ID: 1163384920

View in Genome Browser
Species Human (GRCh38)
Location 19:16993711-16993733
Sequence TGCGATGCCCTGTGAATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163384920_1163384923 12 Left 1163384920 19:16993711-16993733 CCTGAAATTCACAGGGCATCGCA 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1163384923 19:16993746-16993768 TCGCAAAAACAATCCTTAAAGGG 0: 1
1: 0
2: 0
3: 17
4: 233
1163384920_1163384922 11 Left 1163384920 19:16993711-16993733 CCTGAAATTCACAGGGCATCGCA 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1163384922 19:16993745-16993767 ATCGCAAAAACAATCCTTAAAGG 0: 1
1: 0
2: 0
3: 14
4: 163
1163384920_1163384925 26 Left 1163384920 19:16993711-16993733 CCTGAAATTCACAGGGCATCGCA 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1163384925 19:16993760-16993782 CTTAAAGGGAACAAAAAAGAAGG 0: 1
1: 0
2: 7
3: 71
4: 797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163384920 Original CRISPR TGCGATGCCCTGTGAATTTC AGG (reversed) Intronic
901418351 1:9132896-9132918 TGCGATTCCCTATCAATTTGAGG + Intergenic
902034019 1:13443400-13443422 TGCTCTGCCCTCTGGATTTCTGG - Intergenic
902134622 1:14294256-14294278 TGCGATGCCTAGGGAATTGCTGG - Intergenic
907178030 1:52543887-52543909 TGAGATTCCATGTGAATTTTAGG - Intronic
907733154 1:57087165-57087187 TTCTATGCCCTGTGCCTTTCTGG - Intronic
908462669 1:64360764-64360786 TGAGATGCCATATGAATTTTAGG - Intergenic
910277250 1:85462954-85462976 TGTCCTGTCCTGTGAATTTCAGG + Intronic
911253091 1:95601370-95601392 TGCAATGTCCTGTGAAGTTTTGG + Intergenic
911333753 1:96556183-96556205 TGGGATCCCCTGTGGATTTGTGG - Intergenic
912051525 1:105535301-105535323 TGCCATTCCCTGTGCATTTGTGG + Intergenic
913073878 1:115324730-115324752 TGGGCTGCCCTGTGAGTTTCCGG - Intronic
915043431 1:152988668-152988690 TGTGATTCCATGTGAATTTAAGG - Intergenic
915159275 1:153905501-153905523 TGAGATGCCATATGAATTTTAGG - Intronic
915755726 1:158257407-158257429 TGTGATGCTCTGTGAATTTGGGG - Exonic
916418484 1:164614371-164614393 TGTGCTGCCGTCTGAATTTCTGG + Intronic
919868000 1:201797507-201797529 TGCATTTCCATGTGAATTTCAGG + Intronic
920070035 1:203296229-203296251 TGTGTTCCCCTGTGAGTTTCTGG + Intergenic
923025481 1:230200517-230200539 TGAGCTGCCCTGTGAATGACTGG + Intronic
1066676770 10:37896230-37896252 TGAGAAGCCCTGTGAATGTAAGG + Intergenic
1069348253 10:67495441-67495463 TGAGATGGCCAGTGAATCTCAGG - Intronic
1070012916 10:72494251-72494273 GCCCATGCCCTGGGAATTTCTGG + Intronic
1070713979 10:78704091-78704113 TGCAATTCCATGTGAATTTTAGG - Intergenic
1073505277 10:103981818-103981840 TGAGATTCCATGTGAATTTTGGG + Intronic
1073947741 10:108770488-108770510 TGATATGCTGTGTGAATTTCAGG + Intergenic
1075026639 10:118989709-118989731 TGAGATTCCATGTGAATTTTAGG - Intergenic
1075945641 10:126430765-126430787 TGCGATCCCCAGTGAAGTCCTGG + Intronic
1075968419 10:126632553-126632575 TTCAATGCCCAGTGAATTGCTGG + Intronic
1076576117 10:131469880-131469902 TGTAATGCCCTGTTTATTTCTGG + Intergenic
1077449331 11:2626912-2626934 TGAGATTCCATGTGAATTTTAGG + Intronic
1078696622 11:13639261-13639283 TGCTATTCCATGTGAATTTTAGG + Intergenic
1078871363 11:15348205-15348227 TCTGATGGCTTGTGAATTTCAGG - Intergenic
1083338516 11:61943008-61943030 TGCAATTCCATGTGAATTTTAGG - Intergenic
1083383151 11:62284873-62284895 TTTGATAGCCTGTGAATTTCAGG + Intergenic
1086357592 11:86020371-86020393 TGCATTCCCATGTGAATTTCAGG - Intronic
1087646831 11:100817852-100817874 CGCAATGCCCTGTGGATTTTTGG - Intronic
1091651156 12:2311075-2311097 GGTGATGCCCTGTGGATTCCGGG - Intronic
1092628224 12:10351114-10351136 TGTGATTCCATATGAATTTCAGG + Intergenic
1094052227 12:26233207-26233229 TGAAATACCCTGTGAATTACTGG - Intronic
1095781082 12:46060506-46060528 TGCGATTCCATATGAATTTTAGG - Intergenic
1097249015 12:57622145-57622167 GGAGATGCACTGTGAATTACAGG - Intronic
1097847355 12:64380290-64380312 TGTGATAACCTGTCAATTTCTGG + Intronic
1100027986 12:90152726-90152748 TGTGGAGCCCTGTGAATTGCAGG + Intergenic
1104715034 12:131010938-131010960 TCCGATGCCCTCTGACCTTCTGG + Intronic
1105299700 13:19120709-19120731 TGCATTTCCATGTGAATTTCAGG + Intergenic
1105651794 13:22386808-22386830 TGCTATGCTGTGTCAATTTCAGG + Intergenic
1107642605 13:42459252-42459274 TGTCATGCTCTGTGAATTTTTGG + Intergenic
1107647511 13:42510285-42510307 TGTCATGCTCTGTGAATTTTTGG - Intergenic
1108599662 13:51981552-51981574 TGCCCTCCCCTGTGAATTTGTGG - Intronic
1108787672 13:53925401-53925423 TTTGATTCCCTATGAATTTCAGG - Intergenic
1109422696 13:62134239-62134261 TTTTATACCCTGTGAATTTCAGG - Intergenic
1109433147 13:62262999-62263021 TGTGATTCCATGTGAATTTTAGG - Intergenic
1110038757 13:70723655-70723677 TTCGAATCCCTGTGCATTTCTGG - Intergenic
1112971357 13:105266906-105266928 TGCAATCCACTGTGACTTTCTGG - Intergenic
1113546959 13:111160346-111160368 TGTGATTCCATGTGAATTTCAGG + Intronic
1113868159 13:113542745-113542767 TGAGATGCCCTGTGCTTTACAGG + Intronic
1114223024 14:20713983-20714005 TGAGAACCCCTGTGAATTTCTGG - Intergenic
1116412253 14:44638443-44638465 AAAGATGCCCTGTGGATTTCTGG + Intergenic
1118551350 14:66954126-66954148 TGAGATTCCATATGAATTTCAGG + Intronic
1119177101 14:72576897-72576919 TGAGATGCCTTGTGCCTTTCAGG + Intergenic
1121367550 14:93328265-93328287 TGAGATGCCATATGAATTTTAGG - Intronic
1121812529 14:96903962-96903984 TGTGATGCCCTGTGTGGTTCTGG + Intronic
1129182116 15:73884214-73884236 TGCGAGTCTCTGTGAAGTTCCGG - Exonic
1129382373 15:75176398-75176420 TGCGAGGCCCTGTGCACTTTGGG - Intergenic
1131328096 15:91468636-91468658 TGGCCTGCCCTGTGAATTTCAGG - Intergenic
1131630496 15:94171667-94171689 TGAGATTCCCTATCAATTTCAGG - Intergenic
1133375087 16:5279078-5279100 TGTGGTTCCATGTGAATTTCAGG + Intergenic
1134654046 16:15933385-15933407 TGCGATACCATGTGAATTTTAGG - Intergenic
1135029689 16:19028480-19028502 TGCGATTCCATATGAATTTTAGG + Intronic
1137259688 16:46814878-46814900 TGGGATTCCATGTGAATTTTAGG - Intronic
1144612207 17:16730477-16730499 TTTGATTCCCTGTGAATTTTAGG + Intronic
1144900523 17:18584816-18584838 TTTGATTCCCTGTGAATTTTAGG - Intergenic
1145131923 17:20360865-20360887 TTTGATTCCCTGTGAATTTTAGG + Intergenic
1149028330 17:52055912-52055934 AGCTACACCCTGTGAATTTCAGG + Intronic
1150817557 17:68405180-68405202 TGAGATTCCATGTGAATTTTAGG + Intronic
1154461421 18:14592085-14592107 TGGGATGTTCTGTGAATATCTGG - Intergenic
1155013720 18:21810391-21810413 TGAGATTCCTTATGAATTTCTGG - Intronic
1155619489 18:27761071-27761093 TGCGATGCTCTGAAAAATTCTGG + Intergenic
1159754612 18:72348900-72348922 TGCCATGCCATGGGGATTTCAGG + Intergenic
1162270492 19:9610976-9610998 TGAGAAACTCTGTGAATTTCAGG - Exonic
1162665893 19:12211381-12211403 TGAGATTCCCTGTGAATTTTAGG + Intergenic
1163384920 19:16993711-16993733 TGCGATGCCCTGTGAATTTCAGG - Intronic
1166272551 19:41724456-41724478 TGAGATTCCATATGAATTTCAGG + Intronic
1168015781 19:53571776-53571798 CGCTCTCCCCTGTGAATTTCAGG + Intronic
1168259904 19:55187501-55187523 TGTGCTGCCCTGTGAGTCTCGGG - Exonic
1168347497 19:55658052-55658074 TGCGATGCAATGTGAATGTCTGG - Intronic
930393767 2:50794046-50794068 TGGAATGTCCTGTGAATTTTAGG - Intronic
933598825 2:84309027-84309049 GGCCCTGCCCTGTGAATTTCAGG + Intergenic
933618047 2:84504850-84504872 TGCAATTCCATGTGAATTTTAGG + Intergenic
935436454 2:103040274-103040296 TGCAATTCCCTATGAATTTGAGG + Intergenic
936239476 2:110774820-110774842 TGAGATTCCATGTGAATTTTAGG - Intronic
937899672 2:127009498-127009520 TGAGATTCCATATGAATTTCAGG + Intergenic
938021655 2:127910711-127910733 TGAGTTGTCCTGTGAATTTTAGG + Intergenic
938287793 2:130131734-130131756 TGCGTTTCCATGTGAATTTTAGG + Intergenic
938427801 2:131207124-131207146 TGCGTTTCCATGTGAATTTTAGG - Intronic
940886687 2:158995873-158995895 TGCCGTGCCCTGTGCATCTCTGG + Intronic
942089581 2:172476373-172476395 TCGGATGCCCTGTGTATTTCAGG + Exonic
943340363 2:186673399-186673421 TGCGATTCCATGTGGATTTTAGG + Intronic
945872949 2:215246708-215246730 TGCCATGCCCTCTGGCTTTCTGG + Intergenic
1168825055 20:805392-805414 TTTGATAGCCTGTGAATTTCAGG - Intergenic
1168922363 20:1550927-1550949 TGTGGTGCCCTGTGAAATTTGGG - Intronic
1173629745 20:44503262-44503284 TGCATTCCCATGTGAATTTCAGG - Intronic
1179088651 21:38243249-38243271 AGTGTTGTCCTGTGAATTTCAGG - Intronic
1180187023 21:46145172-46145194 TGCCATGGCCTGTGAATGTGGGG + Intronic
951759625 3:26130858-26130880 TGAGATGCCATGTGAATTTTAGG + Intergenic
952177660 3:30883632-30883654 TGAAATGCCATGTGAATTTAAGG + Intronic
952719026 3:36513255-36513277 TGCGATGCTCTGTACATTGCTGG - Intronic
953810916 3:46112191-46112213 TGCGGTGCCTAGTGAATTTAAGG - Intergenic
954470796 3:50693215-50693237 TGAGATTCCATATGAATTTCAGG + Intronic
955478932 3:59369453-59369475 TGCAATGCCCTTTGAGCTTCAGG + Intergenic
959385930 3:105706476-105706498 TGTGAGGCCCTGTGACTTTCTGG - Intronic
969039089 4:4280427-4280449 TGAGATTCCCTGTGAGTTTTAGG - Intronic
970693890 4:18652896-18652918 TGTGATACACTGTGAATATCTGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975133740 4:70853663-70853685 TGCTATGCCCTGTGAATTCAGGG + Intergenic
975322692 4:73026174-73026196 TGTGATGCCCTGTGATGATCAGG + Intergenic
976432927 4:84984222-84984244 TGCAATCCCCTCTGAATTTTGGG + Intergenic
977283151 4:95067799-95067821 TGAAATGCCCTGTGGATTTAAGG + Intronic
977983776 4:103358700-103358722 TGCAATTCCATGTGAATTTTAGG + Intergenic
980759180 4:137205987-137206009 TGTGATTCCATGTGAATTTCAGG + Intergenic
980883882 4:138741013-138741035 TGCAAAGCCCTGTGTATTTCAGG - Intergenic
981180701 4:141740583-141740605 TGCGATTCCTTATGAATTTGGGG - Intergenic
981745932 4:148052459-148052481 TGGGAAGCTCTGTAAATTTCAGG + Intronic
983093185 4:163530210-163530232 AGCGTTACCCTGTCAATTTCTGG + Intronic
985273321 4:188215448-188215470 AGCCTTGCCCTGTGACTTTCTGG - Intergenic
985485873 5:148725-148747 TGAGATTCCCTATGAATTTCAGG - Intronic
987069273 5:14320693-14320715 TGCGATGCTCTGAAAGTTTCAGG + Intronic
990344459 5:54857698-54857720 TGAGAAACTCTGTGAATTTCAGG + Intergenic
992945673 5:81807614-81807636 TGTGGTTCCCTGTGAATTTTAGG - Intergenic
993120934 5:83773655-83773677 TGCGATGCCATGGCAATGTCTGG + Intergenic
1000639325 5:163682920-163682942 TCCGATGGCGTGTGAATTGCTGG + Intergenic
1002354822 5:178617594-178617616 AACTGTGCCCTGTGAATTTCTGG - Intronic
1005601929 6:27435138-27435160 TGAGATACCATGTGAATTTTAGG + Intergenic
1006244640 6:32720525-32720547 TGGATTGCCCTGTGATTTTCTGG + Intergenic
1006687452 6:35848204-35848226 TGTGATTCCATGTGAATTTTAGG - Intronic
1012790076 6:103682195-103682217 TCCTGTGCCCTGTGAACTTCAGG - Intergenic
1015257272 6:131192573-131192595 TGTGATTCCATGTGAATTTTAGG + Intronic
1016423084 6:143905056-143905078 TGAGATTCCATGTGAATTTTAGG + Intronic
1017655857 6:156628954-156628976 TGCATTGCCCTGTGACTTTATGG - Intergenic
1019044830 6:169137136-169137158 TGCGATTCCATGTGAATTTTAGG - Intergenic
1020873215 7:13660551-13660573 TGGGATTCCATGTGAATTTTAGG - Intergenic
1023989096 7:45117517-45117539 TGAGATGTTCTGTGGATTTCTGG - Intergenic
1024490136 7:49972731-49972753 TGAGATTCCATGTGAATTTTAGG - Intronic
1026223468 7:68420577-68420599 TTAGGTGCCCTGTGATTTTCTGG - Intergenic
1027624496 7:80529551-80529573 TGCCATGCTCTTGGAATTTCTGG + Intronic
1030476731 7:110043593-110043615 TGCAATGCCTGGTCAATTTCTGG - Intergenic
1035564670 8:633539-633561 TGAGATTCCATGTGAATTTAGGG - Intronic
1040035042 8:42861750-42861772 TGGGTTGCCCTGAGAATCTCCGG + Exonic
1040656058 8:49509414-49509436 TGAGATTCCATGTGAATTTTAGG - Intergenic
1044920099 8:97160632-97160654 TGAGATTTCATGTGAATTTCAGG + Intergenic
1047076851 8:121413706-121413728 TACTCTGCCCTGTGAATTTTAGG - Intergenic
1048351025 8:133616666-133616688 TGCAATGGCCTGTGAACTTGTGG - Intergenic
1049921219 9:366249-366271 TGCTGTACCCTGTGACTTTCTGG - Intronic
1050470388 9:5982566-5982588 TGTGATGCCCTGTGCAGTTTCGG + Intronic
1053820750 9:41965268-41965290 TGAGGTTCCCTGTGAATTTTAGG - Intronic
1061815823 9:133195097-133195119 TGAGATTCCATGTGAATTTTGGG - Intergenic
1186117007 X:6314801-6314823 TGCAATTCCATGTGAATTTCAGG + Intergenic
1187242811 X:17528944-17528966 TGTGTTGCCCTGTGTATATCTGG + Intronic
1189374528 X:40456444-40456466 TGGCCTGTCCTGTGAATTTCAGG + Intergenic
1192730142 X:73794865-73794887 TGCCATGCACTATGAATTTGCGG - Intergenic
1192843460 X:74881569-74881591 AGAGCTGCCCTGTGAATTTTAGG + Intronic
1193913484 X:87335225-87335247 TTTGGTGCCCTGTGAATTTTAGG + Intergenic
1194115377 X:89889777-89889799 TGCTATGCCCTGGGAATTGGAGG - Intergenic
1201257386 Y:12122432-12122454 TGCCATGTCCTCTGCATTTCTGG - Intergenic
1201437422 Y:13974643-13974665 TGCAATTCCATGTAAATTTCAGG - Intergenic