGGGGTGGCTGGGGCAGG + Intergenic
1107630169 13:42334677-42334699 CAGAGAAGGGACGCTGGTGGTGG - Intergenic
1113588531 13:111482311-111482333 CGGGGTGGTGACGCTGGTGCTGG + Intergenic
1113861951 13:113491812-113491834 CAGGGTGTGGACGCCTGCGCGGG + Intronic
1113914430 13:113862341-113862363 CCGGGTGAGGACGCTGTTGGAGG + Intronic
1114494983 14:23126278-23126300 CACGGTGGGGGCGGTGGTGCTGG + Exonic
1114569777 14:23658535-23658557 CAGTGTGGGGTCGCTGCTGTGGG - Intergenic
1116854152 14:49937353-49937375 CAGCATGGGGACCCTGGGGCTGG - Intergenic
1118338863 14:64878961-64878983 CAGGCTGGGGAAGCAGCTGCGGG - Intronic
1118949277 14:70419210-70419232 CACTGTGGGGACGGTGGTGGGGG + Intergenic
1120549759 14:85855701-85855723 CAGGGTGGGGGCGGTGGGGGAGG + Intergenic
1121426328 14:93854737-93854759 CAGGGTGTGGATGCTGATGAGGG + Intergenic
1122118124 14:99537665-99537687 CAGGGCGGGGAGGCTGGGCCTGG - Intronic
1122184755 14:99983046-99983068 CAGGGTGGTGAGGCTGGGGTGGG - Intronic
1122388649 14:101365426-101365448 CAGGGTGAGGCGGCTGGTGGGGG + Intergenic
1122632042 14:103111610-103111632 CAGGGTGGGGCAGGTGGGGCAGG + Intergenic
1122899158 14:104775033-104775055 CAGGGTGGAGATGAGGGTGCGGG - Intronic
1123468081 15:20530772-20530794 CACGGTGGGGAGGCTGGAGGAGG + Intergenic
1123582459 15:21729188-21729210 CATGGTGGGGAAGCTGAGGCAGG - Intergenic
1123619109 15:22171784-22171806 CATGGTGGGGAAGCTGAGGCAGG - Intergenic
1123650031 15:22470270-22470292 CACGGTGGGGAGGCTGGAGGAGG - Intergenic
1123728397 15:23125981-23126003 CACGGTGGGGAGGCTGGAGGAGG + Intergenic
1123740437 15:23279112-23279134 CACGGTGGGGAGGCTGGAGGAGG - Intergenic
1123746561 15:23323446-23323468 CACGGTGGGGAGGCTGGAGGAGG + Intergenic
1124057348 15:26254268-26254290 CAGGGTGGGGGTGCTGGGGTGGG + Intergenic
1124278828 15:28346763-28346785 CACGGTGGGGAGGCTGGAGGAGG + Intergenic
1124303871 15:28564845-28564867 CACGGTGGGGAGGCTGGAGGAGG - Intergenic
1125422646 15:39519914-39519936 CTGGGTAGGAACGCTGCTGCTGG - Intergenic
1125466731 15:39960613-39960635 CAGGATGGGGCGGGTGGTGCAGG + Intronic
1125717268 15:41826486-41826508 CAGGGTGGTGAAGCTGAGGCAGG - Exonic
1127498985 15:59538658-59538680 CCAGGTGGGGAGGCTGATGCAGG - Intergenic
1128804000 15:70517344-70517366 CAGGGTGGGGTGGCAGGAGCGGG - Intergenic
1129600481 15:76995485-76995507 CAGGACTGGGACGCTGCTGCTGG + Exonic
1129844278 15:78761109-78761131 CAGGGTGGGGGCGCTGCCACTGG + Intronic
1130957674 15:88638957-88638979 CAGGGTCGGGATGCCGATGCCGG + Exonic
1130971750 15:88739321-88739343 CAGGGAGGAGACGCAGGTTCTGG - Intergenic
1131986211 15:98044729-98044751 CATGGGTGGGAGGCTGGTGCTGG + Intergenic
1132184695 15:99792743-99792765 CAGGGTGGGCAGGCAGGGGCAGG + Intergenic
1132244158 15:100281300-100281322 CACGGTGGAGACCCTGGTGGTGG - Exonic
1132312945 15:100870407-100870429 CCAGGTGGGGGTGCTGGTGCTGG - Intergenic
1132321716 15:100930397-100930419 CAGGGTGGGGAAGCAGGTAGGGG - Intronic
1132399856 15:101498587-101498609 CAGCGTGGGGCTGCGGGTGCAGG - Intronic
1132432288 15:101771911-101771933 CAGGGTGGGCAGGCAGGGGCAGG - Intergenic
1132459344 16:42863-42885 CAGGGAGAGGAAGCTGGTCCCGG + Intergenic
1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG + Intronic
1133019845 16:2962621-2962643 CCGGCTTGGGACGCTGGTGGAGG - Intergenic
1133055784 16:3144828-3144850 GAAGGTGGGGACGCTGGAGGGGG + Exonic
1133113193 16:3561835-3561857 CAGGGTGGGGGCCCTGGCCCGGG + Intronic
1133303230 16:4795594-4795616 GGGGGTGGGGAAGCTGGCGCTGG + Intronic
1135042386 16:19127836-19127858 AAGGGTGGTGATGGTGGTGCTGG + Intronic
1135802339 16:25509629-25509651 CAGGGTGGGGAAGTTGGAGGTGG - Intergenic
1136126946 16:28190503-28190525 CAGGCTGGGCACGCTGGCTCAGG - Intronic
1136477877 16:30524699-30524721 CCGTGTGGGAGCGCTGGTGCTGG + Exonic
1137316874 16:47334687-47334709 CAGGGTGGGGAAGGAGCTGCAGG - Intronic
1137766219 16:50979595-50979617 CTGGGTGGAGAGACTGGTGCAGG - Intergenic
1137774761 16:51045509-51045531 CTGGGTGGGGAGGCTGGTATGGG + Intergenic
1138510471 16:57505812-57505834 CAGGGTGGGGATGGTGGGGACGG + Intergenic
1139392202 16:66612090-66612112 CAGGGTGTGGGTGCGGGTGCAGG - Intronic
1140060469 16:71565014-71565036 CAGGGTTGGGATGTTGGTGTCGG + Intronic
1140083967 16:71777478-71777500 GAGGGTGGCGGCTCTGGTGCAGG + Intronic
1140393491 16:74607928-74607950 CAGGGAGGGGATGCTAGTGTGGG - Intergenic
1140750554 16:78019511-78019533 CAGGTTGGGGAGGCTGATGCGGG + Intergenic
1141026110 16:80550224-80550246 CAGGGTGAGGACACTGGTGTAGG - Intronic
1142271413 16:89091531-89091553 GAGGGTGGGGGCGCTGCTGCGGG + Intronic
1142298917 16:89244922-89244944 GAGGGTGCGGCCGCAGGTGCTGG - Intergenic
1143347202 17:6258538-6258560 CAGGGAGAGGAGGCTGTTGCTGG + Intergenic
1143357878 17:6344054-6344076 CAGGGTGGGGATGCTGGGGTGGG - Intergenic
1143471133 17:7176962-7176984 CAGGGTGAGGGCGCTGGGGCGGG - Exonic
1143558114 17:7675132-7675154 CATGGCGCGGACGCGGGTGCCGG + Exonic
1144206844 17:12985440-12985462 CAGGGAGGGGAGTCTGGTGGAGG - Intronic
1144590663 17:16521004-16521026 GAGGATGGGGAGCCTGGTGCTGG + Intergenic
1144646894 17:16981217-16981239 CAGGGTGGGGACTCTGGCCAGGG - Intergenic
1144735147 17:17551447-17551469 CAGGGTGGAGAAGCTGGCGCGGG + Intronic
1144739309 17:17572369-17572391 GTGGCTGGGGACGGTGGTGCAGG - Intronic
1145031382 17:19507575-19507597 GGGGGTGGGGACGCGGGTGGAGG - Intronic
1145246409 17:21272757-21272779 TTGGGTGGGGAAGCTGGTGCAGG - Intergenic
1146596918 17:34177343-34177365 CAAGGTCGGGGCGCTGGTGGCGG + Intergenic
1146682315 17:34816988-34817010 CAGGGTGGGGACTCTGCAGATGG + Intergenic
1147140573 17:38458517-38458539 CAGGGAGGGGTGGCTGGTGCAGG + Intronic
1147191326 17:38739730-38739752 GAGGGCGGGGAGGCTGGTCCTGG - Intronic
1147576025 17:41599437-41599459 GAGGGTGGTGATGGTGGTGCTGG + Intergenic
1147985979 17:44308211-44308233 CAGGGAGGGGACGGGGGTGGGGG + Intergenic
1148048778 17:44759276-44759298 CAGGGAGGGGGCGCCGGGGCCGG - Intronic
1148703454 17:49606452-49606474 CAGGCTGGGCACAGTGGTGCTGG - Intronic
1148725114 17:49783535-49783557 CAGGGTGGGGCTGCGGGTGGGGG + Intronic
1148854755 17:50572649-50572671 CAGCGTGGGCACGCTTCTGCAGG - Exonic
1150292006 17:63987599-63987621 AAGGGAGGGGACGCTGGAGGAGG - Intergenic
1151403922 17:73874612-73874634 GAGGCTGGGGAGGCTGGGGCCGG - Intergenic
1151448447 17:74182304-74182326 GAGGGGAGGGAAGCTGGTGCTGG - Intergenic
1151581460 17:74981629-74981651 CAGGCTGGGGATGCCAGTGCAGG - Intergenic
1151700043 17:75737938-75737960 GAGGCTGGGGACCCTGGTGGGGG - Intronic
1151715998 17:75831336-75831358 CAGGGTCAGGAGGCTGGGGCGGG + Exonic
1151735408 17:75936986-75937008 CAGGGTGGGAAAGCTGGTGTGGG - Intronic
1151852366 17:76698418-76698440 CAGGGAGGGCAGGCTGGGGCAGG + Intronic
1152004573 17:77672034-77672056 CAGGGTGGGGGTGCTGGAGGTGG - Intergenic
1152045205 17:77930739-77930761 CTGGGTGGGGAAGGTGGGGCTGG - Intergenic
1152073317 17:78144781-78144803 GATGGTGGGGAGGCAGGTGCAGG - Intergenic
1152336017 17:79700574-79700596 CAGGGTGGGGGAGCTGGAGGGGG + Intergenic
1152381529 17:79944840-79944862 CAGGGTGGCCACGGTGGTTCAGG + Intronic
1152531865 17:80923507-80923529 CAGGCTGGAGCTGCTGGTGCTGG - Exonic
1152625588 17:81386725-81386747 CGGGGTGGGGTCGGTGGCGCGGG - Intergenic
1152639727 17:81444524-81444546 CAGGGAGGGGCTGCGGGTGCGGG - Exonic
1152663262 17:81552632-81552654 CAGGGTGGGGAAGCGGGTCCTGG + Intronic
1152896490 17:82914320-82914342 CAGGGTGGGAAAGCTGGAGTTGG - Intronic
1152926347 17:83089503-83089525 GGGGTTGGGGACGCTGCTGCGGG - Intronic
1153000759 18:453407-453429 GAGGGTGGGGATGCTGGTCAGGG - Intronic
1153018160 18:602935-602957 CAGGGTGGGGAAGGTCTTGCAGG + Intronic
1153432397 18:5032161-5032183 CAGGGTGGGGAGCAGGGTGCAGG - Intergenic
1153541360 18:6159347-6159369 CAGAGTGGGGTCTCTGGTCCTGG - Intronic
1153711872 18:7808312-7808334 CAGGGTGGGGGTGCTGGTCTAGG + Intronic
1154250008 18:12736536-12736558 GAGGGTGGGGAAGCGGGTACCGG + Intergenic
1157309652 18:46542766-46542788 CACGGTGGAGACGCTGGATCTGG - Exonic
1157590014 18:48830761-48830783 CAGGCTGGGGACAGTGGTGGGGG - Intronic
1160246637 18:77165001-77165023 AAGGGAGGGGACCATGGTGCTGG + Intergenic
1160328794 18:77973788-77973810 CGGGGTGGGGTGGCTGGTGCTGG + Intergenic
1160585056 18:79909553-79909575 AAGGCTGGGGACTCTGGTGAGGG - Intronic
1160585222 18:79910135-79910157 AAGGTTGGGGACTCTGGTGAGGG - Intronic
1160990763 19:1859491-1859513 GAGGGTGGGGACGCTGGGGGCGG - Intronic
1161041849 19:2114634-2114656 CAGGGTGGGCAGGCTGGGGTGGG - Intronic
1161111202 19:2471277-2471299 CAGGCTGGGCACGGTGTTGCGGG - Intergenic
1161115796 19:2495715-2495737 CAGGGTGGGGGGGCTGTCGCAGG + Intergenic
1161361620 19:3853139-3853161 CAGGCTGGGGTCCCTGGGGCTGG + Intronic
1161477962 19:4496699-4496721 GAGGCTGGGGACGCTGCTGAGGG + Intronic
1161479078 19:4501726-4501748 CAGCGTGGGGACCCTGGAGATGG + Intronic
1161576394 19:5056841-5056863 TGGGGTGGGGACCCTGGGGCGGG + Intronic
1161576409 19:5056870-5056892 TGGGGCGGGGACGCTGGGGCGGG + Intronic
1161622337 19:5304885-5304907 GAGGGTGGGGACCCTGGGCCAGG + Intronic
1161801979 19:6421405-6421427 CAGGCTGGGGACCGTGGTGCCGG - Intronic
1161809634 19:6464548-6464570 CGGGGTGGGGACCCCGGCGCAGG - Intronic
1162250190 19:9435804-9435826 TAGGGTGGGGTCGGTGGTGTTGG + Intergenic
1162931836 19:13961360-13961382 CTGGGTGGGGAGGCTGGGGGCGG - Exonic
1163071740 19:14848385-14848407 CAGAGTGGAGACGCTGCTGTGGG - Intergenic
1163115231 19:15185093-15185115 CAAGGTGGGGACCCTGGGGTTGG - Intronic
1163365231 19:16872373-16872395 CTGGGTGGGGACACAGGGGCAGG - Intronic
1163383795 19:16986459-16986481 CAGGGTGGGGACGCTGGTGCTGG - Intronic
1163685596 19:18710129-18710151 CAAGGAGGTGACGCTGGAGCTGG - Intronic
1164711753 19:30361811-30361833 CAGGGTGGGGTGGGTGGGGCGGG + Intronic
1165074796 19:33274849-33274871 CGGGGTGGGGGCTCTGGAGCTGG + Intergenic
1165225048 19:34348950-34348972 CAGGGTGGGGTGGCGGGTGGTGG + Intronic
1165318884 19:35074123-35074145 CAGGGTGGGGACGGGGCAGCTGG - Intergenic
1165738790 19:38193704-38193726 GCGGGTGGGGGTGCTGGTGCTGG - Exonic
1166361867 19:42255823-42255845 CAGCCTGGGGACGGTGGTGGTGG - Intergenic
1166441076 19:42815979-42816001 CAGGGTGGGGATGCAGGTCAAGG - Intronic
1166932361 19:46308797-46308819 GAGGGCGGGGACGCTGGGGCTGG + Intronic
1167606658 19:50484891-50484913 CAGGGAGGGGAAGTGGGTGCTGG - Exonic
1168687242 19:58356324-58356346 CAGAGTGCAGGCGCTGGTGCTGG + Exonic
925959704 2:9003582-9003604 CAGGGTGGAGCCCGTGGTGCTGG + Exonic
926327288 2:11796497-11796519 CAGGGTGGAGACGAGTGTGCGGG + Intronic
926602917 2:14865320-14865342 CAGGTTGGGGAAGCAGGTGGGGG + Intergenic
926722190 2:15969068-15969090 CAGGGTGGGGACTCAGTTGCAGG - Intergenic
927038204 2:19202808-19202830 CAGGACAGGGACACTGGTGCAGG - Intergenic
927812262 2:26186623-26186645 CAAGGTGGGGACTTTGCTGCAGG + Intronic
927886700 2:26723263-26723285 CGGGGTGGGGATGGTGGTGTGGG - Intronic
927916133 2:26937855-26937877 TAGGCTGGGCACGGTGGTGCAGG - Intronic
928105913 2:28470514-28470536 CAGGGTCGGAAGGCAGGTGCTGG + Intronic
928568175 2:32575027-32575049 CCGGCTGGGCACGCTGGTTCAGG - Intronic
928706250 2:33952771-33952793 CAGGGTGTGGAGGGTGGTGTTGG + Intergenic
929811369 2:45191718-45191740 AAGGGTAGGGAGGCTGCTGCAGG + Intergenic
930018231 2:46985254-46985276 CAGGGTGGTGAGGTTGGGGCAGG - Intronic
931517822 2:63059906-63059928 CAGGGTGAGGGCGCTGGCGTTGG + Intergenic
932700133 2:73985989-73986011 CAGGGTCTGGACGCTGGAGAAGG - Intergenic
933141485 2:78796041-78796063 AAGGGTGGGGTCGCTGGTGAGGG - Intergenic
933808199 2:86015283-86015305 CAGGGAGGGGAAGCCGGTACTGG + Intergenic
935281537 2:101522011-101522033 CAGGCTGGTGGCTCTGGTGCAGG + Intergenic
936512691 2:113161047-113161069 CATGGTGAGGATGCGGGTGCAGG + Intronic
936799115 2:116244747-116244769 CATGGTGGAGATGCTGGTCCAGG + Intergenic
937232639 2:120407044-120407066 CAGGGAGGCGGCGCTGGTGGAGG + Intergenic
937546141 2:123023381-123023403 CATGATGGGGACAATGGTGCAGG - Intergenic
938249899 2:129806512-129806534 CAGGGTGGGGAAGCTGAAGGAGG - Intergenic
939930832 2:148231025-148231047 CAGGGTGGGGAAGGGAGTGCTGG - Intronic
942067463 2:172285140-172285162 CAGGATGGGGACACAGGAGCTGG + Intergenic
943562810 2:189483756-189483778 GTGGGTGGGGACAGTGGTGCAGG - Intergenic
945059490 2:205896351-205896373 CAAGGTGGAGACACTGGTGTAGG - Intergenic
945204356 2:207316206-207316228 GATGCTGGGGACACTGGTGCTGG - Intergenic
946210534 2:218143854-218143876 AAGGGTGGGGTCCCTGGTGAGGG - Intergenic
946396243 2:219445021-219445043 GGGGGTGGAGCCGCTGGTGCGGG + Exonic
947995181 2:234521480-234521502 TAGGGAGGGGACGCTGTAGCTGG + Intergenic
948685009 2:239664785-239664807 AATGGTGGGGAGGCCGGTGCAGG + Intergenic
948711911 2:239830440-239830462 CAGGGAGCGGACGGTGCTGCTGG - Intergenic
948727247 2:239942371-239942393 GAGGCTGGGGCCGCTGGTCCAGG + Intronic
948806068 2:240453817-240453839 CAGGGCGGCGACGCTGCCGCCGG + Intronic
949053917 2:241914334-241914356 CCAGGTGGGGATGCTGCTGCTGG + Intergenic
1171013835 20:21522731-21522753 GAGGGTGGGGCCGCTGGGCCGGG - Intergenic
1171019486 20:21572219-21572241 GAGGGAGGGGGCGCGGGTGCAGG - Intergenic
1171474043 20:25393887-25393909 CAGGGTGGGGACCATGGAGGCGG - Intergenic
1171972456 20:31572968-31572990 CAGGGCGGGGAGGCAGGGGCAGG - Intronic
1172154944 20:32817917-32817939 ATGGGTGGGGAAGCTGGGGCAGG - Intergenic
1172380187 20:34483092-34483114 CAGCGTGGGGACCCTGGGCCCGG + Intronic
1172445923 20:34993393-34993415 CAAGGTGCTGACGCTGCTGCAGG + Exonic
1172891922 20:38271591-38271613 CAGGGTGGAGAAGATTGTGCGGG - Intronic
1173338014 20:42128798-42128820 CCGGGTGAGGCTGCTGGTGCTGG - Exonic
1173434021 20:43016446-43016468 AAAGGAGGGGACGCTGATGCAGG - Intronic
1174192080 20:48747790-48747812 CAAGGTGTGGACGCTGGGGCTGG - Exonic
1174396767 20:50251407-50251429 CAGCCTGGGGACGCTGGTGTTGG - Intergenic
1174571325 20:51503745-51503767 CAGGGAGAGGAGGCTGGGGCAGG + Intronic
1174835576 20:53853439-53853461 TAGGGTGGGGACCATGGGGCTGG + Intergenic
1175171249 20:57082792-57082814 CAGGGAGGGGCCGCTGTGGCTGG + Intergenic
1175527791 20:59647458-59647480 GAGGTTGGGGAGGGTGGTGCAGG + Intronic
1175777563 20:61662861-61662883 CAGGGTAGAGCCGGTGGTGCAGG + Intronic
1175830998 20:61965612-61965634 CCGTGTGGGGACGCGGGTGCCGG - Intronic
1176007683 20:62875287-62875309 GAGGGTGGGGGTGCGGGTGCGGG - Intergenic
1176119216 20:63446476-63446498 CAGGGTGGGGGCGATGGAGGCGG + Intronic
1176164220 20:63664413-63664435 CCTGGTGGGGACGCTGGGCCTGG + Intronic
1176249379 20:64113000-64113022 CAGAGTGGGCAGGCAGGTGCAGG + Intergenic
1176266491 20:64212171-64212193 CAGGGTGGGGGCCGTGGTGGGGG + Intronic
1176266504 20:64212195-64212217 CAGGGTGGGGGCCGTGGTGGGGG + Intronic
1176266517 20:64212219-64212241 CAGGGTGGGGGCCGTGGTGGGGG + Intronic
1176266530 20:64212243-64212265 CAGGGTGGGGGCCGTGGTGGGGG + Intronic
1177130404 21:17248278-17248300 CAGCATGGGGACCCTGGGGCCGG - Intergenic
1179176565 21:39011985-39012007 CAGTGTGGGGAGGTGGGTGCAGG + Intergenic
1179622357 21:42625634-42625656 TAGGGTGGGGCTGCTGGTGCAGG - Intergenic
1179684617 21:43046573-43046595 GAGGGTGAGGACGGGGGTGCAGG - Intergenic
1179935691 21:44602297-44602319 CCGTGTGGTGAGGCTGGTGCAGG - Intronic
1181167956 22:20993342-20993364 CAGTGTGAGGACGCAGGTCCAGG + Intronic
1182586496 22:31346696-31346718 CGGGGTGGGGAGGCGGGGGCCGG - Intergenic
1182605058 22:31496647-31496669 GAGGGTGGGGACGTTAGGGCCGG - Intronic
1183061339 22:35338117-35338139 CAGGGTGGGGAGGCAGGAACTGG - Intronic
1183548604 22:38468415-38468437 CAGGGTGGGGACTCCGGCGTGGG + Intronic
1183665806 22:39245079-39245101 GAGGGGGGGGACGCGGGAGCTGG + Intergenic
1183729694 22:39611038-39611060 GAGGGTGGGGAGGCTGGTCAGGG + Intronic
1183950595 22:41350484-41350506 CAGGGTGGTGATGCTGGAGGTGG + Intronic
1184160187 22:42693115-42693137 CAGGGTGGTGACGCCGCGGCAGG + Exonic
1184597269 22:45521712-45521734 CAGGTTGGGGAGGCTGGGGCGGG - Intronic
1184758995 22:46534355-46534377 CAGGGTGGGGACGACGGCGATGG - Exonic
1185117781 22:48947784-48947806 CATGGTGGGGAGCCTGGTGAGGG - Intergenic
1185219408 22:49622016-49622038 CAGGATGGGGAAGGTGGTGGAGG + Intronic
950289413 3:11771377-11771399 CATGGTGGGGAGGCTGCTGGAGG + Intergenic
950432252 3:12957598-12957620 CAGGCTGGGGAGGCTGGCTCTGG + Intronic
951217538 3:20039922-20039944 GAGGGTGGGGACGAGGGTGGGGG - Intergenic
951429835 3:22593674-22593696 GAGGTTGGGGACGGTGGTGTGGG - Intergenic
952841087 3:37646014-37646036 CAGAGTAAGGACGCTGGGGCTGG - Intronic
952963636 3:38607988-38608010 CAAGGTGGGGAAGCTGGGGAAGG + Intronic
953982192 3:47418503-47418525 CAGGGTGGCGGCGCTGGGCCTGG - Exonic
954223022 3:49166107-49166129 CAGGGTGGGGTCGCTGGGCGCGG + Intronic
955345104 3:58155096-58155118 AAGGGTGGGAACGCTTGTTCTGG + Intronic
959705037 3:109331839-109331861 CAGGCTGGGGACGGTGCTGCTGG - Intronic
959748307 3:109803596-109803618 CAGGGTGGGGCAGCTTGTGTGGG - Intergenic
960812255 3:121636327-121636349 GAGGGAGGGGACGGTGGTGCTGG - Intronic
960962870 3:123084364-123084386 CAGAGTGGGGAGGCTGGGACAGG - Intronic
961032378 3:123617931-123617953 CAGCCTGGGGAAGATGGTGCCGG + Intronic
961103016 3:124217942-124217964 CATGGTGAGGACACTGGAGCAGG + Intronic
961168416 3:124779406-124779428 GAGGTTGGGGAGGCTGGTGGTGG - Intronic
966353389 3:179055463-179055485 CGGGGAGGGGACGCTGGGGTAGG - Intronic
966842445 3:184100590-184100612 TTGGGTGGGGACGCTGATGTTGG - Exonic
966896161 3:184446840-184446862 CAGGGTTGGGTCGCTGGGGTGGG - Intronic
966949886 3:184806783-184806805 CAGGGCTGGGTGGCTGGTGCTGG + Intergenic
967207585 3:187138236-187138258 CGGGGAGGGGAGGCGGGTGCTGG + Intronic
967762493 3:193241328-193241350 CAGCGTGGCGGCGCTGGTGCTGG + Exonic
968486952 4:867476-867498 CGCCGTGGGGACCCTGGTGCTGG - Intronic
968486974 4:867547-867569 CGCCGTGGGGACCCTGGTGCTGG - Intronic
968870554 4:3239864-3239886 CAGGATGGGCAAGCTGGAGCAGG + Exonic
968957522 4:3726847-3726869 CAGTGTGGGGACCCTGCGGCAGG + Intergenic
969220109 4:5753679-5753701 GAGGTTGGGGAAGCTGGTGTCGG - Intronic
969238981 4:5887571-5887593 GAGGGTGGGGACGGTGGTGGAGG - Intronic
969580246 4:8060551-8060573 CAGGCTGGGGTGGCTGGGGCGGG + Intronic
969592542 4:8130225-8130247 CAGGGTGGCCAGGGTGGTGCTGG + Intronic
969597978 4:8159519-8159541 CAGGGCCTGGACGCGGGTGCAGG + Intergenic
969837126 4:9850974-9850996 CAGGGGTGGGACACTGGTGGGGG - Intronic
976595648 4:86892484-86892506 CAGGGAGGGGACGCCGGGCCCGG + Intronic
980237753 4:130131227-130131249 CAGGATGGGGACAGAGGTGCTGG + Intergenic
981230476 4:142348457-142348479 CAGGAGGGAGAAGCTGGTGCTGG - Intronic
981474986 4:145179736-145179758 CTGGGTGGGGAGGCAGCTGCGGG - Intronic
981782582 4:148444537-148444559 CATGGTGGGGAGGCTGGGGCGGG + Intronic
981920539 4:150079815-150079837 CTCGGTGTGGACCCTGGTGCAGG + Intronic
982136802 4:152280076-152280098 CATGGTGATGACGGTGGTGCTGG - Intergenic
982224998 4:153156958-153156980 CAGGGTGGGCAGGCAGGGGCGGG - Intronic
982550055 4:156786544-156786566 CAAGGAGGGGACGCTGTGGCTGG + Intronic
983693162 4:170497293-170497315 GAGGGTAGGGAAGCTGGAGCGGG - Intergenic
985014801 4:185623049-185623071 GTGGGTGGAGAGGCTGGTGCAGG + Exonic
985155454 4:186982996-186983018 TAGGGTGGGGAGGAGGGTGCAGG + Intergenic
985889713 5:2705952-2705974 GAGGGAGGGGATGGTGGTGCAGG + Intergenic
986323375 5:6652182-6652204 CAGAGAGGTGACGCAGGTGCTGG + Intronic
986626916 5:9731119-9731141 CAGGGAGGGGAGGTGGGTGCTGG - Intergenic
986721645 5:10564522-10564544 CGGGGTGGGGACGGCGGTGGTGG - Exonic
986723434 5:10577015-10577037 AAGGGGGAGGAAGCTGGTGCCGG + Intronic
991054519 5:62306589-62306611 CACGGAGGGGACGCGGGCGCCGG + Intronic
991674159 5:69075397-69075419 CAGGCTGGTGAGGCTGGCGCCGG + Intergenic
992484427 5:77181090-77181112 GAGGGTGGGGATGGTGGTGGGGG - Intergenic
994447161 5:99891006-99891028 CAGGGTGAGCATGCTGTTGCAGG - Intergenic
994586003 5:101710392-101710414 TGGGGTGGGGGCGCTGGTGGAGG - Intergenic
994614958 5:102092574-102092596 CAGGATGGGGACCCTGGGCCTGG + Intergenic
997156946 5:131571848-131571870 CAGGCTGGGGGCGGTGGTGGCGG - Intronic
997622144 5:135305813-135305835 GAGGGTGGGGAGGGTGTTGCTGG + Intronic
998396547 5:141822259-141822281 CTGGGTGGAGACTCTGGTCCGGG + Intergenic
999379567 5:151110697-151110719 GAGGTTGGGGAGGCTGGTGCTGG + Intronic
1000658954 5:163915730-163915752 AAGGGTGGGGTCCCTGGTGAGGG - Intergenic
1001034186 5:168285442-168285464 CAGGGTGGAGATGGTGGTACAGG + Intergenic
1001102943 5:168829131-168829153 CAGGGTGGGGTGGCTGCAGCTGG - Intronic
1001136025 5:169103615-169103637 CAGGGTGGGCATGCTGTTACCGG + Intronic
1001638252 5:173228008-173228030 TGGAGTGGGGAAGCTGGTGCTGG - Intergenic
1002400508 5:178989212-178989234 GAGGGTGGGGAGGGTGGTGAGGG - Intronic
1003092153 6:3113255-3113277 CACGGTGGGGAAGCTGGCCCAGG + Exonic
1003550459 6:7098344-7098366 CAGGGGGGTGAAGCAGGTGCAGG - Intergenic
1004566629 6:16803909-16803931 AAGGCTGGGGCCGCTGGGGCAGG + Intergenic
1005704115 6:28434734-28434756 CAGTGTGGAGTCTCTGGTGCTGG + Exonic
1006083419 6:31580506-31580528 CAGGGTGGGTGCACGGGTGCGGG - Intronic
1006256003 6:32832770-32832792 CAGGGCGGGGCAGGTGGTGCGGG - Exonic
1006335586 6:33418885-33418907 CAGGATGGGGACAGTGGTGATGG + Intergenic
1007656705 6:43455203-43455225 CACGGAGGGGACGCGGGGGCCGG + Intronic
1009316123 6:62223362-62223384 CAGGTTGGGGACCCTGGGTCAGG + Intronic
1010133460 6:72522929-72522951 CTGGTTGGTGACGCTGGAGCTGG - Intergenic
1011260837 6:85468297-85468319 CAGGGTGGAGCGGCTGGGGCTGG + Intronic
1011849330 6:91606000-91606022 CAGGATGGAGACGATGGTGGTGG - Intergenic
1013214602 6:108015804-108015826 CAGCATGGGGACCCTGGTCCCGG + Intergenic
1013485051 6:110588939-110588961 CGGGGTGTGGAAGCTGGTCCTGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017489629 6:154933656-154933678 CAGGATGGGGATGGGGGTGCCGG + Intronic
1017672549 6:156779719-156779741 GAGGGGGGGGACGCGGGTGCGGG - Intronic
1018252214 6:161882388-161882410 CAGGGAGGGGAGGCTGCGGCAGG + Intronic
1018867402 6:167756890-167756912 CATGGTGGGGATGCTGGGTCAGG + Intergenic
1019155729 6:170037690-170037712 CAGGTTGGGGCTGCTGGTTCTGG - Intergenic
1019324576 7:431952-431974 CAGTCTGGGGAAGCGGGTGCCGG - Intergenic
1019336627 7:485880-485902 CAGGGAGGGGACGCTGTGGGAGG + Intergenic
1019451959 7:1103692-1103714 CAGGGTGGGGACGTCGCTGTTGG - Intronic
1019521457 7:1462349-1462371 TAGGCTGGTGTCGCTGGTGCAGG + Intergenic
1019523113 7:1469339-1469361 GAGGGTGGGCAGGCGGGTGCAGG + Intergenic
1019568006 7:1694214-1694236 CAGGCTTGGGAGGCCGGTGCCGG + Exonic
1019780053 7:2934417-2934439 GAGGGAGGGGGCGCAGGTGCAGG - Intronic
1019812470 7:3174808-3174830 CAGGGTGGGGAGGGTGGAGTGGG - Intergenic
1019912157 7:4107111-4107133 CAGGGTGGGGAGGGTGGGGAGGG + Intronic
1021101388 7:16588383-16588405 GAGGCTGGGGAGGCTGGGGCAGG + Intergenic
1022877814 7:34552967-34552989 CATGCTGGTGACCCTGGTGCAGG - Intergenic
1023082001 7:36534488-36534510 GAGGGTAGGGACTCTGGGGCTGG + Intronic
1023177479 7:37448276-37448298 GAGGGTTGCGACGCTGGCGCGGG - Intronic
1024249836 7:47497821-47497843 CAGGGTGGGGAGCCCGGTCCTGG - Intronic
1024276714 7:47683503-47683525 CAGTGTGGGCAGGCTGGTGCGGG + Intergenic
1027450952 7:78330774-78330796 CAGGTTGGGGAGGCAGGGGCTGG + Intronic
1028121431 7:87059747-87059769 CGGGGCGGGGACGCTGGAGCTGG + Intergenic
1028868347 7:95738223-95738245 AAGGGTGGGGTGACTGGTGCTGG - Intergenic
1029361240 7:100089800-100089822 CAGGGTGGGGAAGATGGAGAGGG + Intronic
1029524799 7:101088059-101088081 CCGGGTGGGGACTCAGGTGGAGG + Exonic
1029654227 7:101913704-101913726 CAGGGTGGGGGTGCTGGGGGCGG - Intronic
1030197240 7:106864266-106864288 GAGGGAGGGGGCGCTGGTTCAGG + Intergenic
1030915145 7:115303691-115303713 CAGCGTGGGGACCCTGGACCTGG - Intergenic
1032513757 7:132492158-132492180 CAGGGTGGGGACACTGAGGCAGG + Intronic
1032695131 7:134329240-134329262 CAGGGCAGAGACGCTGGGGCAGG - Intergenic
1032886314 7:136142997-136143019 CAGGGTGTGGATGCAGGTGTAGG - Intergenic
1034489864 7:151387423-151387445 CAGGCTGAGGACCCTGGGGCTGG - Intronic
1034686946 7:152980559-152980581 CAGGGTGTAGAGGGTGGTGCGGG + Intergenic
1035038729 7:155912079-155912101 CAGGAAGGGGGTGCTGGTGCAGG - Intergenic
1035270620 7:157717760-157717782 CAGGGATGGGGCGCAGGTGCTGG - Intronic
1035283356 7:157791563-157791585 CAGGGAGGGGGGGCGGGTGCAGG - Intronic
1035296581 7:157870805-157870827 CAAGGTGGGGGTGCAGGTGCGGG - Intronic
1035739209 8:1913607-1913629 CAGGGACGGGACGCTGGTATTGG - Intronic
1036521271 8:9493912-9493934 GAGGGTGGGGAGGAGGGTGCTGG - Intergenic
1039878009 8:41603833-41603855 CAGTGTGGGGTGGCTGGTGCTGG - Intronic
1043599750 8:81923262-81923284 AAGGGTGGGGTCCCTGGTGAGGG + Intergenic
1044586613 8:93874537-93874559 CAGGGTGGGGCCACAGGAGCAGG + Intronic
1047726301 8:127686927-127686949 CAGGATGGGGAAGTCGGTGCAGG + Intergenic
1047933154 8:129750291-129750313 AAGACTGGGGACTCTGGTGCCGG - Intronic
1048315945 8:133362205-133362227 CAAGTTGGGAACTCTGGTGCTGG - Intergenic
1049229209 8:141473416-141473438 CAGGGAGGGGAGGCTGGCTCTGG - Intergenic
1049248073 8:141573263-141573285 CAGGATGGGGGAGCTGGTTCTGG + Intergenic
1049293695 8:141818191-141818213 AAGGGTGGGGACTCTGCTCCTGG - Intergenic
1049351592 8:142167530-142167552 CAAGGTGGAGAGGCTGCTGCTGG - Intergenic
1049357709 8:142196865-142196887 CCGGGTGGGGAGGGCGGTGCAGG + Intergenic
1049558683 8:143296686-143296708 CCGTGTGGAGTCGCTGGTGCCGG - Exonic
1049686011 8:143939645-143939667 CAGGGTGGGGCCTCGGGGGCGGG - Intronic
1049744612 8:144257947-144257969 CTGGGTGGGGACGCTGGTGCAGG + Intronic
1049765567 8:144353801-144353823 CAGGTTGGAGCCCCTGGTGCTGG - Exonic
1051208860 9:14720182-14720204 CAAGGTGGTGATGCTGGTGGAGG - Exonic
1051619481 9:19036472-19036494 CAGCATGGGGACCCTGGTCCCGG - Intronic
1051774960 9:20622716-20622738 CAGGGAGGGGACGCAGGAGTGGG + Intergenic
1053464503 9:38295821-38295843 GAGGGTGGGCAAGATGGTGCAGG - Intergenic
1054715227 9:68550808-68550830 CAGGGTGGGTACGCTGGGGATGG + Intergenic
1054906537 9:70418643-70418665 CTAGGTGGGGTCGCTGGAGCTGG - Intergenic
1055154050 9:73038960-73038982 CAGTGTGAGGAATCTGGTGCAGG - Intronic
1056349716 9:85737860-85737882 CAGGGTGGGGAGGCCGGGGAGGG - Intronic
1056632511 9:88305489-88305511 GAGGGTGGGGCCGCTGGAGAGGG - Intergenic
1056805993 9:89729182-89729204 CAGGGTGGAGAGTCTGGTCCTGG + Intergenic
1056966429 9:91166350-91166372 CAGGGTGGAGTCTCTGTTGCTGG - Intergenic
1058539398 9:105995758-105995780 CAGGATGGGGACGCTGGGCCAGG + Intergenic
1058878462 9:109265371-109265393 CAGGGTGGGGCCGCGGGGTCTGG + Intronic
1059284527 9:113161387-113161409 AAGGGTGGGGAAGAAGGTGCAGG + Intronic
1059749872 9:117237879-117237901 CAGAGAGGAGATGCTGGTGCTGG + Intronic
1060941632 9:127546013-127546035 CTGGGTGGTGACGCTGCTGGGGG - Intronic
1061191391 9:129084800-129084822 CAGGGTGGGGGCACTGGGGGTGG - Intronic
1061680520 9:132240664-132240686 CAGGGCGGGGAAGGTGGGGCTGG + Intronic
1062026265 9:134342122-134342144 CGGGGTGGGGGCTCTCGTGCTGG + Intronic
1062334431 9:136058862-136058884 CATGGAGGGGACGCAGGGGCCGG + Intronic
1062341216 9:136094768-136094790 CCGGGTGGGGAAGCCGGGGCAGG - Intronic
1062457537 9:136646633-136646655 CAGGGTGGGGACTATGGGCCCGG + Intergenic
1062609771 9:137368732-137368754 CAGGGTGGGGGCGCAGGGCCGGG + Intronic
1062702171 9:137913016-137913038 CAGTGGGGGGACACAGGTGCTGG + Intronic
1185895506 X:3854863-3854885 CAGTGTGGGGAAACTGGTGGTGG + Intergenic
1185900623 X:3893287-3893309 CAGTGTGGGGAAACTGGTGGTGG + Intergenic
1185905739 X:3931718-3931740 CAGTGTGGGGAAACTGGTGGTGG + Intergenic
1185930131 X:4193522-4193544 GATGGTGGGGACGCTGATGATGG + Intergenic
1186355185 X:8783336-8783358 CTGGGTGGGTACCCAGGTGCTGG - Intergenic
1187154619 X:16712011-16712033 CCGGGTGCGGGCGCTGGCGCGGG + Exonic
1189248559 X:39582040-39582062 CAGGGTGGGGGCAGTGGAGCAGG + Intergenic
1189304898 X:39979600-39979622 CTGGGTGGGGACCCTGGAGATGG - Intergenic
1189450354 X:41123093-41123115 GAGGGTGGGGTCCCTGGTGAGGG - Intronic
1190425218 X:50329232-50329254 CAGAGTGGGGACTCTAGTGAGGG + Intronic
1191714919 X:64187581-64187603 CAGGGTCTGGAGGCTGGTGATGG + Exonic
1192240636 X:69324989-69325011 CAGGGGTGGGAGGCTGGGGCTGG - Intergenic
1197802091 X:130361678-130361700 CATGGTGGGGACTGTGGTCCTGG + Intronic
1198640578 X:138751405-138751427 GAGGGTGGGGAGGCAGGTGGAGG + Intronic
1198981378 X:142400168-142400190 TGGGGTGGGGAAGCTGGAGCAGG - Intergenic
1200052791 X:153443835-153443857 CAGGGTGGGGCCCCTGAGGCAGG + Intergenic
1200115274 X:153767287-153767309 CAGGCTGAGGACCCTGGTGACGG + Exonic
1200176998 X:154123847-154123869 CAGGGTAGGGCAGCTGCTGCAGG + Intergenic
1200424988 Y:3010088-3010110 CACTGTGGGGACGCTGCAGCAGG - Intergenic